ID: 994102408

View in Genome Browser
Species Human (GRCh38)
Location 5:95908348-95908370
Sequence AAAATCCTCACTTAGCATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994102401_994102408 28 Left 994102401 5:95908297-95908319 CCTTTCACAGATGAGAAAACTGA 0: 9
1: 90
2: 457
3: 1295
4: 2689
Right 994102408 5:95908348-95908370 AAAATCCTCACTTAGCATTTGGG 0: 1
1: 0
2: 2
3: 16
4: 237
994102399_994102408 30 Left 994102399 5:95908295-95908317 CCCCTTTCACAGATGAGAAAACT 0: 5
1: 105
2: 950
3: 4027
4: 10180
Right 994102408 5:95908348-95908370 AAAATCCTCACTTAGCATTTGGG 0: 1
1: 0
2: 2
3: 16
4: 237
994102400_994102408 29 Left 994102400 5:95908296-95908318 CCCTTTCACAGATGAGAAAACTG 0: 58
1: 807
2: 3532
3: 9066
4: 16217
Right 994102408 5:95908348-95908370 AAAATCCTCACTTAGCATTTGGG 0: 1
1: 0
2: 2
3: 16
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994102408 Original CRISPR AAAATCCTCACTTAGCATTT GGG Intronic