ID: 994102408 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:95908348-95908370 |
Sequence | AAAATCCTCACTTAGCATTT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 256 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 16, 4: 237} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
994102401_994102408 | 28 | Left | 994102401 | 5:95908297-95908319 | CCTTTCACAGATGAGAAAACTGA | 0: 9 1: 90 2: 457 3: 1295 4: 2689 |
||
Right | 994102408 | 5:95908348-95908370 | AAAATCCTCACTTAGCATTTGGG | 0: 1 1: 0 2: 2 3: 16 4: 237 |
||||
994102400_994102408 | 29 | Left | 994102400 | 5:95908296-95908318 | CCCTTTCACAGATGAGAAAACTG | 0: 58 1: 807 2: 3532 3: 9066 4: 16217 |
||
Right | 994102408 | 5:95908348-95908370 | AAAATCCTCACTTAGCATTTGGG | 0: 1 1: 0 2: 2 3: 16 4: 237 |
||||
994102399_994102408 | 30 | Left | 994102399 | 5:95908295-95908317 | CCCCTTTCACAGATGAGAAAACT | 0: 5 1: 105 2: 950 3: 4027 4: 10180 |
||
Right | 994102408 | 5:95908348-95908370 | AAAATCCTCACTTAGCATTTGGG | 0: 1 1: 0 2: 2 3: 16 4: 237 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
994102408 | Original CRISPR | AAAATCCTCACTTAGCATTT GGG | Intronic | ||