ID: 994102493

View in Genome Browser
Species Human (GRCh38)
Location 5:95909115-95909137
Sequence ATGGAGAAGACAAATAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 420}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994102482_994102493 20 Left 994102482 5:95909072-95909094 CCAAGGTCTACTGGGTTTATCCC 0: 1
1: 0
2: 0
3: 6
4: 69
Right 994102493 5:95909115-95909137 ATGGAGAAGACAAATAAGGGAGG 0: 1
1: 0
2: 4
3: 36
4: 420
994102485_994102493 -1 Left 994102485 5:95909093-95909115 CCCATGCTTCCCCAAAGCAGGTA 0: 1
1: 0
2: 1
3: 13
4: 159
Right 994102493 5:95909115-95909137 ATGGAGAAGACAAATAAGGGAGG 0: 1
1: 0
2: 4
3: 36
4: 420
994102486_994102493 -2 Left 994102486 5:95909094-95909116 CCATGCTTCCCCAAAGCAGGTAT 0: 1
1: 0
2: 0
3: 12
4: 209
Right 994102493 5:95909115-95909137 ATGGAGAAGACAAATAAGGGAGG 0: 1
1: 0
2: 4
3: 36
4: 420
994102488_994102493 -10 Left 994102488 5:95909102-95909124 CCCCAAAGCAGGTATGGAGAAGA 0: 1
1: 0
2: 2
3: 14
4: 233
Right 994102493 5:95909115-95909137 ATGGAGAAGACAAATAAGGGAGG 0: 1
1: 0
2: 4
3: 36
4: 420
994102484_994102493 0 Left 994102484 5:95909092-95909114 CCCCATGCTTCCCCAAAGCAGGT 0: 1
1: 0
2: 1
3: 25
4: 230
Right 994102493 5:95909115-95909137 ATGGAGAAGACAAATAAGGGAGG 0: 1
1: 0
2: 4
3: 36
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994102493 Original CRISPR ATGGAGAAGACAAATAAGGG AGG Intronic
901120278 1:6886079-6886101 AAGGAAAACAAAAATAAGGGAGG - Intronic
902005038 1:13225538-13225560 ATGGAGAAGAGACAGAAGGAGGG - Intergenic
902024264 1:13371332-13371354 ATGGAGAAGAGACAGAAGGAGGG - Intronic
903189612 1:21649360-21649382 ATAGAGAAGAAAAAAAAGGAAGG + Intronic
903571143 1:24306380-24306402 ATGGGGAAGAGAAAGAAGGATGG + Intergenic
907886054 1:58593295-58593317 ATGGGGAAGGGAAAGAAGGGAGG - Intergenic
907948252 1:59155439-59155461 ATGGAGAAAACAAGTATGGGTGG + Intergenic
909470989 1:76027878-76027900 AAGGAGAAGCCAAATCAGAGTGG + Intergenic
910005825 1:82395973-82395995 AGTTAGAAGAGAAATAAGGGAGG - Intergenic
910301240 1:85709104-85709126 ATGGTTAACACAGATAAGGGTGG - Intergenic
910669489 1:89758587-89758609 ATAGAGAATAAAAATAATGGAGG + Intronic
911265638 1:95740123-95740145 AAGAAGAAAACAAATAAGGAAGG - Intergenic
911880207 1:103227939-103227961 ATCTTGAGGACAAATAAGGGAGG + Intergenic
912015171 1:105025584-105025606 ATGGAGAAAACATTTATGGGGGG - Intergenic
912740117 1:112186602-112186624 AAGGAGAATACAAAGAAGGGAGG - Intergenic
913166789 1:116194969-116194991 ATAGAGAGGACAAAAAAGGCAGG + Intergenic
913365559 1:118034193-118034215 ATGGATGAGACAGATAAGGAGGG + Intronic
913963525 1:143356630-143356652 ATGGAGGAGAAAAAGAAGTGAGG - Intergenic
914057883 1:144182219-144182241 ATGGAGGAGAAAAAGAAGTGAGG - Intergenic
914121263 1:144784146-144784168 ATGGAGGAGAAAAAGAAGTGAGG + Intergenic
914709905 1:150203610-150203632 ATAGAGATGATAAATAAGGTTGG - Intergenic
914742687 1:150478592-150478614 ATTGAGAATACAGATATGGGTGG + Intergenic
914964655 1:152244181-152244203 ATGGAGAAGAAGGAGAAGGGAGG - Intergenic
915897478 1:159823268-159823290 ATGGAGAAGGGAAAGAAAGGTGG - Intergenic
917322046 1:173792803-173792825 ATGGAGAGGAGAAGTAAGAGTGG - Intergenic
918569452 1:185971386-185971408 ATGAGGTAGACAAAAAAGGGAGG - Intronic
919580330 1:199364490-199364512 ATGGAAAAGAAAAAAAAGGCAGG - Intergenic
919782250 1:201228563-201228585 TTGGGGAAGAAAAACAAGGGAGG + Exonic
919977344 1:202621259-202621281 AAGGAGAAAACAAATGAGGGGGG + Intronic
920313436 1:205061717-205061739 ATGGAGAGGACAAAGAGGAGGGG - Intronic
920905846 1:210166640-210166662 AAGGAGAAGGGAAAGAAGGGAGG + Intronic
920922226 1:210307524-210307546 ATGGAGTAGAAACAGAAGGGAGG - Intergenic
920952118 1:210582264-210582286 GGGGAGAAGGGAAATAAGGGTGG + Intronic
921710096 1:218365235-218365257 AAGGAAAAGCCAAAAAAGGGGGG - Intronic
921933523 1:220775156-220775178 AGAGAGAAGTGAAATAAGGGTGG - Intronic
921979133 1:221236016-221236038 AAGGAGGAGAGAAAGAAGGGAGG + Intergenic
922038109 1:221869697-221869719 CTGGAGAAGAGAAATAAGTTAGG + Intergenic
923985801 1:239380414-239380436 AGGGAGAGGAAAAAAAAGGGGGG + Intergenic
1063718438 10:8553716-8553738 ATGGAGAAGAAGAATTCGGGTGG + Intergenic
1067535552 10:47107327-47107349 ATGGAGAAGCCCAACCAGGGAGG + Intergenic
1068109186 10:52659206-52659228 ATGGATAAGGAAACTAAGGGGGG - Intergenic
1068813358 10:61281648-61281670 AAGAAGAAGACAGATAAGGTAGG + Intergenic
1069098520 10:64289324-64289346 GGGGAGAAGAGAAATAAGAGAGG + Intergenic
1071191960 10:83111106-83111128 ATGGAAAACAGAAAAAAGGGGGG + Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071897109 10:90079684-90079706 AAGGAGAAGACAAATATAGTTGG + Intergenic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1074305957 10:112278726-112278748 GAGGGGAAGACAGATAAGGGAGG + Intergenic
1074729184 10:116350239-116350261 ATTGAGAACACAGTTAAGGGAGG + Intronic
1075100522 10:119503079-119503101 ATGGAGAATGCAACTAAGGCCGG + Intronic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075918705 10:126191590-126191612 ATGGAGAAGACTAAGGTGGGGGG + Intronic
1076039497 10:127232040-127232062 ATGGAGAAGGCAGAAAAGGAGGG + Intronic
1076448879 10:130541472-130541494 AAGGAGAAGAAAAAGAGGGGAGG - Intergenic
1077600792 11:3573114-3573136 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1078244178 11:9558393-9558415 TTTGAAAAGACAAATAAGGCCGG - Intergenic
1078738241 11:14041768-14041790 ATTGAGAATTCAGATAAGGGAGG - Intronic
1078821315 11:14885775-14885797 ATGAAGATGACAAAAATGGGAGG - Exonic
1079005712 11:16789988-16790010 AGGAAGAAGAGAAATAAGGGTGG - Intronic
1081065429 11:38534612-38534634 CTGGAGAAGACAAGGCAGGGTGG + Intergenic
1081331120 11:41801332-41801354 AAGGAGAAAACAAATGTGGGTGG - Intergenic
1081516474 11:43835837-43835859 AAGGAGCAAACAAGTAAGGGAGG + Intronic
1084256712 11:67947699-67947721 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1084653786 11:70503663-70503685 ATGGTGAGGACAAATAGGGCAGG - Intronic
1084816078 11:71647675-71647697 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1087149229 11:94843679-94843701 ATGGAGGAGAAACATTAGGGAGG + Intronic
1087265400 11:96055117-96055139 ATGTAGAAGTCAATTAAGGGAGG - Intronic
1087398326 11:97632031-97632053 AAAGACAAGACACATAAGGGAGG - Intergenic
1088086796 11:105990761-105990783 ATGGAAAAGGCAAAGCAGGGTGG + Intergenic
1088316611 11:108513336-108513358 ATGGACCAGACAAACAAGGCAGG - Exonic
1089201325 11:116726245-116726267 AAGGAGAAAACAAAGTAGGGAGG + Intergenic
1089363620 11:117907644-117907666 TTGGAGAAGACAGGTAATGGGGG - Intronic
1090189662 11:124759795-124759817 AGGCAGAAGACAATGAAGGGGGG + Intronic
1091521482 12:1248493-1248515 GTGGAGAAGACAAAAAATTGAGG + Intronic
1091632367 12:2171576-2171598 AGGGAGAAAACGAAGAAGGGAGG - Intronic
1092426926 12:8382372-8382394 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1092678337 12:10947452-10947474 ATGGAAAACAGAAAAAAGGGGGG - Intronic
1092719801 12:11430603-11430625 AGGGAGAAGACAAGGGAGGGAGG - Intronic
1092990537 12:13893320-13893342 ATGCAGAAGACAGATAGTGGAGG + Intronic
1093431804 12:19093260-19093282 ATGGAGCAGTCCACTAAGGGAGG - Intergenic
1093535292 12:20216277-20216299 TTGGAGAAGAGAAAGAAGCGTGG + Intergenic
1095345308 12:41142674-41142696 ATGCAGGAGGCAGATAAGGGAGG - Intergenic
1096915625 12:55029147-55029169 ATGGAGATAATAAATAAGAGAGG - Exonic
1097868029 12:64576118-64576140 TTGGAGAAGACAAAAATGGGAGG + Intergenic
1098416036 12:70236541-70236563 AAGGAGAAGCCAAATAAATGAGG - Intergenic
1098853102 12:75621037-75621059 TTGAAGAAGAGAAATAAGGTAGG + Intergenic
1099552334 12:84063386-84063408 ATGGAGAATACTAATTAGAGAGG - Intergenic
1100563098 12:95768763-95768785 ACGCAGAAGAAAAATAAGAGTGG + Intronic
1101905285 12:108820231-108820253 CTGGAGAGGACAGATAAGAGGGG - Intronic
1102353920 12:112216374-112216396 ATGAAAAATACAAAGAAGGGAGG + Intronic
1102943896 12:116968246-116968268 ATGGAGCAGACAAAAGTGGGTGG - Intronic
1106448551 13:29858940-29858962 TGTGAGAAGACAAAAAAGGGTGG - Intergenic
1106923009 13:34584698-34584720 ATTGACAAGAGAAATAAAGGTGG + Intergenic
1107517516 13:41145581-41145603 ATGCAGGAGACAGATAAGGGAGG + Intergenic
1107571442 13:41663306-41663328 ATGGAAAAGAGGAATGAGGGTGG - Intronic
1109148443 13:58812925-58812947 ATGGTGAAAACAAATTATGGTGG + Intergenic
1110465551 13:75796812-75796834 AAGGAGAAGAAAAAGAAGAGAGG - Intronic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111545504 13:89728629-89728651 ATTGAGAAGAAAAACAAGGTAGG - Intergenic
1111904253 13:94237299-94237321 ATGGAGAAAAGAAAGAAGGAAGG - Intronic
1113014291 13:105809943-105809965 ATGGAAAAGACTAAAAATGGGGG - Intergenic
1113709999 13:112456885-112456907 AAGGAAAAGACAAAGAGGGGAGG + Intergenic
1116745595 14:48814566-48814588 GAGGAGAAGCCAAATAAGAGTGG + Intergenic
1117265340 14:54080486-54080508 ATGGGGAAGAGAAATATGGATGG - Intergenic
1117730800 14:58719991-58720013 ATGGAGAAGGCAAAAATGGAAGG + Intergenic
1118554939 14:67007878-67007900 ATGGAGAAAATAAAAAAGGGAGG + Intronic
1118907555 14:70033625-70033647 TTGGGGAAGAGAAATAAGGCAGG + Intergenic
1120409053 14:84128281-84128303 AATGAGAAGAAAAATAATGGGGG + Intergenic
1120688876 14:87570338-87570360 AAGGAGCATGCAAATAAGGGTGG - Intergenic
1121029741 14:90647853-90647875 ATGGAGCAGACTAATTAGGTGGG + Intronic
1121038618 14:90727049-90727071 AAGGAGAAGAAAAAGAGGGGTGG + Intronic
1121042449 14:90760204-90760226 ATGGAGAAGATAAACAGAGGTGG + Intronic
1121976942 14:98413602-98413624 GTGGAAAAGACAAATGAGGGGGG + Intergenic
1122316460 14:100828404-100828426 AGGGAGAAGAAAAATAGGAGGGG - Intergenic
1124493003 15:30169640-30169662 AAGGAGAAAACAAACGAGGGGGG + Intergenic
1124750531 15:32368685-32368707 AAGGAGAAAACAAATGAGGGGGG - Intergenic
1124827668 15:33114858-33114880 ATGGATAGGCAAAATAAGGGAGG - Intronic
1125005863 15:34816935-34816957 CTGGAGAAGAGAAAAAAGGGGGG + Intergenic
1125281052 15:38043132-38043154 ATGGGGAAGAAAGATAAGGCTGG - Intergenic
1125486718 15:40116253-40116275 ATGCAGGAGACAAGCAAGGGAGG + Intergenic
1125826768 15:42683058-42683080 ATGGAGAAAAGAAACAAGGAAGG - Intronic
1126154438 15:45552335-45552357 ATGGAAAAGAGAAGTAAGGCAGG - Intergenic
1126196264 15:45935578-45935600 ATAGAGAAAACAAATAAGGGAGG + Intergenic
1127747434 15:61994217-61994239 ATGCAGTAGACAAAGAAGGATGG - Intronic
1129569790 15:76668628-76668650 AAGGAGATGACAAATAATAGAGG - Intronic
1129876961 15:78981952-78981974 ATGGAGAAGAAAAGGAAGGAGGG - Intronic
1129929855 15:79401738-79401760 ATGGAAAAGAGAAACGAGGGTGG + Intronic
1130072691 15:80661808-80661830 ATGGAGAGTAGAAAGAAGGGTGG - Intergenic
1130301305 15:82681265-82681287 ATGGAGGAGAACAATAAGGCTGG - Intronic
1131321113 15:91392103-91392125 CTGGAGAAGACAAATATGGATGG + Intergenic
1131333542 15:91525275-91525297 ATGAAGAAGAGAAATAGGCGTGG + Intergenic
1133371335 16:5247992-5248014 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1135637683 16:24093057-24093079 ATGGAGAAGACAGAAAAGGAGGG - Intronic
1135923833 16:26674702-26674724 ATGGGGAAGAGAAAGAGGGGTGG + Intergenic
1136289267 16:29261798-29261820 ATGGGAAAGACAAACACGGGCGG - Intergenic
1137889387 16:52142763-52142785 ATTGAGCACACAAATAAGTGGGG + Intergenic
1140039298 16:71395250-71395272 ATGGAGAAGACAGACCAGAGAGG + Intergenic
1142095002 16:88234755-88234777 ATGGGAAAGACAAACACGGGCGG - Intergenic
1146564595 17:33901476-33901498 ATGAAAAAGAGGAATAAGGGAGG - Intronic
1147361860 17:39935900-39935922 ATAGAGAAGATAGATAAGGAAGG - Intergenic
1149094317 17:52822626-52822648 ATGGACCAAAAAAATAAGGGAGG + Intergenic
1150535520 17:66035393-66035415 CAGGTGAAGACAAATAAGGATGG - Intronic
1150974830 17:70073566-70073588 ATGGAGAAGAGCAAGACGGGAGG - Intronic
1151180042 17:72320700-72320722 AAAGAGAAAAGAAATAAGGGAGG + Intergenic
1152370808 17:79887419-79887441 ATGGAGGGGACTAAGAAGGGTGG + Intergenic
1153091297 18:1346983-1347005 TTGGAGAGGAAAATTAAGGGTGG - Intergenic
1153123021 18:1754487-1754509 ATGAAGAAAACTAATAAAGGGGG + Intergenic
1155113701 18:22742596-22742618 AAGGAGATGACAAATCAGAGTGG + Intergenic
1155242515 18:23877116-23877138 TTGGAGAAGACAGATGAGGGAGG + Intronic
1156310849 18:35920434-35920456 CTGGATAAGACCACTAAGGGAGG + Intergenic
1156419494 18:36935306-36935328 AAGGAGAAGAGGAAAAAGGGAGG - Intronic
1157379145 18:47195232-47195254 ATGAAGAAGACAAAGAGGAGAGG + Intergenic
1157615490 18:48985005-48985027 ATGGAGAGGAGAAATAGGAGAGG + Intergenic
1157763301 18:50280702-50280724 AAGGAGAAGAAAAATAAGGGGGG - Intronic
1158490768 18:57907491-57907513 ATGGAGAAAAGAAATTAGGATGG + Intergenic
1158585743 18:58732723-58732745 ATGGAGGAGACAAATGAGTCAGG + Intronic
1158586088 18:58736373-58736395 ATGTAGAAAACAAATAAAAGTGG - Intronic
1158791752 18:60788344-60788366 ATGCACAAGACAGAAAAGGGGGG + Intergenic
1158917914 18:62154776-62154798 ATGGGGAAGAGAAAAATGGGAGG + Intronic
1158925444 18:62253086-62253108 ATGAAGAAGAAAAATAAAGCAGG + Intronic
1159234226 18:65650330-65650352 ATGGAGAAGAAAGATAGTGGAGG + Intergenic
1159238073 18:65703426-65703448 AGGGAGAAGAGAAACAAGGAGGG + Intergenic
1159436907 18:68429825-68429847 ATGGAGAAAACAAGGGAGGGAGG + Intergenic
1159816221 18:73077111-73077133 CAGGAGAAGACAAATAATGGAGG - Intergenic
1160356183 18:78229797-78229819 ATGAAGAAGAGAAAGGAGGGAGG - Intergenic
1165121781 19:33564419-33564441 ATGGAGGAGATCAATAAGTGAGG - Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165834256 19:38744593-38744615 ATGGAGAAGAAACATGAAGGCGG - Intronic
1166174875 19:41060540-41060562 ATGAAGATGAGAAATAAGGTTGG + Intergenic
1167430259 19:49450076-49450098 AAGGAGAAAACAAAGAAGAGAGG - Intronic
1168258498 19:55179939-55179961 ATGGAGAAGACAAAGAGCCGAGG - Intronic
1202697366 1_KI270712v1_random:134887-134909 ATGGAGGAGAAAAAGAAGTGAGG - Intergenic
926779685 2:16458427-16458449 AAGGAGAAGACAAAGATGTGGGG - Intergenic
926875399 2:17471164-17471186 ATGGAGAAGCCAAATTAAAGTGG - Intergenic
926909703 2:17840632-17840654 GTGGAGAAGACACATAGGTGTGG + Intergenic
926938548 2:18112001-18112023 ATGGAGAAGATAAAGATGGGAGG + Intronic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
928589808 2:32802768-32802790 ATGGGGAAGAAAAATAATTGAGG - Intronic
928782497 2:34841229-34841251 ATAGAGCAGAAAATTAAGGGAGG + Intergenic
929879639 2:45824605-45824627 AAGGAGGAGAAAAAGAAGGGAGG - Intronic
930047153 2:47182791-47182813 ATGGAGAAGAGAAAGAAGATGGG - Intergenic
930077428 2:47418317-47418339 ATGGAGCTGACAGAGAAGGGGGG - Intronic
930264971 2:49189124-49189146 ATGGAGAAAACAAGTGGGGGAGG - Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930836650 2:55801223-55801245 CTGGAGAAAACAAAAAAGGAGGG - Intergenic
930880473 2:56264553-56264575 ATGCAGGAGACAAATGATGGTGG - Intronic
931999789 2:67874159-67874181 ACGAAGAAGACAAAAAAGGATGG - Intergenic
932089152 2:68789635-68789657 CTGGAGAAAACAGAAAAGGGTGG - Intronic
932490440 2:72116492-72116514 AGAGTGAAGACAAGTAAGGGTGG - Intergenic
933539017 2:83615533-83615555 ATGAAGAAGATAAAGAAAGGAGG + Intergenic
934278534 2:91591912-91591934 ATGGAGGAGAAAAAGAAGTGAGG - Intergenic
935090950 2:99894340-99894362 AGGGAGGAGAGAAAAAAGGGAGG + Intronic
935154097 2:100466811-100466833 ATTATGAAGTCAAATAAGGGTGG - Intergenic
935206000 2:100896833-100896855 ATGAAGAAGAAAAGGAAGGGAGG - Intronic
935660221 2:105460464-105460486 ATGGAGAAGAAAAATGTAGGAGG + Intergenic
936927130 2:117748877-117748899 ATGGAGAAGCCAAATAGAGATGG + Intergenic
937220931 2:120343066-120343088 ATGCAGGAGACAGACAAGGGAGG + Intergenic
937520109 2:122703381-122703403 AAGGAGAAGAAAAAGAGGGGAGG + Intergenic
937535059 2:122876100-122876122 ATGGAGAAGATAGAGGAGGGTGG - Intergenic
937737246 2:125307084-125307106 ATGAAGAAGAGAAACAAAGGAGG + Intergenic
939086591 2:137726575-137726597 ATGGAGAAGGCAAATAATACTGG - Intergenic
939516422 2:143174117-143174139 ACGGAGAGTACAAATAAAGGAGG - Intronic
939901069 2:147850163-147850185 AGGGAGTAGACAAAGAAGGGAGG - Intronic
940117409 2:150224227-150224249 ATGCAGAACTCTAATAAGGGAGG + Intergenic
940353894 2:152718178-152718200 AGGGAGAAGACAAATAGGTTCGG + Exonic
941216798 2:162720787-162720809 ATGTCGAAGACAAACAAGTGAGG - Intronic
941332619 2:164197383-164197405 TTGAAGAAGACAAATATGGCTGG - Intergenic
941867603 2:170351006-170351028 AGGGAGAAAAGAAAAAAGGGAGG + Intronic
941940228 2:171028875-171028897 ATGAAGAAGGCAAAAAAGGATGG + Intronic
941962509 2:171268001-171268023 ATGGGGCAGACACATAATGGGGG - Intergenic
942907460 2:181200953-181200975 ATGAAGAAGAGAAATAGGGGAGG + Intergenic
943232064 2:185266039-185266061 ATGGGGATGACAAATCAAGGTGG + Intergenic
943437216 2:187881104-187881126 ATGAGGAAGAGAAAGAAGGGGGG + Intergenic
943860067 2:192850169-192850191 ATAGAGAAGCCTAAGAAGGGGGG - Intergenic
944153291 2:196585072-196585094 ATGGCAAAGACAAACAAGGAAGG - Intronic
944755786 2:202760462-202760484 AAGGCGAAGACAAAGAGGGGAGG - Intronic
945000787 2:205347928-205347950 CTGGGGAAGATAAAAAAGGGAGG + Intronic
945201369 2:207285088-207285110 ATGGAGATGAGAGATAAGGCTGG + Intergenic
946642057 2:221794618-221794640 CTGGAGAAGACACACAAAGGAGG + Intergenic
946994600 2:225377083-225377105 ATGGGGCTGAAAAATAAGGGAGG - Intergenic
947202562 2:227627900-227627922 ATGAAGAAGACTAATCTGGGTGG - Intronic
947766648 2:232642086-232642108 ATGAAAAAGACAAATGAGGCCGG + Intronic
948489475 2:238303237-238303259 ATGGAGACGACAAAGAAGAATGG - Intergenic
949080489 2:242094413-242094435 ATGGAGAAGTCATTTAAGGCTGG - Intergenic
1168790785 20:574512-574534 ATGGAGAAAACAAGGATGGGTGG - Intergenic
1169546710 20:6657800-6657822 AAGGAAGAGAAAAATAAGGGAGG + Intergenic
1169894789 20:10491414-10491436 ATGGAGAAGACAAAGGAGCAAGG - Intronic
1169904614 20:10589422-10589444 ATGAAGAAGAAAAATAATGTTGG + Intronic
1170208101 20:13821360-13821382 ATGGAGAAGACCTAGAAGTGAGG + Exonic
1170529913 20:17281004-17281026 AAGGAGAAGGCAAATATGGCGGG - Intronic
1171178743 20:23075575-23075597 ATGGAAAAGAAAAAGAAGGCCGG + Intergenic
1172025207 20:31943672-31943694 ATGGACAAGACAGACCAGGGAGG + Exonic
1172788730 20:37487682-37487704 AAGGGGAAGACAAGTGAGGGTGG - Intergenic
1172945831 20:38688534-38688556 ATGGAGATGACATACAAGGAGGG - Intergenic
1173133269 20:40414590-40414612 AGGGAGAAGCCAAAGAAGGGAGG + Intergenic
1174180233 20:48669838-48669860 ATGGAGAAGGCAAAGTGGGGTGG + Intronic
1174871512 20:54186755-54186777 ATGGAGTACACCATTAAGGGAGG - Intergenic
1175042864 20:56072197-56072219 AAAGAGAATACAAAGAAGGGAGG + Intergenic
1176986502 21:15443535-15443557 TTGGAGAAGAAAGAAAAGGGTGG + Intergenic
1177722231 21:24922503-24922525 AATGAGAAGACAGAGAAGGGAGG - Intergenic
1178057858 21:28819524-28819546 AAGGAAAAGAAAAATAAAGGTGG - Intergenic
1178778721 21:35578486-35578508 ATTCAGAAGACAAATGAGGCAGG + Intronic
1178889515 21:36509476-36509498 ATGGAGAAGATACATATGGTTGG + Intronic
1179047210 21:37856626-37856648 AGAGAGAACACAAATAAAGGAGG + Intronic
1179302309 21:40123742-40123764 ATGGAGGAGGGAAAGAAGGGAGG + Intronic
1182021847 22:27088323-27088345 ATGGAGAAGCCACATGTGGGTGG - Intergenic
1182156595 22:28079228-28079250 AAGGAGAAGACAGATAAGATAGG + Intronic
1182263153 22:29090652-29090674 TTGAAGAAAAAAAATAAGGGAGG + Intronic
1182365407 22:29775570-29775592 ATGGCAAAGAAAAATAACGGTGG - Intergenic
1182458215 22:30466085-30466107 ATGGACAGGAGAAATAAGGGAGG + Intronic
1183137407 22:35902331-35902353 ATGGAGAGGACAAATGATTGAGG - Intronic
949322725 3:2829143-2829165 ACGGGGAAGAGAAAAAAGGGAGG - Intronic
949690831 3:6636996-6637018 ATGGAGAATCTAAATTAGGGTGG - Intergenic
950980970 3:17304046-17304068 GTGGAGAAGACAGAGAATGGAGG - Intronic
951729598 3:25796061-25796083 AAGGAGAAGATAAAGAAGGAAGG + Intergenic
951853698 3:27170921-27170943 ATGGAGAGGAGAAATGAGAGAGG - Intronic
952057128 3:29461318-29461340 ATGGAGAAGAGAAAACAGTGAGG - Intronic
952142679 3:30497603-30497625 ATGGAAATGAGAAAGAAGGGTGG + Intergenic
952985528 3:38777644-38777666 TTCAAGAAGACAAATAAGGAGGG + Intronic
953594069 3:44291259-44291281 ATAGAGAAAGTAAATAAGGGAGG - Intronic
954353204 3:50062852-50062874 AAAGAGAAGACAAATAATGTAGG - Intronic
956695087 3:71911902-71911924 ATGGTGAAAAGAAATAAGGATGG + Intergenic
956952264 3:74296253-74296275 GAGGAGAAGAAAAATGAGGGAGG + Intronic
957416903 3:79917295-79917317 ATGGACTAGATAAAAAAGGGTGG + Intergenic
958448595 3:94245450-94245472 ATGGAGAAGTCATACAATGGAGG + Intergenic
958863996 3:99479453-99479475 ATGGATAAGACCAATAAGATGGG - Intergenic
959502754 3:107125267-107125289 AAGGAGAAGAAAAAAAAGGGGGG + Intergenic
959625195 3:108442020-108442042 ATAAAGAAGACAAATTAGAGGGG - Intronic
959927930 3:111945717-111945739 AAGGAGAAGCAAAATAAGAGAGG - Intronic
960846671 3:122010219-122010241 ACAGAGAAGATAAATAAGGCGGG + Intronic
961282511 3:125775020-125775042 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
962675938 3:137758582-137758604 ATGGAGTGGACAAAGAAAGGTGG - Intergenic
964564316 3:158033112-158033134 AAGAAGAAGAAAAAGAAGGGTGG + Intergenic
964777186 3:160291603-160291625 AAGGTGAAAACAAATAAGCGTGG + Intronic
966354218 3:179061992-179062014 ATGGAGAGGAAAAAAAAGGTAGG + Intronic
966679044 3:182620627-182620649 AAGGAGAGAACAAAGAAGGGAGG + Intergenic
969015216 4:4099377-4099399 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
969738718 4:9008874-9008896 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
969797922 4:9540519-9540541 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
970026520 4:11629855-11629877 AGGGAGAACACAGAGAAGGGCGG + Intergenic
970368678 4:15386548-15386570 ATGGAGAAAACAAAGAAAAGGGG + Intronic
970624792 4:17864576-17864598 CTGGAAAAGAGAAAAAAGGGTGG + Intronic
970729873 4:19090234-19090256 ATGCAGGAGGCAGATAAGGGAGG + Intergenic
971684266 4:29744716-29744738 TTTGAGAACACAAATAAGGAAGG - Intergenic
971811397 4:31432586-31432608 ATGCAGGAGGCAGATAAGGGAGG + Intergenic
972450844 4:39196819-39196841 TTGGAGCAGACAAATGAGGAGGG - Intronic
973087355 4:46082314-46082336 GAGAAGAAGAGAAATAAGGGAGG - Intronic
973823135 4:54680686-54680708 TTGAGGAAGACAAATAAGGCCGG - Intronic
975437099 4:74365409-74365431 AAAGAGGAGACAAATAAGGAAGG + Intronic
975789873 4:77937508-77937530 ATGGGGACCACAAATATGGGCGG - Intronic
976615273 4:87069631-87069653 AAGGAGAAGAGAAAAAAGGAAGG - Intronic
977149971 4:93499127-93499149 ATGGAGAAGAAATAGAAGCGGGG - Intronic
977487816 4:97671001-97671023 ATGGAGAACAAAAGTCAGGGAGG - Intronic
977902634 4:102439610-102439632 AGGAAGAAAACAAATAAGGAAGG + Intergenic
978256518 4:106698798-106698820 GTGGAAAAGATAATTAAGGGTGG - Intergenic
978728708 4:111999548-111999570 AGGGAGGAGACAAAGAAGAGAGG + Intergenic
979335638 4:119458014-119458036 CTGGAGAATACAAATCTGGGAGG - Intergenic
979673971 4:123390775-123390797 ATGGAGAAGATAAAGTAGTGGGG - Intergenic
980270725 4:130580792-130580814 ATGCAGAAGAGAAATCATGGAGG - Intergenic
980442394 4:132866465-132866487 CTGGAGAAAACAAATAGGGGAGG + Intergenic
980795533 4:137677373-137677395 ATGCAGGAGGCAGATAAGGGGGG - Intergenic
981058308 4:140390128-140390150 AAGGGGTAGACTAATAAGGGGGG + Intronic
981289699 4:143060087-143060109 ATGGTGAAGACACAAAAGGAGGG - Intergenic
981427812 4:144623853-144623875 ATGGAGAAAACCAATATTGGAGG - Intergenic
982274861 4:153628319-153628341 AAAGAGAAGAAAAATGAGGGAGG - Intronic
982782410 4:159505103-159505125 TTGGAGAAGGGAAAGAAGGGAGG - Intergenic
983323464 4:166224924-166224946 ATGGAGACCAGAAACAAGGGTGG - Intergenic
983484408 4:168317416-168317438 ATGGAAAAGAGAAAAAAGGAGGG + Intronic
985190964 4:187372409-187372431 ATGGCTAAGAAAAATAAGCGAGG + Intergenic
986163730 5:5253891-5253913 AGGGAGAATACAAAGAAAGGAGG - Intronic
986587238 5:9331093-9331115 TTGGAAAAGACGAATAAGTGTGG + Intronic
986857881 5:11892290-11892312 ATCGAGAAGACAAATAAGGTAGG - Intronic
987465597 5:18268379-18268401 ATGGAAAAGCCAAATAAAGGTGG + Intergenic
988159126 5:27496305-27496327 ATAGAAAAGAAAAATAAGGTTGG - Intergenic
988832662 5:35002983-35003005 AAGGACAGGACAAATTAGGGAGG + Intronic
988903925 5:35764827-35764849 AGGGAGAAAAGAAATAAGCGGGG - Intronic
990444926 5:55885674-55885696 AGGCAGAAGGCAGATAAGGGGGG - Intronic
990537992 5:56742731-56742753 AAGGAGAAGAAGAAGAAGGGGGG - Intergenic
990988806 5:61665048-61665070 TTGGAAAAAAAAAATAAGGGAGG + Intronic
991268039 5:64745923-64745945 ATGTAGAAGAAAAAAAAAGGTGG + Intronic
992023000 5:72643360-72643382 AAGAAGAAGCCAAAGAAGGGAGG - Intergenic
993909435 5:93663392-93663414 ATGGAAAAGAAAAATACAGGAGG - Intronic
994102493 5:95909115-95909137 ATGGAGAAGACAAATAAGGGAGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997267724 5:132505821-132505843 ATGGAGAAAAGAAAAAAAGGTGG - Intergenic
997442724 5:133919947-133919969 ATGGAACATGCAAATAAGGGGGG + Intergenic
999870732 5:155747777-155747799 TTGGCCAAGACAGATAAGGGGGG - Intergenic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
999933480 5:156459143-156459165 AGGGAGAAGACAAAGACAGGAGG - Intronic
999950257 5:156641896-156641918 ATGGAAAAGACACTTAAGGAAGG - Intronic
1001225146 5:169937904-169937926 ATGTGAAAGACAAAGAAGGGAGG - Intronic
1001773578 5:174312707-174312729 ATGGAAAAGAGAAAGAAGGGTGG - Intergenic
1004933010 6:20479786-20479808 ATGGACAAGAACAAGAAGGGAGG - Intronic
1006284098 6:33080189-33080211 ATGGAAAAGAGAAAGAAGGAAGG + Intronic
1006434353 6:34018554-34018576 AGGGAGAAGACAAAGAAAGGTGG - Intergenic
1006557149 6:34877085-34877107 ATGGAGAAGACACTTCAGTGGGG - Exonic
1006851049 6:37098894-37098916 TCGGAGCAGACAAATAAGTGGGG - Intergenic
1007168193 6:39843323-39843345 ATGGGGAAGAAAGATCAGGGTGG + Intronic
1007751282 6:44073459-44073481 ATGGAGGAGACGCACAAGGGAGG - Intergenic
1009044449 6:58221110-58221132 ATGGAAAACACAAATTAGGAAGG - Intergenic
1009855033 6:69251200-69251222 TGGAAGAAGACTAATAAGGGAGG - Intronic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1010815890 6:80357497-80357519 ATAGAGAAGGCAAAGAAGGGTGG + Intergenic
1011118468 6:83923000-83923022 AGAGAGAAAAAAAATAAGGGGGG - Intronic
1011482810 6:87811977-87811999 ATGGAGACCTCAGATAAGGGAGG + Intergenic
1011692151 6:89879987-89880009 AAGGAGAAAATAAATAAAGGAGG - Intergenic
1011872566 6:91914522-91914544 ATGGAGAAAATGAATAAGAGTGG + Intergenic
1012043831 6:94243622-94243644 ATGTAGAAGATAAATAAAGGTGG - Intergenic
1012595427 6:101032605-101032627 ATGCAGGAGGCAGATAAGGGAGG + Intergenic
1012635432 6:101532967-101532989 ATGAAAAAGACACAGAAGGGAGG + Intronic
1012970335 6:105722328-105722350 AAGGAGGAGACAAAGAAGGGAGG + Intergenic
1013541386 6:111113723-111113745 AAGAGGAATACAAATAAGGGAGG + Intronic
1014479882 6:121922596-121922618 CTGGAGAATACAAAAAAGAGAGG - Intergenic
1015259307 6:131216923-131216945 ATGTAGAAGAAAAATATGTGAGG - Intronic
1015526318 6:134177582-134177604 ATGGGGAAGGCACATAAGGTGGG - Intronic
1015737756 6:136419057-136419079 AAGGAGATGGCCAATAAGGGTGG + Intronic
1015817187 6:137222406-137222428 ATGAAGAAAACAAATTGGGGTGG + Intergenic
1016031004 6:139338108-139338130 ATGGAGAAGAACAAAAAGGCAGG + Intergenic
1017098917 6:150830520-150830542 ATGGAGAAGACACATAACTCAGG - Intronic
1017330458 6:153192300-153192322 ATAGAGAAGATAAATAAGATGGG - Intergenic
1020447949 7:8289312-8289334 ACAGAGAAGACAAATAAATGTGG - Intergenic
1021076549 7:16311386-16311408 CTGGAAAAGACAAATTATGGAGG - Intronic
1021605276 7:22403593-22403615 ATGGTAAAGATAACTAAGGGTGG + Intergenic
1022020542 7:26396563-26396585 CTGTAGTAGACAAATAAGGCTGG + Intergenic
1023075475 7:36478019-36478041 ATAGAGAAGAGAAAGAAGGAAGG - Intergenic
1023204170 7:37730157-37730179 AGAGAGAAGAGAAAGAAGGGGGG - Intronic
1023395772 7:39750653-39750675 ATGGATAACATAAATAAGTGTGG - Intergenic
1023675277 7:42622254-42622276 ATAAAGAAAACAAAAAAGGGGGG + Intergenic
1024490960 7:49985698-49985720 ATGCAGGAGGCAGATAAGGGAGG + Intronic
1026622890 7:71966206-71966228 ATGGACAATACAAATTAGTGTGG + Intronic
1026856882 7:73761041-73761063 ATGGAAAAGACAAGTTAGAGGGG + Intergenic
1027730018 7:81859492-81859514 ATGGAGAAGAGAAAGCAGAGTGG + Intergenic
1028714212 7:93945947-93945969 CTGGAAAAGAAAGATAAGGGAGG - Intergenic
1029073892 7:97921038-97921060 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1029416234 7:100444873-100444895 GTGGAGAAAACAGATAAGGCAGG + Intergenic
1029702100 7:102253933-102253955 ATGGAGAAGACAGGTTAGTGAGG - Exonic
1031870660 7:127086999-127087021 AAGGAAAAAATAAATAAGGGTGG + Intronic
1031925587 7:127635183-127635205 ATGGAGAAAACAAAGATGGGTGG + Intergenic
1032599817 7:133281654-133281676 AAGGAAAAGATAAAGAAGGGAGG - Intronic
1033840910 7:145371931-145371953 AAGAAGAAGAAAAATAAGGTGGG - Intergenic
1034064212 7:148120851-148120873 ATGGAGATGACATATAATGATGG - Intronic
1034108826 7:148516223-148516245 ATGGATAAGATAAAGAAGAGTGG - Intergenic
1034324090 7:150213736-150213758 TATGAGAAGACAAAAAAGGGAGG + Intergenic
1034769105 7:153755500-153755522 TATGAGAAGACAAAAAAGGGAGG - Intergenic
1035500341 8:87309-87331 ATGGAGAGGAGAAAGAAGAGGGG - Intergenic
1035538541 8:412605-412627 ATGGAGAAGTCATTTAAGGCTGG - Intronic
1036243813 8:7100258-7100280 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036256976 8:7213793-7213815 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036309026 8:7672392-7672414 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036360508 8:8073720-8073742 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036890463 8:12593247-12593269 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036898031 8:12651165-12651187 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1037067485 8:14600192-14600214 ATGAAGAAGACAAGGCAGGGAGG - Intronic
1037334869 8:17782164-17782186 ATGGACATGACATTTAAGGGGGG - Intronic
1037479324 8:19289349-19289371 ATGTAGAATCCAAAGAAGGGTGG - Intergenic
1038948924 8:32392462-32392484 ATGGAGATGCGAAAAAAGGGAGG - Intronic
1039201854 8:35103939-35103961 ATAGGGAAGATAAATAAGGCAGG - Intergenic
1039439045 8:37581863-37581885 TGGGAAAAGAAAAATAAGGGGGG - Intergenic
1040401900 8:47059728-47059750 CAGGAGAGGACAAGTAAGGGAGG + Intergenic
1040622609 8:49106548-49106570 ATGGAGAAGACATGGAAGGTGGG - Intergenic
1040853473 8:51925396-51925418 ATGCAGGAGGCAGATAAGGGAGG - Intergenic
1043074066 8:75673795-75673817 CTGGAGAAAACATATAAGAGAGG + Intergenic
1043245455 8:77994224-77994246 ATGGAGAATACAAATAGGACTGG - Intergenic
1043267426 8:78284242-78284264 ATTGAGAAAAGAACTAAGGGAGG - Intergenic
1043764238 8:84109399-84109421 ATGAAAAAGAAAAATAAGGAAGG - Intergenic
1045454467 8:102363474-102363496 AGGGAGAAGATAAACAAGGGTGG + Intronic
1045574504 8:103405465-103405487 ATGGTGAAAAGTAATAAGGGTGG + Intronic
1047048329 8:121080030-121080052 AAGGAGAAGTCAAATTAGAGTGG - Intergenic
1047489850 8:125365451-125365473 ATGGAGAATACAAAACAGGGAGG - Intronic
1047514829 8:125544919-125544941 ATGGGCAAGAGAAAGAAGGGTGG + Intergenic
1047780522 8:128107102-128107124 AAGAAGAAGAAAAAAAAGGGGGG + Intergenic
1048859618 8:138714408-138714430 ATGGAGAGGACAGAGAAGGACGG + Intronic
1049868010 8:144951323-144951345 ATAAAGAATACAAATAAGGCTGG + Intergenic
1050159651 9:2704260-2704282 ATGGAGAAGAAAAATAAATAAGG + Intergenic
1050195762 9:3082107-3082129 TTAGAGAACACAAATAAGTGGGG + Intergenic
1050446924 9:5733886-5733908 ATAGAGAAGACAAAGAAGGGAGG - Intronic
1051347131 9:16162389-16162411 ATGGTGAAGAAAAATAAAGCAGG + Intergenic
1052111477 9:24589282-24589304 ATAGAGAAGAAAAAGAATGGGGG + Intergenic
1052417076 9:28189900-28189922 ATGGAGAAGAGAGAGAAGAGGGG + Intronic
1052505460 9:29348537-29348559 AGGGAGATAACAAACAAGGGAGG + Intergenic
1053242886 9:36510791-36510813 AGGGAGAAGAGAGAAAAGGGAGG - Intergenic
1053382659 9:37661478-37661500 ATGGAGAAGAGAGATAAGACTGG + Intronic
1053636994 9:40019018-40019040 ATGCAGGAGACAAAGAAGGCAGG - Intergenic
1055036370 9:71822705-71822727 CTGGATAAGACAGATAAGGGAGG - Intergenic
1055119198 9:72638626-72638648 ATAGAGAAGACACATATGGCAGG - Intronic
1055339562 9:75266540-75266562 ATGGAGAACACAAATAATGTTGG - Intergenic
1055488990 9:76785106-76785128 ATGGTGATGACAGATAAGGCTGG - Intronic
1056108871 9:83374805-83374827 ATGGAGAAGAAGAATAAAAGAGG + Intronic
1056395102 9:86174744-86174766 ATGAACAAGACAAATGAGGTGGG - Intergenic
1056998370 9:91484830-91484852 ATGGAGAAAATCAATCAGGGAGG + Intergenic
1057640003 9:96810337-96810359 AGGTAGAAGACAAATAAGGAAGG + Intergenic
1058872671 9:109216143-109216165 ATGGAAAAGAGAAAGAGGGGAGG - Intronic
1059568112 9:115404097-115404119 AAGGAGAAGAAAAAGAAGAGGGG - Intergenic
1061563013 9:131418562-131418584 AAGAAGAAGACAAATCAGGCTGG - Intronic
1185812171 X:3120770-3120792 TTTGAGAAGACAAATACAGGAGG + Intergenic
1186659721 X:11657438-11657460 AAGGAGGAAACAAAAAAGGGAGG + Intronic
1186820207 X:13280321-13280343 ATGGAGAGAATAATTAAGGGTGG - Intergenic
1186924700 X:14320435-14320457 AAGGAGAAGAGAAACAAGGATGG - Intergenic
1187096821 X:16157557-16157579 AAGGCTAAGACAAAGAAGGGTGG + Intergenic
1187461764 X:19493237-19493259 GTTGAGAAGGCAAAGAAGGGAGG - Intronic
1187718168 X:22124365-22124387 ATGGAGAAAACAAACAAGAAAGG - Intronic
1188436371 X:30163857-30163879 ATGGAGAAGAGAAGGTAGGGTGG + Intergenic
1188561422 X:31472694-31472716 ATGCTGAAGATAAATAAGGATGG + Intronic
1188585426 X:31768519-31768541 AAGGAGAGAACAAAGAAGGGAGG - Intronic
1189089021 X:38058887-38058909 ATAGAGGAGACAGATAATGGGGG - Intronic
1191731278 X:64338375-64338397 AAGGAGGAGACAACTAAGGTGGG + Intronic
1192306632 X:69967197-69967219 ATAATGAAGACAAAGAAGGGAGG + Intronic
1192627540 X:72745868-72745890 GTGGATGAGACAAACAAGGGAGG + Intergenic
1192654168 X:72974945-72974967 GTGGATGAGACAAACAAGGGAGG - Intergenic
1193540176 X:82761694-82761716 ATGGAGACATTAAATAAGGGAGG + Intergenic
1194470631 X:94290933-94290955 AAGGACAAGACACCTAAGGGTGG - Intergenic
1195235815 X:102897227-102897249 AAGGAGAAGAAGGATAAGGGAGG + Intergenic
1195487918 X:105431448-105431470 CTGGAGAATACCTATAAGGGAGG - Intronic
1195494249 X:105511520-105511542 ATGGAGAGGACACATGTGGGTGG - Intronic
1195569759 X:106385139-106385161 TTGGAGAAGACAAAAAGGGAGGG - Intergenic
1196563527 X:117178201-117178223 ATGCAGGAGGCAGATAAGGGAGG + Intergenic
1199251826 X:145672545-145672567 ATGGAGTAGACATTTAAGGTTGG + Intergenic
1199594361 X:149494810-149494832 ATAGAGAAGAAAACTCAGGGAGG + Intronic
1200739696 Y:6840345-6840367 AAGGAGAACAGAAATAATGGTGG + Intergenic
1201988081 Y:19991688-19991710 ATGGAGAACAAAAAAAAGGCAGG - Intergenic