ID: 994103825

View in Genome Browser
Species Human (GRCh38)
Location 5:95923290-95923312
Sequence AAGAACAAGGAAAAATGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 932
Summary {0: 1, 1: 0, 2: 6, 3: 74, 4: 851}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994103825 Original CRISPR AAGAACAAGGAAAAATGGTA GGG (reversed) Intronic
901589810 1:10332049-10332071 AAGAAAAAAGATAAATGTTAAGG - Intronic
901811624 1:11770123-11770145 AAAAAAAAGGGAAAATGGTGTGG + Intronic
901920550 1:12533360-12533382 AAGAATGGGGAAAAAAGGTATGG - Intergenic
902099250 1:13972251-13972273 AAGAAAAAAGAAAAAAAGTAGGG - Intergenic
902648043 1:17817677-17817699 AAGAAAAAAGAAAAGTGGTTGGG - Intronic
903425075 1:23247365-23247387 AAGAAAAAAGAAAAATGGGCTGG + Intergenic
903865095 1:26392100-26392122 AAGAGCAAGGAAAGTTGGTGGGG + Intergenic
904772449 1:32887690-32887712 GAAAACAAAGAAAAATGGCAAGG + Intronic
905545499 1:38795648-38795670 AAGAACAAGGAAAAAAAGAAAGG + Intergenic
905708036 1:40077029-40077051 AGGAAGAAGGAAAAATGGATAGG + Intronic
906245726 1:44272508-44272530 AAAAACCTGGAAAAATAGTATGG - Intronic
907047769 1:51310243-51310265 AACAACAACAAAAAAGGGTAGGG + Intronic
907066703 1:51491551-51491573 CAGAAGAATGAAAAATAGTAAGG + Intronic
907600412 1:55763185-55763207 AAGAGCAATAAAAAATGATAAGG + Intergenic
908109574 1:60882737-60882759 AAGAAAAAGAAAAAATAGTAAGG - Intronic
908779410 1:67675754-67675776 AAGAACAAAGAAAATTAGAAAGG + Intergenic
909069853 1:70981224-70981246 AAGAAAAAGAAACAATAGTATGG - Intronic
909250896 1:73354794-73354816 AAGAATAAGGAAAAATATTTGGG + Intergenic
909467904 1:75994312-75994334 TTGAACAAAGAAAAATGGGAGGG + Intergenic
909839659 1:80303353-80303375 AAGAACAAGATATCATGGTATGG - Intergenic
909956224 1:81782257-81782279 AAGAAGAAGGAAACAGGGTAGGG - Intronic
910315852 1:85882864-85882886 CAGAACAAGGAAAATTGTCAGGG - Intronic
910687085 1:89928461-89928483 AAGAAAAAAGAAAAATGGGCTGG + Intronic
910932420 1:92455690-92455712 TAGAACAAGGAAAAATGGGGAGG + Intergenic
911198358 1:95018557-95018579 AAGAAAAAAGAAAAAAGGGACGG + Intronic
911220404 1:95239794-95239816 GAGAAAAATGAAAATTGGTAAGG + Intronic
911660899 1:100500133-100500155 AGGAACAAGGACAAATAGGAAGG + Intronic
912009819 1:104946383-104946405 AAGAAAAAAGAAAAATGGGCTGG + Intergenic
912207544 1:107525003-107525025 AAGAGGAAGGAAGAATGGCAGGG - Intergenic
912858125 1:113189935-113189957 AAGGAAAAGGCAGAATGGTAGGG - Intergenic
913094672 1:115504857-115504879 AAGAGCAAGAAAAAAGGGAAAGG - Intergenic
913213638 1:116602097-116602119 CTGAACAAGGAAGAATGGGAGGG - Intronic
913567067 1:120082983-120083005 GAGAACAAAGAAAAATGTTGTGG + Intergenic
913616959 1:120570176-120570198 AGAAACAAGGAAATATGCTATGG + Intergenic
913631064 1:120710566-120710588 GAGAACAAAGAAAAATGTTGTGG - Intergenic
914287819 1:146243689-146243711 GAGAACAAAGAAAAATGTTGTGG + Intergenic
914548853 1:148694435-148694457 GAGAACAAAGAAAAATGTTGTGG + Intergenic
914573316 1:148940739-148940761 AGAAACAAGGAAATATGCTATGG - Intronic
914617828 1:149377283-149377305 GAGAACAAAGAAAAATGTTGTGG - Intergenic
914855086 1:151344881-151344903 AAGAACCAGGACAACTGTTAGGG - Intronic
915201486 1:154233004-154233026 AAAAAAAAGAAAAAAAGGTAAGG - Intronic
916576139 1:166068297-166068319 TAAAACAAGGAAACATGGGAAGG + Intronic
917069514 1:171134973-171134995 AAGTACAAGGAGACATGGAAAGG + Intergenic
917321136 1:173782596-173782618 AAGAACACCAAAAAATGGCATGG - Intronic
917448491 1:175126839-175126861 AAGAAGGAGGAGAAATGGGAGGG + Intronic
917866383 1:179199717-179199739 AAAAAAAAGGAAAAAGTGTATGG - Intronic
917992933 1:180401790-180401812 AAAAAAAAAAAAAAATGGTAAGG + Intronic
918075146 1:181165331-181165353 CAGAAGAAGTGAAAATGGTAGGG - Intergenic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918302842 1:183219628-183219650 AAAAACAAGGAAGGATGGGAGGG - Intronic
918854948 1:189740377-189740399 AAGAACAAGGTATAATGAGAGGG + Intergenic
918886408 1:190199812-190199834 TAGAAAAAAGAAAAATGGTTAGG - Intronic
919236713 1:194855154-194855176 AAGAAAAAGGAAAAAGGGCCCGG + Intergenic
919347375 1:196401642-196401664 AAAAACAAAGAGAAAAGGTAAGG + Intronic
919488822 1:198178675-198178697 AACAACAACAAAAAATGGCAGGG - Intronic
919491021 1:198204925-198204947 AAGAAGAAGGAAAATTGGGAGGG - Intronic
919730368 1:200909658-200909680 CAGCACAAGGAAACATGGCAAGG - Intronic
920063260 1:203244026-203244048 AAGAAGAAAGAAAAAGGATAGGG + Intronic
920156362 1:203955260-203955282 CAGAACAAAGAATAATGGTATGG + Intergenic
921689932 1:218137145-218137167 AAAAACAACGAAAAATGGCAAGG + Intergenic
921692495 1:218165824-218165846 AAGAGAAAGAAAAAATGGTGGGG - Intergenic
921942995 1:220863019-220863041 AAGAACCTTGAAAAATGGTTAGG - Intergenic
922192431 1:223331369-223331391 AAGAATAAAGAAAAAAGGAAAGG - Intronic
922477772 1:225918692-225918714 AAAAAAAAAGAAAAAAGGTATGG - Intronic
923574900 1:235149400-235149422 AAAAAAAAGGAAAAATGTTAAGG + Intronic
923605111 1:235436333-235436355 CAGAACAATGTAAAATGCTATGG - Intronic
924186050 1:241492247-241492269 AAGAACAAGGACACATGTGATGG - Intergenic
1063051301 10:2451992-2452014 AAGAAAAGAGAAAAATGGAAAGG - Intergenic
1063248593 10:4249705-4249727 AAGAAAAAGAAAAAAAGGAAAGG - Intergenic
1063781327 10:9328424-9328446 AAGAGAAAGGAAAAATGCAAAGG - Intergenic
1064792234 10:18970957-18970979 ATTAACAAGAAAAAATGTTAAGG + Intergenic
1064834566 10:19511504-19511526 AAGAACAACAAAAAATAGTTTGG - Intronic
1065216265 10:23451637-23451659 AAGAACAAGTAAGAATGGAAAGG - Intergenic
1065360321 10:24883472-24883494 ACGAAAAAGGAAAAAGGGGAGGG + Intronic
1065480716 10:26191306-26191328 AGGCACGAGGAAAGATGGTAAGG - Intronic
1065809835 10:29431162-29431184 AGGAAGAAGGAAAAAAGGAAGGG - Intergenic
1065863210 10:29889233-29889255 AAGAACAATGGAAATTGGGAAGG + Intergenic
1066049964 10:31624336-31624358 AGGAAAAAGGAAAGATGGGATGG + Intergenic
1066586026 10:36936476-36936498 AAGAAAAAGAAAAATTAGTATGG + Intergenic
1067184319 10:44014130-44014152 AAGAGGAAGAAAAAATGGGAAGG - Intergenic
1067212783 10:44274857-44274879 AAAAAAAAGAAAAAATGTTAAGG + Intergenic
1067399385 10:45957000-45957022 GAGAAAAAGGAAAAAAGGAAGGG + Intergenic
1067854391 10:49779684-49779706 ATGAAGAACAAAAAATGGTAAGG - Intergenic
1067867704 10:49926216-49926238 GAGAAAAAGGAAAAAAGGAAGGG + Intronic
1067978036 10:51048324-51048346 AAGCACAAGGAAGAAAGGGAGGG - Intronic
1068174819 10:53444762-53444784 AAGAAGAAAGAAAGATGGGATGG + Intergenic
1068690552 10:59909525-59909547 AAGAAGGAGGAGAAATGATAGGG - Intergenic
1068810901 10:61255202-61255224 AAGAGAAAGAAAAAATGTTAAGG - Intergenic
1068887266 10:62110467-62110489 AGGAAAAAGGAAAAAAGGAAGGG - Intergenic
1069281678 10:66662456-66662478 AAAAACAAAAGAAAATGGTAGGG - Intronic
1069289572 10:66760997-66761019 AAGAAGAAGGAAGAATGGAAGGG + Intronic
1069937605 10:71929094-71929116 AAGAAAAAGGAAAAAATGCAGGG - Intergenic
1070303652 10:75224433-75224455 AAGAAAAAGGATAAATGGATGGG + Intronic
1070871598 10:79758726-79758748 GAGAAAAAGGAAAGGTGGTAAGG + Intergenic
1071227029 10:83542619-83542641 AAGACAAAGCAAAAATGGTGGGG + Intergenic
1071469457 10:85972145-85972167 AAAAAAAAAGAAAAATGGTCAGG - Intronic
1071499976 10:86196355-86196377 AAGAAAAACGAGAAATGGTCTGG + Intronic
1071638519 10:87280889-87280911 GAGAAAAAGGAAAGGTGGTAAGG + Intergenic
1071656723 10:87457063-87457085 GAGAAAAAGGAAAGGTGGTAAGG - Intergenic
1072375548 10:94812299-94812321 AAAAGAAAGGAAAAATGTTAAGG - Intronic
1072389416 10:94967945-94967967 AAAAGAAAGGAAAAATGTTAAGG - Intronic
1072481664 10:95814926-95814948 AAGAAGGAGGAAAAATGAGATGG - Intronic
1072896190 10:99368904-99368926 ATGCACATGGAAAAATGGTGGGG + Intronic
1072975465 10:100053629-100053651 AAGAAAAAGAAAAAAAGGTGGGG + Intronic
1073089335 10:100921213-100921235 AAGAAAAAGGAAAAATCCAAAGG - Intronic
1073103822 10:101021146-101021168 AAGGAAAAGGAAAAATGGGATGG + Intronic
1073995083 10:109306493-109306515 AAGACCCAGGATAAATGGAAAGG + Intergenic
1073997715 10:109334720-109334742 AAGAAAAAGCAAAAAAGGCAAGG + Intergenic
1074162351 10:110845243-110845265 GATAACAAGGAAACATGATAAGG - Intergenic
1074371313 10:112902926-112902948 AAGAAGAAGGAAAGAAGGGAAGG - Intergenic
1075352490 10:121736372-121736394 AAGAAAAAGAAAAAATGTTTTGG - Intergenic
1075367687 10:121907152-121907174 AAGAAAAAGATAAAAAGGTATGG + Intronic
1076199671 10:128547918-128547940 AAGAACAAGGAATAATAAAAGGG - Intergenic
1076682662 10:132181954-132181976 AAAAACATGAAAAAATGGAAAGG + Intronic
1076870883 10:133193575-133193597 AAGAAGAAGGAAAAAGGAGAAGG + Intronic
1077116276 11:886162-886184 AAAAAAAAGGAAAAATGGCGGGG + Intronic
1077979858 11:7288675-7288697 AAGAACAAGTATAAATGAGAAGG - Intronic
1078155648 11:8797750-8797772 AAGAATCAGGAAAAAGAGTAGGG - Intronic
1079498990 11:21080936-21080958 AAGAACAAGTTAAAATAATAAGG - Intronic
1079571791 11:21952547-21952569 AAGAAGAAGGAAGAGTGGGAAGG + Intergenic
1079693364 11:23447483-23447505 AAGATCAAGAAAAAAAGGGAGGG + Intergenic
1079727886 11:23898958-23898980 AAAAACAAGGAAAGCTGGCAGGG + Intergenic
1080123552 11:28704794-28704816 AAGGGCAAGTAAAAAAGGTAAGG + Intergenic
1080326872 11:31085130-31085152 AAGAAAAAATAAAAATGATAAGG - Intronic
1080385270 11:31807191-31807213 AAGAACCAGGAAAAGGGGAAGGG + Intronic
1080518777 11:33048316-33048338 AAGAGCCATGAAAAATGGTAAGG - Intronic
1080592995 11:33739789-33739811 AAGAGAAAGAAAAAATGGCAAGG + Intergenic
1081141380 11:39505243-39505265 AAAAAGAAAAAAAAATGGTATGG - Intergenic
1081322539 11:41708734-41708756 AAGAAAAAGGAGAAAAGGAAAGG - Intergenic
1081494084 11:43589104-43589126 AAAAATAAGGAAAAATAGAAGGG + Intronic
1081557721 11:44181533-44181555 AAGAAGACCGAAAGATGGTAAGG - Intronic
1082661300 11:55914574-55914596 AAGAACAAGGAAGAATGGACTGG - Exonic
1085095786 11:73760193-73760215 AAGAGCAAGGAATAAGGGTGGGG + Intronic
1085132491 11:74053287-74053309 AAAAACAAGAAAAACTGATACGG + Intronic
1085470035 11:76752123-76752145 CAGAGAAAGGAAAAATGGGATGG - Intergenic
1085930519 11:81077206-81077228 GAGAAGAAGGTAAAATAGTACGG - Intergenic
1086000038 11:81972433-81972455 TAGAACAAGGAAAATTGTAAGGG - Intergenic
1086423805 11:86664547-86664569 AAAATCAAGGAAATATGGAATGG - Intronic
1086931414 11:92697282-92697304 AAGGAAAAGCAAAAGTGGTATGG - Intronic
1087209836 11:95436009-95436031 AAGAACATGGATAAAATGTAAGG + Intergenic
1087389839 11:97518444-97518466 AAGAAAAAGTCCAAATGGTAGGG - Intergenic
1088025946 11:105183343-105183365 AAGGAAAAGGAAAAATGTTTCGG - Intergenic
1088172679 11:107017109-107017131 AAGAAAAAGAAAAAAAGCTACGG + Intronic
1088391924 11:109323913-109323935 AAGAACGAGGAAGAAAGGAAGGG - Intergenic
1088498033 11:110452131-110452153 AAGAACAAGAAAAAATCTTTAGG + Intronic
1090053013 11:123397072-123397094 AAGCACAGGAAAAAATGTTAGGG - Intergenic
1090440339 11:126720078-126720100 AAGAGGCAGGAAAAATAGTAAGG - Intronic
1090861842 11:130660992-130661014 AATAACAGGGGAAACTGGTAGGG - Intergenic
1091064599 11:132497422-132497444 AAAAAAAAAGAAAAATGCTATGG + Intronic
1091065089 11:132502284-132502306 AAGAGAAAGTAAAAATGGAAGGG - Intronic
1091172758 11:133532862-133532884 AGGAAGAAGGAAGAATGATAAGG - Intergenic
1091523004 12:1266935-1266957 AAGAGCAAAGTAAAATTGTATGG + Intronic
1091763323 12:3102112-3102134 AAGAAAAAGAAAAAAAGGCAGGG - Intronic
1092020766 12:5200627-5200649 AAGAACAAGGTAAATTGTTCTGG - Intergenic
1092751459 12:11723435-11723457 AAGAGCAAGAAAGAATGGAAGGG - Intronic
1093444830 12:19245283-19245305 AATAGCAAGGAAAAAGGGGAAGG - Intronic
1093978189 12:25446858-25446880 AAGAAAAAGGAAAAAGTTTAAGG - Intronic
1094046549 12:26173796-26173818 ACGAAATAAGAAAAATGGTAAGG - Intronic
1094291587 12:28856400-28856422 AAGAACAAAGAAAAAGAGAAGGG + Intergenic
1094408000 12:30139081-30139103 AACCACAAAGAAAAATAGTAAGG + Intergenic
1094486848 12:30932185-30932207 AAGACCATGGAAAAAAGGAAAGG - Intronic
1094551888 12:31460387-31460409 CAGAACAAGGAAAAAGGAAAGGG + Intronic
1094875809 12:34641233-34641255 AAAATGAAGGAAAAATGTTAAGG + Intergenic
1095200996 12:39384063-39384085 AAGAACAGGGAAGAAAAGTATGG + Intronic
1095372419 12:41484951-41484973 CAGACCCAGGAAACATGGTAAGG - Intronic
1095682040 12:44988639-44988661 AAAAGCAAGTAAAAATGGTGTGG - Intergenic
1097475003 12:60042649-60042671 AAGAAGAAGGAAAAAAGAAAGGG + Intergenic
1097717411 12:62981545-62981567 AAGAAGAAGTCAAGATGGTAAGG - Intergenic
1097890865 12:64776398-64776420 AAACACAGTGAAAAATGGTAAGG + Intergenic
1097945113 12:65358950-65358972 AAGAAGAAAGAAAAAAGGCAGGG - Intronic
1098959977 12:76729619-76729641 AAGAAAAAGAAAAAATGGCTGGG + Intergenic
1099020668 12:77400382-77400404 AATAAAAAGGAAAAATGGTCAGG - Intergenic
1099142179 12:78992332-78992354 AAGAACAAGTCAAAATAGTTTGG - Intronic
1099324549 12:81197801-81197823 AAATACAAGGAAAAATAGTGAGG - Intronic
1099356179 12:81638033-81638055 AATAACTAGGAAAAATAGTCGGG - Intronic
1100505047 12:95211519-95211541 AAGAAAAAGAAAAAAAGATATGG - Intronic
1101013723 12:100477516-100477538 AAAGAAAAGGAGAAATGGTATGG + Intronic
1101226247 12:102690853-102690875 AAGAACAAGGTAAAGAAGTATGG - Intergenic
1101439963 12:104696179-104696201 AGGAAAAAAGAAAAAAGGTAGGG - Intronic
1101504463 12:105332759-105332781 AAGAAAATAGAAAGATGGTAAGG + Intronic
1102177618 12:110887573-110887595 CAGAAGAAGGCAAAAAGGTAGGG - Intronic
1102238075 12:111307172-111307194 AAGAGCAAAGAAAGATGGTGAGG - Intronic
1102571696 12:113830723-113830745 AAGAACCAGGAAAGGTGGGAAGG + Intronic
1102948744 12:117013473-117013495 AAGAGCAATGAGTAATGGTACGG + Intronic
1103175656 12:118861053-118861075 AGGAAAAAGGAAAAAAGGGAGGG - Intergenic
1103282830 12:119774675-119774697 AAAAACAAGATAAAATGGTCAGG + Intronic
1103988626 12:124783809-124783831 AAAAACAAAAAAAACTGGTAAGG + Intronic
1105216870 13:18292652-18292674 CTGAACAAGGAAGAATGGGAGGG - Intergenic
1105716494 13:23070723-23070745 AAGAAAAAGAAAAAATCATAAGG - Intergenic
1105753616 13:23444687-23444709 AAAAACAAGGAGAACTGGTGTGG + Intergenic
1106351286 13:28932991-28933013 AATAAAGAGGAAAAAAGGTAAGG + Intronic
1106765133 13:32906129-32906151 GAGATGAAAGAAAAATGGTATGG - Intergenic
1106842815 13:33703675-33703697 AAGAACACACAAAAATGGAAAGG - Intergenic
1106872782 13:34039637-34039659 AAGAAGAAGGAAAAAGAGAAGGG - Intergenic
1106996639 13:35491725-35491747 AAGTACAAGGAATTATGCTAGGG + Intronic
1107176847 13:37409222-37409244 AGGAACAAGGAGAAATGCTAAGG - Intergenic
1107417379 13:40213125-40213147 AAGAAGAAAGAAAAATGGTCTGG + Intergenic
1108490195 13:50974360-50974382 AAGAAGAAGGAATAAAGGGAAGG + Intergenic
1108563722 13:51673170-51673192 AAAAACAAGGAATAAGGGAATGG + Intronic
1108591730 13:51918478-51918500 TAGAAGAAGCAAAAATGATATGG + Intergenic
1108788032 13:53930523-53930545 AAGAGAAATGAAAAATGTTATGG + Intergenic
1109442094 13:62388067-62388089 AGAAACAAGGAAAAAAGGTTTGG + Intergenic
1109558574 13:64016027-64016049 AAGAAAAAAGATAAATTGTAGGG + Intergenic
1109811910 13:67524579-67524601 AGGAAAAAGGGAAAATGGTAGGG - Intergenic
1109876695 13:68414950-68414972 AAGAACAAAAAAAAATGATGGGG - Intergenic
1110164808 13:72428346-72428368 AAGAACAAGATAAGAGGGTACGG + Intergenic
1110345740 13:74445850-74445872 ACGAACAAGGAAGAATTGTGTGG + Intergenic
1110536956 13:76661656-76661678 ATGAACAAAGAAAAGTGGTAAGG + Intergenic
1110564715 13:76946650-76946672 AAGAAAAAGGTAGAAGGGTAGGG + Intergenic
1110647161 13:77900938-77900960 AAGAAAAAGGAAATATGCTCTGG + Intronic
1110896326 13:80756833-80756855 AAAAACAAGGTAAATTGTTAGGG - Intergenic
1111042409 13:82766803-82766825 CAAAACAAGGGACAATGGTAAGG - Intergenic
1111537416 13:89621185-89621207 AAACACAAGGAAGAATGGGAAGG - Intergenic
1111541145 13:89668794-89668816 AAAAAAAAGGAAAAATGATTTGG + Intergenic
1111988846 13:95094650-95094672 AAAAACAAAGATAAATAGTAGGG + Intronic
1112595214 13:100801721-100801743 AAGAACAAGGGAAAAAGGGGAGG + Intergenic
1112802658 13:103129712-103129734 GAGAACCAGGGAAAATGGTGTGG - Intergenic
1113434357 13:110278357-110278379 AAGACCAAAGAAGAATGATAAGG - Intronic
1113477415 13:110594383-110594405 AAGACCAAGGAAAAAGAGTTTGG - Intergenic
1114038900 14:18657944-18657966 AAGAACAGGGAAATAGGGAACGG + Intergenic
1114748659 14:25179068-25179090 AAGAAGAAAGATACATGGTAAGG + Intergenic
1114936213 14:27540668-27540690 AGGAAAAAGAAGAAATGGTACGG + Intergenic
1115095263 14:29627750-29627772 AAGAACAAAGGAAAAAGATAAGG - Intronic
1115335706 14:32242691-32242713 AGGTACATGGAAAAATGGAATGG - Intergenic
1115906134 14:38205290-38205312 AAGAAAAAGGAAAACTGATATGG - Intergenic
1117106769 14:52405429-52405451 AAGAACAAAGAAGAAGGGTGGGG + Intergenic
1118039880 14:61905076-61905098 AGGAACAAGGAAGAAATGTAAGG - Intergenic
1118924716 14:70181607-70181629 AAGAACAAGGACAAGTCTTAGGG + Intronic
1119245639 14:73104219-73104241 AAAAACAAATAAAAATGCTAGGG - Intronic
1119473996 14:74916681-74916703 AAGAAAAAAAAAAAATGGTTGGG + Intronic
1119766651 14:77194477-77194499 AAGAAAAAAGAAATATGGCATGG - Intronic
1119835337 14:77744500-77744522 AAAAACAAGGAACAATGCTTTGG + Intronic
1119843530 14:77811085-77811107 GAGAGCAAGGAGAAAGGGTAGGG + Intronic
1120353845 14:83402152-83402174 AAGAACAATGAAAAATGTCATGG + Intergenic
1120682871 14:87501684-87501706 AAGAATGGGGAAAAATGGCAGGG + Intergenic
1120836031 14:89039161-89039183 AAGAAAAAGGCACAATGGTGTGG + Intergenic
1120880740 14:89413764-89413786 AAGAAGAAGGAAAAAAAGAAGGG + Intronic
1120975212 14:90242321-90242343 AAGAAAAAGTCTAAATGGTAGGG + Intergenic
1121370422 14:93353141-93353163 AAGTAAAAGGAAAAATAGCAGGG - Intronic
1121381127 14:93468283-93468305 AAGGACAAGGAAAAAAAATAGGG + Intronic
1121477021 14:94218223-94218245 AAGAGAAAGGAGAAATGGGAAGG + Intronic
1122163251 14:99802013-99802035 AAGTGTAAGGAACAATGGTAGGG + Intronic
1122644474 14:103184371-103184393 GAGAACAACAAGAAATGGTATGG + Intergenic
1123138986 14:106056793-106056815 AAGAACAAGAGAAAATGTTGAGG - Intergenic
1123197738 14:106632453-106632475 AAGAACAAGAGAAAATGTTGAGG - Intergenic
1125234556 15:37497921-37497943 ATGAAAATAGAAAAATGGTAGGG - Intergenic
1125243192 15:37600495-37600517 TAGAAATAGGAAAAATGTTAGGG + Intergenic
1125316418 15:38437004-38437026 AAGTACAATCAGAAATGGTAAGG - Intergenic
1125538492 15:40456505-40456527 AAGGACACGGAAAACTGGAAAGG - Intronic
1126224370 15:46253251-46253273 AAGAACAAGGAAACATTTTGAGG + Intergenic
1126645627 15:50872321-50872343 AAGAAAAAGTACACATGGTAGGG - Intergenic
1126975091 15:54168929-54168951 AATAAAATGGAAAAATGCTAAGG + Intronic
1127245733 15:57172089-57172111 AAGAACAAGGAAAAACCAAATGG - Intronic
1127590233 15:60415323-60415345 CACAATAAGGAAAAATGGGACGG + Intergenic
1127915949 15:63455298-63455320 AAAAACAAGGATAAATTTTATGG - Intergenic
1128154175 15:65382419-65382441 AAAAAAAAGGAAAAATGGACTGG + Exonic
1129015423 15:72463719-72463741 AAAAAAAAGGAAAAATAATAAGG - Intergenic
1129130090 15:73486092-73486114 AAAAAAAAGGAAAAAAGGTATGG - Intronic
1131006195 15:88980579-88980601 AAGAAAAGAAAAAAATGGTATGG - Intergenic
1131652415 15:94415381-94415403 AAGAGCAAGTAACAACGGTACGG - Intronic
1131780671 15:95854789-95854811 GAGAAAAAGGAGAAATGCTATGG + Intergenic
1131785789 15:95910073-95910095 AAAATCAAGGAAAAATGTCATGG + Intergenic
1131872988 15:96779843-96779865 AAGAAAAAAGAAAAAAGGTATGG + Intergenic
1132151000 15:99458919-99458941 AACAAGAAGGAACAATGGAAAGG + Intergenic
1132277750 15:100583714-100583736 AAGAGGAAGGAGAAAAGGTAGGG - Intronic
1133208029 16:4245797-4245819 AAGAAAAAGAAAAAATGGCCAGG - Intergenic
1133944963 16:10340365-10340387 CAGAACAAGGAACAACGGTAAGG - Intronic
1134766829 16:16766564-16766586 AAGACCAAGCAAAAATGCAAGGG + Intergenic
1134825557 16:17281546-17281568 AGGAAAAAGGAACAATGCTATGG + Intronic
1135188907 16:20338430-20338452 AAGAAGCAGGAAAAAATGTAGGG - Intronic
1135234786 16:20745126-20745148 AAGAACAAAGAAGAATAATAAGG - Intronic
1136094782 16:27947444-27947466 AAGAAGAAGGAAGAAAGGGAGGG + Intronic
1137279759 16:46965847-46965869 AAGAAAAAAGAAAAATGTAATGG + Intronic
1137387653 16:48056261-48056283 AAGTGCAAGGAAAAAAGGGAGGG + Intergenic
1137615142 16:49841939-49841961 AAGAAGAAAGAAAAATGGCCAGG + Intronic
1137637008 16:49995714-49995736 AAGAAGAAGGCAAACTGGTCTGG + Intergenic
1137995201 16:53203361-53203383 AAGAAAATGCAAGAATGGTAAGG - Intronic
1138238381 16:55405426-55405448 AGGAAAAAGGAAAAGTGGAAAGG + Intronic
1138303383 16:55951678-55951700 AAGAACAATGAAAGAAAGTAGGG + Intronic
1139218923 16:65158805-65158827 AACAATAAGGATAAATGGTGAGG + Intergenic
1139603826 16:68003701-68003723 AAAGACAAGGAAATAAGGTATGG - Intronic
1139803206 16:69541462-69541484 AAGAAGAAGAAAAAATGGGAAGG - Intergenic
1140401571 16:74676178-74676200 AAGCAGATGGAAAAATGGCATGG + Intronic
1140529842 16:75655423-75655445 ATTAACAAAGAAAAATGGTTAGG + Intronic
1140765394 16:78152238-78152260 AAGAATGAGGAGAAATGATACGG - Intronic
1140850197 16:78928190-78928212 AAAAAAAAAGAAAAGTGGTAGGG - Intronic
1140906669 16:79415261-79415283 AAGAACAAGGAAGGAAGGAAGGG + Intergenic
1141375776 16:83528842-83528864 ATGAACAAAGAAAAAAGGCATGG - Intronic
1141603119 16:85138031-85138053 AAGAAAAAGAAAGAAAGGTAGGG - Intergenic
1142681801 17:1554267-1554289 GAGAAAAAGGAAAAAAGCTATGG + Intronic
1142704146 17:1683838-1683860 AAAAACAGAGTAAAATGGTAAGG - Intronic
1143426956 17:6847614-6847636 GAGATAAAGGAAAAATGTTAAGG - Intergenic
1143746650 17:8999625-8999647 AACAACAAAAAAAAATTGTATGG - Intergenic
1144213831 17:13037281-13037303 AAGACAAAGGAAAAAGGGTTTGG - Intergenic
1144263520 17:13546244-13546266 AAGAAAAAAGAAACATGATAAGG - Intronic
1144284160 17:13756505-13756527 AAGACCAAGGAAAATAGGTTAGG + Intergenic
1144776455 17:17787375-17787397 AAGAAAAGGGAAAAAGGGTGGGG - Intronic
1144868714 17:18354710-18354732 AAGAACAAGGAATAAGGTTCAGG - Intronic
1145803981 17:27713305-27713327 ACCAACAGGGAAAAATGCTAAGG + Intergenic
1146979513 17:37146788-37146810 AAGAACAAAAAAAAATTGCAGGG + Intronic
1147279310 17:39345472-39345494 AAGAGAAAGCAGAAATGGTAGGG + Intronic
1147352599 17:39863086-39863108 AATAACAAGGAAAAAAAGTTGGG - Intronic
1148033833 17:44642656-44642678 TAGAGCAAGGAAAAAAGGAATGG + Intergenic
1148116185 17:45176522-45176544 AAGAAAAAAGAAAAAAGTTAAGG - Intergenic
1148370385 17:47095348-47095370 AAGAAAAAGGAAAGAAGGAAGGG + Intergenic
1148882567 17:50741428-50741450 AAAAACAAAGAAAAATCTTATGG - Intronic
1148909887 17:50935745-50935767 AATAACAAGGAAAAATAATCAGG + Intergenic
1149673779 17:58439944-58439966 AAAAAATAGGAAAAATGGAAGGG + Intronic
1149920404 17:60653293-60653315 AAGAGCAACAATAAATGGTAGGG - Intronic
1150539119 17:66077895-66077917 AAAAACAAAGATAAATGGTTGGG - Intronic
1150590505 17:66558353-66558375 AAAAACAAGGAGTACTGGTAAGG + Intronic
1150961244 17:69914666-69914688 AAGAAAAAAAAAAAAAGGTAGGG + Intergenic
1151156354 17:72125753-72125775 AACAACAAAGAAAAAAGGGATGG - Exonic
1151652435 17:75478361-75478383 AAGAAAAAGAAAAAAAGGAAAGG + Intronic
1151983460 17:77527823-77527845 TAGAACAAGGAGAAAAGGAAAGG + Intergenic
1152459713 17:80435450-80435472 AACAACAAAGCAAAATGGTCTGG - Intronic
1152960019 18:74013-74035 AAGAAGAAGGAAGAAAGGAAGGG + Intergenic
1153162776 18:2227618-2227640 AAGAACAAAGAAAAAAGGTGAGG + Intergenic
1153551401 18:6265226-6265248 AAGCACAAAGAAAATTGGGAAGG - Intronic
1153636069 18:7115007-7115029 AAGAAGAAGGAAAAAAAGAATGG + Intronic
1153711416 18:7803388-7803410 AAGAACAAGGCAAGAGGCTAGGG - Intronic
1153915128 18:9738344-9738366 AAGACCAAGGCAAGATGGGAGGG + Intronic
1154265823 18:12878039-12878061 AAGAAAAAAGAAAAATGGCCAGG + Intronic
1155469645 18:26177671-26177693 AAGAACAAAGAAAAGAGGAAAGG + Intronic
1155582645 18:27327502-27327524 AAGAATAATAAAGAATGGTATGG + Intergenic
1155686055 18:28552254-28552276 AACAACAAGGCAAAATAATAAGG - Intergenic
1155897042 18:31342806-31342828 GAGAACAAGGAAAGATGAAAAGG - Intronic
1156181756 18:34612755-34612777 AAGAACAAGGCACATTGGTGGGG - Intronic
1156417928 18:36917917-36917939 CAGAAACAGGAAAAATGGGAGGG - Intronic
1156884661 18:42120973-42120995 AGGAAAAAAGAAAAATGGAATGG - Intergenic
1157082535 18:44541759-44541781 AAGAACCTGGAAAAATAGTAAGG + Intergenic
1157770661 18:50343005-50343027 AAGAGCAAGGAAAATTATTAGGG - Intergenic
1158141266 18:54259007-54259029 AACAACAGGGGAAACTGGTAAGG - Intergenic
1158902698 18:61981056-61981078 AAGAAAAAGAAAAAATTGTATGG - Intergenic
1159042851 18:63341880-63341902 AAGAATAAAGAAAAATGGCCAGG + Intronic
1159269248 18:66127832-66127854 ACCAACAAGGACAAATGGTGTGG - Intergenic
1159657348 18:71048060-71048082 AGGAAGAAGGAACAATGGAATGG - Intergenic
1160047820 18:75404069-75404091 AATAAAAAGAAGAAATGGTATGG + Intergenic
1160262416 18:77307061-77307083 AGGCAGAAGAAAAAATGGTAAGG + Intergenic
1160333238 18:78014656-78014678 AAGGAAAAGGAAAATTAGTAGGG - Intergenic
1161037897 19:2095729-2095751 AAGAAAAAAGAAAAAAGGAAGGG - Intronic
1161227377 19:3153265-3153287 AAAAAAAAGGAAAGATGGAAGGG + Intronic
1161789427 19:6350138-6350160 AAGAAAAAGGAAAGAAGGGAAGG + Intergenic
1161904968 19:7149830-7149852 AAGAAGAAGGAAAGAAGGAAGGG + Intronic
1162188666 19:8927471-8927493 AAGAACATGGAGAAATGATTGGG + Intronic
1162232835 19:9281999-9282021 AAGGACAAGGAAACAGGGTTGGG - Intergenic
1162446383 19:10725454-10725476 AAAAAAAAGGAAAAAAGGAAAGG + Intronic
1163898983 19:20084054-20084076 AAAAAAAAGAAAATATGGTATGG - Intronic
1163957390 19:20657067-20657089 AAGATAAAGAAAATATGGTATGG + Intronic
1163959312 19:20672444-20672466 AAGATAAAGAAAATATGGTATGG - Intronic
1163998843 19:21078642-21078664 AAAAAAAAAAAAAAATGGTAAGG - Intergenic
1164611236 19:29633308-29633330 AAGAAGAAGAAAAAACGCTATGG + Intergenic
1165608748 19:37132116-37132138 AAGAAAAAGAAAAAAAGCTAAGG + Intronic
1165984109 19:39752300-39752322 AAGAGCAAGGAAGAGTGGGAAGG + Intergenic
1166085847 19:40474425-40474447 AAAAAAAAAAAAAAATGGTAGGG - Intronic
1166425584 19:42675777-42675799 AAGAAAAAAGAAAATTGGAAAGG - Intronic
1167483674 19:49747689-49747711 AAGAAAGAGGAGAAATGGAATGG - Intronic
1167836929 19:52080578-52080600 AAGAACAAGGTGAAAGGTTAGGG + Intronic
1168020759 19:53607068-53607090 AGGAACAAGAAACATTGGTAAGG + Intergenic
1168081844 19:54015789-54015811 AAGAAAAAGGAAGAAAGGAAGGG - Intergenic
1168507423 19:56948309-56948331 AAGAAAAAAGAAAAAGAGTAAGG - Intergenic
1168541748 19:57218060-57218082 AAGAAGAATGAACAATGGAATGG - Exonic
924995092 2:352811-352833 AAGAAAAAGTAAAAATAATATGG + Intergenic
925621810 2:5801238-5801260 CAGAACAAGGAAAAAGGTGATGG + Intergenic
925756146 2:7133945-7133967 AAGAACAATAAAGAAAGGTAAGG - Intergenic
926533255 2:14078833-14078855 AAAAACAAGCAAAAAGGGTTGGG + Intergenic
927033162 2:19143464-19143486 AAGAATAGGGAAAAATAGTGTGG + Intergenic
927647115 2:24884977-24884999 AAGAAGAAGGAAAATTGGAAAGG - Intronic
929235550 2:39601616-39601638 AAGACAAAGTAAAAATGGTTAGG + Intergenic
929341343 2:40822427-40822449 AACATCAAAGAAAAATTGTAAGG - Intergenic
929349616 2:40934183-40934205 AAGACAAAGGAAAAATAGTTGGG - Intergenic
929368088 2:41186039-41186061 AAAATCAAGGAAAAATGTTTTGG - Intergenic
929480509 2:42302827-42302849 AAGAACAGGGAAAAAAGGCTGGG - Intronic
929812847 2:45206347-45206369 AAGATCACGGAAGAATGGTTGGG + Intergenic
930180979 2:48356649-48356671 AAAAAGAAGGCAAAATGGCAAGG - Intronic
930266431 2:49205050-49205072 ACAAACAAGGATAAAGGGTAAGG + Intergenic
930816208 2:55600775-55600797 AAAAACAATGACAAATGGAAAGG + Intronic
931417756 2:62097722-62097744 AAGAAAAAGTCCAAATGGTAGGG - Intronic
931495938 2:62807250-62807272 AAGAATAAGAAAAAATGGCTGGG + Intronic
932032091 2:68199262-68199284 AAGAACAATTAAAAATGAAATGG - Intronic
932153515 2:69394341-69394363 AAGAACAAGGAGGAAAGGTGTGG - Intergenic
932523609 2:72440265-72440287 ATGAAAAAGAAAAAATGTTAAGG + Intronic
933015645 2:77123017-77123039 AAGAACAAAGAAAAATGATTAGG + Intronic
933155520 2:78969065-78969087 AAGAAAAAGAAAAAATATTAGGG - Intergenic
933387907 2:81634652-81634674 AAGGAGAAGGAAAAGTGGGAAGG + Intergenic
933634901 2:84698210-84698232 AAAAACAAGGAAAAAAGCTGGGG - Intronic
933939745 2:87235336-87235358 AAGGAACAAGAAAAATGGTAAGG + Intergenic
934047340 2:88183626-88183648 AAGAAAAAAGAAAGATGGAAAGG - Intronic
934297455 2:91754033-91754055 CTGAACAAGGAAGAATGGGAGGG + Intergenic
934331861 2:92075535-92075557 GAGAAAAAGGAAAAAAGGGAGGG + Intergenic
934622981 2:95826818-95826840 GAGAACAAGGAAAGATGGGCTGG - Intergenic
934810785 2:97275270-97275292 GAGAACAAGGAAAGATGGGCTGG + Intergenic
934826907 2:97432669-97432691 GAGAACAAGGAAAGATGGGCTGG - Intergenic
934928407 2:98398452-98398474 AAGAAGAAAGAAAAAAGGAAAGG - Exonic
935427388 2:102934295-102934317 AAGAAGAAGGGGAAATGGCATGG + Intergenic
935873766 2:107483981-107484003 AAGAAGAAGAAAAAATTGTCAGG - Intergenic
936291368 2:111226452-111226474 AAAACCCAGGAAAAATGGAAAGG + Intergenic
936353393 2:111730437-111730459 AAGGAACAAGAAAAATGGTAAGG - Intergenic
937353027 2:121179222-121179244 AAGAACAATAAAAACTGGGAAGG + Intergenic
937387516 2:121449590-121449612 AAGACCAAGAAAAAATGGGCCGG + Intronic
937720189 2:125085989-125086011 AAGAAGAAGGAAATGTGGGAAGG + Intergenic
937745396 2:125406257-125406279 AAGAAGAATAAAAAATGGCAAGG + Intergenic
938272056 2:129981137-129981159 AAGAACACGGAAATAGGGAACGG - Exonic
938443953 2:131362676-131362698 AAGAACACGGAAATAGGGAACGG + Intergenic
938984049 2:136555776-136555798 AACCATAATGAAAAATGGTATGG + Intergenic
939041940 2:137200400-137200422 AAGAAGAAATAAAAATGGGAAGG - Intronic
939354541 2:141084371-141084393 CAGAACAAGCAAAAATGTTAAGG + Intronic
939371176 2:141302363-141302385 AAGAACAAGGAATACTGTTTGGG - Intronic
939451605 2:142381454-142381476 AACAGGAAGGCAAAATGGTATGG - Intergenic
939910438 2:147976553-147976575 AAGAAAAAGGAAGAAAGGGAAGG - Intronic
940315115 2:152320246-152320268 AAGGAGAAGGAAAAGTGGGAAGG - Intergenic
940770588 2:157835495-157835517 AAGAAAAAGAAAAAGTGTTAAGG - Intronic
941202352 2:162527192-162527214 TAGAAAAAGGAAACATGGCATGG - Intronic
941572226 2:167185304-167185326 AAGACCAACAAAAAATGGTCAGG - Intronic
941619978 2:167766390-167766412 AAGTTCATGGAAAAATGGAATGG + Intergenic
941943453 2:171068458-171068480 AAGAACAAAGAAACTGGGTATGG - Intronic
942164520 2:173229171-173229193 AAGGACATGGGAAATTGGTACGG - Intronic
942887997 2:180952239-180952261 GAGAACAAATAAAACTGGTATGG - Intergenic
943731638 2:191308542-191308564 AAGAAGAAAGAAAAAAGATAAGG - Intronic
944035684 2:195291732-195291754 AAAATTAAGGAAAAATGTTAAGG + Intergenic
944255556 2:197619929-197619951 AAAAACAAGGTAAAATAGTGTGG + Intronic
945001454 2:205355404-205355426 AAAAATAAGCAAAAATGATAAGG + Intronic
945436701 2:209826898-209826920 AATATCAAGGAAAAATGGGCTGG - Intronic
945546209 2:211155299-211155321 AAGACCAAGGAAAAATGGGATGG - Intergenic
945574612 2:211515213-211515235 AAGAAAAAGGAAAATTGTGAGGG + Intronic
945633663 2:212318944-212318966 GAGAACACTGAAAAATGGTGAGG - Intronic
945697508 2:213126269-213126291 AAGAAATGGGAAAAGTGGTAGGG - Intronic
945698202 2:213135700-213135722 AAGAAAAAGGAAAAAAGGAAAGG + Intronic
945719121 2:213396796-213396818 AAGAACACAGATAAAGGGTATGG - Intronic
945742542 2:213680944-213680966 AAGAACTAGGATCAATGGAAAGG + Intronic
945847410 2:214963205-214963227 AAACACAATGAAAAATGATAAGG + Intronic
946509033 2:220334678-220334700 AAGTAAAGGGAAAAATGGTGAGG - Intergenic
946838200 2:223794100-223794122 AAGAAAAATGCAAAATGATAAGG - Intronic
947134572 2:226964372-226964394 AACAAGAAAGAAAAAAGGTATGG - Intronic
947313210 2:228826670-228826692 CAGTACAAGTAAAAATGGTATGG + Intergenic
947453311 2:230228653-230228675 CAGAACAAGGAAAATTGTCAGGG - Intronic
948218477 2:236250344-236250366 AAGAACAAGAGAAAATGGCAGGG - Intronic
1168979265 20:1991027-1991049 AAGAAGAGGGAAAAAAGGGAAGG + Intronic
1169496045 20:6116426-6116448 AAGAAAAAGAAAAAATAATAGGG + Intronic
1169620752 20:7503985-7504007 AAGAACAAGGCAAGATATTATGG + Intergenic
1169660537 20:7973713-7973735 AAGATCTAGGAGAAATTGTAAGG - Intergenic
1169677651 20:8172704-8172726 AAGAACAAAGAAAAATGTTCAGG - Intronic
1169850927 20:10049809-10049831 AAGAAAAAGGAAAAAGGGATGGG + Exonic
1169949574 20:11028679-11028701 AAGAAAAAGGAAAAAGGAGAAGG - Intronic
1170117136 20:12872618-12872640 GAGAACAGGGAAAAATAGTGAGG - Intergenic
1170730162 20:18967150-18967172 AAAATGAAGGAAAAATGTTAAGG + Intergenic
1171028959 20:21659030-21659052 AAAAACAAAGAAAAATTGCAGGG + Intergenic
1171149731 20:22816876-22816898 AAAAATAAAGAAAAATGCTATGG - Intergenic
1171375112 20:24687588-24687610 AAAAACAAAGAAAAATAGTTGGG - Intergenic
1171376304 20:24696347-24696369 AGGAACAGGGAACAATGGAATGG + Intergenic
1171998474 20:31752245-31752267 AAGAAGAAGGATAAAGGGAAAGG + Intronic
1172332686 20:34086535-34086557 AATAACTTGGAAAAATGGTCTGG + Intronic
1173033391 20:39383302-39383324 AAGCAATAGGAAAAATGGCAAGG + Intergenic
1173257459 20:41405054-41405076 AAGCACAACGAAAAGTGGTACGG - Exonic
1173970412 20:47148072-47148094 AAGAATAAAAAAAAATGGTCCGG + Intronic
1174468415 20:50735717-50735739 AAAAACAATAAAAAATTGTATGG - Intronic
1175459262 20:59138893-59138915 AAGATCAAGGAAAAATCCAAGGG - Intergenic
1177216351 21:18134555-18134577 AGGAACAATGAAAGATGGTATGG + Intronic
1177334131 21:19701453-19701475 AAAAAAAAGTAAAAATGGCAGGG - Intergenic
1177429102 21:20966345-20966367 TAGAACAATGAAAATTGTTAAGG - Intergenic
1177472751 21:21580011-21580033 AAGAATAAAGAAAAATAGCAGGG + Intergenic
1177592275 21:23185768-23185790 AAGAACAGAGAAAAGTGGGAAGG + Intergenic
1177655995 21:24018701-24018723 AAGAGCAGGGAAGAAGGGTAGGG - Intergenic
1177760217 21:25394754-25394776 AAGAAAAAAGAAAAATAGTTTGG + Intergenic
1178070983 21:28966876-28966898 AAGTAAAAAAAAAAATGGTAAGG - Exonic
1178322608 21:31616849-31616871 AATAAAAAGAAAAAATTGTAGGG - Intergenic
1178594902 21:33944322-33944344 AAGAAAAAGAAAAAATGAAAAGG + Intergenic
1179412630 21:41174069-41174091 AGGAAAAAGGAAAAATGGGCAGG - Intronic
1180635392 22:17259329-17259351 AAGAAGAAGGAAAGAAGGAAAGG - Intergenic
1181445390 22:22968731-22968753 AAAATGAAGGAAAAATGGTAAGG + Intergenic
1181899039 22:26137283-26137305 AAGGATAAGGAAAAAGGGCAAGG + Intergenic
1182230393 22:28833385-28833407 AAGAAGAAGGAAAGAAGGAAAGG + Intergenic
1182785972 22:32908078-32908100 AAAAAAAAAGAAAAAAGGTATGG - Intronic
1182855322 22:33512008-33512030 AAGAACAAGGAAAAAAATCATGG - Intronic
1183800392 22:40158658-40158680 CAAAACAAGGGAGAATGGTAAGG - Intronic
1184931422 22:47683972-47683994 AAGAACGTTGAAAAATGGGAAGG - Intergenic
949394658 3:3602103-3602125 AATAAAAAGGAGAGATGGTAGGG + Intergenic
949494621 3:4619872-4619894 AAAAACAAAGAGAAATGGAAGGG - Intronic
950007627 3:9701694-9701716 AAGCACAAGGACAGGTGGTATGG + Intronic
951104732 3:18729728-18729750 AAGAACATAGAAGAATGGGAGGG + Intergenic
951152797 3:19312267-19312289 AATAATAAGGAAAAATAGAAGGG - Intronic
951155598 3:19349592-19349614 AAGAACCAGGAAGAATGGAAAGG - Intronic
951489348 3:23251710-23251732 AAAAACAAAGAAAAAGGATATGG - Intronic
951617667 3:24566543-24566565 AGGAGGAAGGAAATATGGTATGG - Intergenic
951644133 3:24868473-24868495 AACAACAAAAAAAAATGTTAAGG + Intergenic
951703299 3:25518452-25518474 AAGAGCAACGAAAAATGTCAAGG - Intronic
951879419 3:27465430-27465452 TAGAACATGGGAAAATGGTTAGG - Intronic
952140706 3:30475779-30475801 AAGAAACAGGAAAATTGGAAGGG + Intergenic
952277718 3:31893402-31893424 AAAGACAATGACAAATGGTAAGG + Intronic
952546223 3:34422437-34422459 AAGAATAAGGGAATATGCTAGGG + Intergenic
952624552 3:35388640-35388662 AATAAAAAGGAAAAATGGTGGGG + Intergenic
952645211 3:35649055-35649077 AAGGACAATGAAAAATGGACTGG - Intronic
952688311 3:36175172-36175194 AAGAAAAGGGAAGAATGGGAAGG - Intergenic
954190750 3:48958709-48958731 AAAAAAAAGAAAAAAAGGTAAGG + Intronic
954834126 3:53450143-53450165 AAGAGCAAGGAAAACAGATAAGG - Intergenic
954839732 3:53499858-53499880 TACAAAAAGGAAAAATGGAAAGG + Intronic
955119092 3:56037768-56037790 AAAATGAAGGAAAAATGTTAAGG + Intronic
955204238 3:56881136-56881158 AAGAAAAAGAAAAAATGTTTGGG - Intronic
955393289 3:58536597-58536619 CAGAGCAAGGAAAAGAGGTAAGG - Intronic
955455988 3:59122269-59122291 AAGAAAAAGAAAAAACGGTCAGG + Intergenic
955523244 3:59795399-59795421 AATAAGAAGAAAAAATGTTATGG - Intronic
955581296 3:60425887-60425909 ATGAAGAAGGAAAAGTGTTATGG + Intronic
955605865 3:60702443-60702465 TAGAAAAAAGAAAAATGTTATGG - Intronic
955655533 3:61241108-61241130 TAGAACAACAAAAAATGGTGGGG - Intronic
956380450 3:68659316-68659338 AAGAACCAGAAAAAAACGTAAGG - Intergenic
956530249 3:70211225-70211247 AAGGAAAAGGAAAAAGGGAAAGG - Intergenic
956530409 3:70211724-70211746 AAGAAAAAGGAAAAAGAGAAAGG - Intergenic
956530424 3:70211817-70211839 AGGAAAAAGGAAAAAGGGAAGGG - Intergenic
956847815 3:73199553-73199575 AAGACCGATGAAAAATGGTTTGG + Intergenic
957043243 3:75353278-75353300 AAGGAACAGGAAAAATAGTATGG - Intergenic
957169236 3:76716386-76716408 AAGAATAAAGAAAAAAGATAAGG - Intronic
957860643 3:85944091-85944113 ATGAAAAACGAAAAATGGCAGGG + Intronic
957974342 3:87424199-87424221 ATGAAAAAAGAAAAATGGTAGGG - Intergenic
958136007 3:89492585-89492607 AAGAGCAAAGAAAATTAGTAGGG - Intergenic
958439085 3:94133955-94133977 AAGAGCAAGGGACACTGGTAAGG + Intergenic
958664432 3:97116907-97116929 AATAATTATGAAAAATGGTAAGG - Intronic
958936197 3:100258790-100258812 AATAATAAAGAAAAATGGTTTGG + Intergenic
959031570 3:101305553-101305575 AATAACAGGGAAAAGTGGTGGGG + Intronic
959454653 3:106543719-106543741 TACACCAAGGAAAAATGGTATGG - Intergenic
959497100 3:107064382-107064404 GAGAATAAGGAGAAATGGTAAGG + Intergenic
959961627 3:112304548-112304570 AAGAATAAGGAAAATGGTTAGGG + Intergenic
960446430 3:117754880-117754902 AAGAAGAATGAAAAATATTAAGG - Intergenic
960663577 3:120087830-120087852 AAATATAAGCAAAAATGGTAAGG + Intronic
960911013 3:122649643-122649665 AAGTAAAAGGAAAGATGGTATGG + Intergenic
962018342 3:131467816-131467838 AAGAACCTGTAAAAAGGGTAAGG - Intronic
962412265 3:135151494-135151516 AAGTACATGAAAAAATGGAAAGG - Intronic
962516803 3:136159974-136159996 AAGAAAATGAAAAAATGGTCAGG + Intronic
962793181 3:138829792-138829814 AAGAAGAAAGAAAACTGCTAGGG + Intronic
963561086 3:146866132-146866154 AATAATAAGGAATAATGGGAAGG - Intergenic
963995996 3:151709348-151709370 AAGAATAGGGAAGAATGGGAAGG + Intergenic
964183137 3:153912047-153912069 AAGGAGAGGGAAAAATGGGAAGG - Intergenic
964309378 3:155376362-155376384 AGAAACAAGGAAATGTGGTAGGG + Intronic
964553364 3:157909565-157909587 AAGAAATATTAAAAATGGTAGGG - Intergenic
964874271 3:161348117-161348139 AAGGACATGGAAAAATGCTAAGG + Intronic
964952005 3:162307350-162307372 AAGAAGAATGAAAAATAGTGAGG - Intergenic
965014429 3:163139130-163139152 AAGAAGAAAGAAAAGTAGTAAGG - Intergenic
965018929 3:163200452-163200474 AAGAAGAAGGAAAAAAAATAAGG - Intergenic
965024038 3:163275322-163275344 AGGAACAAGGAAAAAAGGAGAGG + Intergenic
965030824 3:163365352-163365374 GATCACAAGGAAAATTGGTAAGG + Intergenic
965551371 3:169967637-169967659 AAGAACCAGGGAAAATCGCAAGG - Intronic
965851876 3:173037384-173037406 AAAAACAAAGCAAAATGATAAGG + Intronic
965952546 3:174328149-174328171 AAGAGCAAGTTAAATTGGTAAGG - Intergenic
966118492 3:176494614-176494636 AACAAGAAGGAAAAATGCTTAGG - Intergenic
966368492 3:179218671-179218693 AAGAAAAAAGAAAAATGAAAGGG - Intronic
966614167 3:181896462-181896484 AAGAACAAGGCGAAATATTAAGG + Intergenic
966751902 3:183330262-183330284 AAGAAGAAGAAAAAAAGGAAAGG + Intronic
966789486 3:183653680-183653702 CAGAACAAAGAATGATGGTATGG + Intronic
966816887 3:183896740-183896762 CAGAACGAGGAGAAATGGAATGG + Intergenic
966846113 3:184131139-184131161 AAGAAAAATGAAAAAAAGTATGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967113825 3:186318861-186318883 AAAACCAAGGGAAACTGGTATGG - Intronic
967140817 3:186557898-186557920 AAGAACAAGTAAAAATATTTTGG + Intronic
967276262 3:187778334-187778356 AAGTACAAATAAAAATGATAAGG + Intergenic
967414639 3:189202549-189202571 AAGAAAAAGTAAAATTTGTAAGG - Intronic
969854551 4:9988762-9988784 AAATACAAGGAAGCATGGTAGGG + Intronic
970108357 4:12609936-12609958 AAAAAAAAGGAAAAAAGGAAAGG + Intergenic
970218840 4:13786497-13786519 ATGAAGAAGGAAAAAAGGGAGGG - Intergenic
970282282 4:14470998-14471020 AAGAGTAAGGAAACATGGTTAGG - Intergenic
970405579 4:15759859-15759881 CAGAACCAGGAAAAATGGAAGGG + Intergenic
970789908 4:19845115-19845137 ATGAACAAGGGGAAAAGGTATGG - Intergenic
971444825 4:26732025-26732047 AAGAAGAAGAAAAAATAGGAAGG - Intronic
971728280 4:30341627-30341649 AAATTCAAGGAAAAATGGCATGG - Intergenic
971951055 4:33346857-33346879 GAGGAAAAGGAAAATTGGTATGG - Intergenic
972186751 4:36537841-36537863 AAGAACAAGGAAGATTATTAAGG - Intergenic
972853215 4:43074795-43074817 GAGAAAAAGGAAAAAAGGGAGGG - Intergenic
973024841 4:45254843-45254865 AAGAGCAAGGAATAAATGTAAGG - Intergenic
973103966 4:46308236-46308258 AACAACAAGGAAAAATTTAAAGG + Intronic
973116033 4:46460535-46460557 AAAAACAACTAAAAATTGTATGG + Intronic
973297163 4:48537043-48537065 AAGAAAAAGAAAAAATGGGTTGG + Intronic
973326899 4:48871621-48871643 AAAAAAAAGGAAAAAAAGTAAGG - Intergenic
973625274 4:52765493-52765515 AAGAAAAAGAAAAAAAGGAAAGG + Intergenic
974336289 4:60549652-60549674 AAGAACAAGGAAACAAAGTCAGG - Intergenic
974382354 4:61157326-61157348 AAGAACATGGAATAATGGGGAGG + Intergenic
974419246 4:61650973-61650995 AAGAATAATGGAAAATAGTAAGG + Intronic
974550276 4:63363215-63363237 AATAAAAAGGAAAAGTGATATGG - Intergenic
974627463 4:64443140-64443162 AAGAAAAAGTGGAAATGGTAAGG - Intergenic
974702286 4:65467177-65467199 ATGAGCAAGGAAAAAAGATAGGG + Intronic
974757261 4:66225698-66225720 AGGAACAAGGAAGGAAGGTAGGG + Intergenic
975219870 4:71801863-71801885 AAGAAACAGGAAAAATAGGAAGG - Intronic
975250639 4:72174393-72174415 AAGAAAAAGTCCAAATGGTAGGG + Intergenic
975572694 4:75834362-75834384 AAGAACAAGGAAACAGCATAGGG + Intergenic
976042898 4:80908022-80908044 AAGAATGATGAAAAATGTTATGG - Intronic
976423366 4:84871528-84871550 AGGAAGAAGAAAAAATGATAGGG + Intronic
976500647 4:85784761-85784783 AATAAAAAGGAAAAATGCCAAGG - Intronic
976519198 4:86006739-86006761 TAGATGAAGGAAAAATGGCATGG - Intergenic
977285135 4:95095107-95095129 TAGTATAAGGAAAAATGGTTAGG + Intronic
978672912 4:111272720-111272742 AACAACAAGCAAAATTGGTGAGG - Intergenic
978796550 4:112713570-112713592 AAAAACAAAAAAAATTGGTATGG + Intergenic
978858339 4:113418789-113418811 TAGAGCAAGGAAAAATAGGAAGG + Intergenic
979558036 4:122073322-122073344 AAGAAAAAGAATAAATGGTTAGG + Intergenic
980193318 4:129554372-129554394 AATAACAATGAAAAATATTAAGG - Intergenic
980200178 4:129646719-129646741 AAGGACAAGGTGAAATAGTATGG + Intergenic
980294618 4:130895271-130895293 AAGAGCAAAGCAAAATGGTAAGG + Intergenic
980321568 4:131286132-131286154 AGGAACTAGGAACAATTGTAAGG + Intergenic
980753964 4:137131952-137131974 AAGATAAAGGAAAAATGGGAGGG - Intergenic
981009138 4:139906544-139906566 AAGAACAAGGAATGATGGTTAGG + Intronic
981271569 4:142851610-142851632 AAGGCGAAGGAAAAATGGGAGGG + Intergenic
981576178 4:146208232-146208254 AAGAACATTTAAAAATTGTAAGG - Intergenic
981637342 4:146895799-146895821 AAGCACAAGGGAAAATGATGGGG - Intronic
981798607 4:148629498-148629520 TAGAAAAAGGTAAAAAGGTAAGG - Intergenic
981843827 4:149144018-149144040 AAGAAAAAGGAAGAAAGGAAAGG - Intergenic
982124208 4:152170249-152170271 AATAACAAATAAAAATGGTAGGG + Intergenic
982416748 4:155142490-155142512 AAGAGCAAGGAAAAATAAAAGGG - Intergenic
982680650 4:158424917-158424939 AATAACAAGGACAAGTAGTATGG + Intronic
983131543 4:164025861-164025883 AAGTGCAATGAAAAATGGCAAGG + Intronic
983149117 4:164255435-164255457 AAGAAAAAAGTAATATGGTAAGG + Intronic
983195437 4:164801094-164801116 AAGAACATGAAAAAAAGGGAAGG + Intergenic
983508178 4:168578000-168578022 AAGAACATTGAAAAGTAGTATGG - Intronic
983843835 4:172491297-172491319 AAAAGCAAGGAAAAATGGAAAGG - Intronic
984225152 4:177025980-177026002 AAGAAAAAGGAAACATGATTTGG + Intergenic
984723516 4:182999050-182999072 GAAATGAAGGAAAAATGGTAAGG + Intergenic
984957340 4:185058449-185058471 AAGAACAAGCAACAGTGGGAAGG - Intergenic
985326688 4:188778519-188778541 AAGAACAGTGAGAAATGGTGCGG + Intergenic
986374800 5:7119512-7119534 AAGAGGAAAGAAAAATGGGAAGG + Intergenic
986660808 5:10058113-10058135 AAGAAAAAGGAAAAAGGAAATGG + Intergenic
986995175 5:13599190-13599212 AAAAACTGGGAAAAATGCTATGG - Intergenic
987130107 5:14852322-14852344 AAGGAAAAGGAAACATGATATGG + Intronic
987462458 5:18228996-18229018 AAGAAGAAGGAATAAAGGAAGGG + Intergenic
987531422 5:19126082-19126104 AACAACAAGGAGACATGCTAAGG - Intergenic
987601721 5:20080698-20080720 AAGAAAAAAGAAAAATGATTAGG + Intronic
987837243 5:23177748-23177770 AATAAAAAGAAAAAATGTTAAGG - Intergenic
988016740 5:25569277-25569299 CAGAAAAAGGAAAAAAGGAAAGG - Intergenic
988087703 5:26492960-26492982 CAGAACAAAGAATAATGGTATGG - Intergenic
988088659 5:26506123-26506145 GAGTCCAAGGAAAAATGGAAGGG - Intergenic
988290492 5:29278080-29278102 AAGAACAAAGAGAAATGGGTAGG - Intergenic
988292775 5:29311214-29311236 TAGAAAAAGTAGAAATGGTAGGG + Intergenic
988378766 5:30475509-30475531 AAGAAGAAGGAAGAAAGGGAAGG - Intergenic
988394671 5:30681233-30681255 TAGAACATGGAGAAATGTTACGG - Intergenic
988527718 5:32001216-32001238 AAGAAAAGGTAAGAATGGTAAGG + Intronic
988861359 5:35283597-35283619 AAAAACAAGGAAAAGTGGCTAGG + Intergenic
988914656 5:35880402-35880424 AAGAACAAGAAAAAGTAGGAAGG - Intergenic
989335286 5:40309086-40309108 AAGAAAAAGGCAAAATTGAATGG + Intergenic
989406160 5:41063570-41063592 AAGAAATGGGAAAAATGGAATGG + Intronic
989427867 5:41316778-41316800 AAGGACAGGGAAGACTGGTAAGG + Intronic
989440986 5:41471993-41472015 AAGAAAAAGGAAGAAAGGGAGGG - Intronic
989751423 5:44898909-44898931 AAGAAAAAGAAAAAATGGCCGGG + Intergenic
989764594 5:45066612-45066634 AAGAACAATTAAAGATGTTATGG - Intergenic
990389908 5:55308098-55308120 AAGGACAAGGGGAAATGGAAGGG + Exonic
990587849 5:57229491-57229513 AAGAAAAAGGAAAAAGGAAAAGG - Intronic
990716342 5:58641479-58641501 AAAAACCAGGAGAAATGCTAAGG + Intronic
990716627 5:58644671-58644693 AAGAACCAGGAGAAATAGTTAGG - Intronic
990812414 5:59743139-59743161 AAGAATAAGGAAAAAATTTAGGG - Intronic
991295988 5:65081373-65081395 AAGAACAAGCAAAGATGAAAAGG - Intergenic
991461453 5:66863532-66863554 AAGAAAAAGGGAAAGAGGTAGGG - Intronic
991683266 5:69159359-69159381 AAGAAAAAGGAAAAAAAGAAAGG - Intergenic
991924299 5:71689044-71689066 AAAAACAAGGATAAATAGTTGGG + Intergenic
992196244 5:74341918-74341940 GAGAACCAGGAAAAACGGAAAGG + Intergenic
992381159 5:76239206-76239228 AAGAACAAAGAAAACTGGAGAGG - Intronic
992426277 5:76661209-76661231 AAGAACTATAAAAAATGTTAAGG - Intronic
992499039 5:77323525-77323547 AAGAGCTAGGAAAATGGGTAGGG + Intronic
992836372 5:80645533-80645555 AAGAACAAAGTAATATGTTAAGG + Intronic
993213717 5:84991430-84991452 ATGAACAAGGATAAATCGTGGGG - Intergenic
993598723 5:89892470-89892492 AAGAGCAAGGAAAAGGGGCAGGG + Intergenic
993602401 5:89943980-89944002 ATGAACAAGGTAGAAGGGTATGG + Intergenic
994103825 5:95923290-95923312 AAGAACAAGGAAAAATGGTAGGG - Intronic
994163169 5:96579651-96579673 AAGAACAAGGAAAACTGGTGTGG - Intronic
994216740 5:97145848-97145870 GAGAACCAAGAAAAATGATATGG + Intronic
994695019 5:103063109-103063131 AAGAAAAAGGAAAAATCATTAGG - Intergenic
994986741 5:106942944-106942966 AAGGTCAAGGAAAATAGGTAAGG - Intergenic
995036095 5:107536141-107536163 TAGAACAAGGAGTAATTGTATGG - Intronic
995263638 5:110134583-110134605 AAGAGCAACAAAAAATGCTAAGG - Intergenic
995762895 5:115582713-115582735 AAGAACAAGTAGAAATGCTCTGG - Intronic
996118852 5:119648612-119648634 AAGAAAAATGAAAAAGGGTCTGG + Intergenic
996134812 5:119828284-119828306 AAGAAGAAAGAAAAACGGAATGG - Intergenic
996416540 5:123216889-123216911 AAGAACAAAGCAAAATGTTTCGG - Intergenic
996434126 5:123415307-123415329 AAGGAAAAGGAAAAATGTCAAGG + Intronic
996453969 5:123658707-123658729 AAGACCAAGGAACAATTGTAAGG + Intergenic
996577986 5:124997715-124997737 AAGAAAAAAGAAAAAAGGGAGGG - Intergenic
996578719 5:125006212-125006234 AAGAACAACTAAAATTGTTAAGG + Intergenic
997203849 5:132029809-132029831 AAGGAAAAGGAAAAAGGGAAAGG + Intergenic
997252086 5:132397051-132397073 AAGAATAGGAAAAGATGGTATGG - Intergenic
997364620 5:133318010-133318032 AAGCACAAGAAAAAGTGGTTGGG - Intronic
998515266 5:142748129-142748151 AAGAAAAAGGAAAAAAGTTTGGG - Intergenic
998831733 5:146167128-146167150 AAGATTAAGGAAACATAGTAAGG + Intronic
998929325 5:147163167-147163189 AGGAAGAAGGAAAAATGAAAAGG - Intergenic
998957920 5:147455489-147455511 AAGAACAAAGCAAAATGTTTAGG - Intronic
999302716 5:150501076-150501098 AACAACAACAAAAAATGGGATGG - Intronic
999432649 5:151537406-151537428 AAGGAAAAGGAAAAAAGGAAAGG + Intronic
999468301 5:151828233-151828255 AAGAACTAAGAAAAAAGCTAGGG + Intronic
999500563 5:152142774-152142796 AGGAACAAAGAAGAATGGCAGGG + Intergenic
999607555 5:153332419-153332441 TAGATGAAGGAAATATGGTATGG - Intergenic
1000208722 5:159089839-159089861 AAGAAAAAGGAAGAAAGGAAAGG + Intronic
1000312695 5:160060821-160060843 AAGAACAGGGCAAAACAGTATGG - Intronic
1000762996 5:165250015-165250037 AAGAAAAAGGAAGATTGGTGTGG + Intergenic
1000954763 5:167530298-167530320 AAGAATAAGGAATAAAGCTAGGG + Intronic
1001188312 5:169599933-169599955 AAGAACAATGAAACATATTAGGG + Intronic
1001735337 5:173993651-173993673 AAGAAAAAAGAAAAGTGATAGGG + Intronic
1001869909 5:175143502-175143524 CAGAACAAGGAAAACTATTAGGG + Intergenic
1002597076 5:180330940-180330962 AAGAACAGGGAAAACCGGGAAGG + Intronic
1002659494 5:180781926-180781948 AAGAAGAAGTAAAAATGAAAAGG + Intergenic
1003244943 6:4375679-4375701 AAAAAAAAGAAAAAAAGGTAGGG - Intergenic
1003262392 6:4531279-4531301 AAGAGCAAGGAAAAAGAGAAAGG + Intergenic
1003768315 6:9266688-9266710 AAGAATAAGAAAAAAAGGAAAGG + Intergenic
1003846932 6:10183390-10183412 AAGAACAAGGAAAAGTAATCAGG + Intronic
1004805138 6:19195470-19195492 AAAAACAAGTAAAAGTGGGAAGG + Intergenic
1005079258 6:21940491-21940513 ACAAACAAACAAAAATGGTAGGG - Intergenic
1005686863 6:28261675-28261697 AAGAGAAAGAAAAAATGATAAGG + Intergenic
1006070770 6:31496660-31496682 AAAAAAAAGGAAAAAGGGTCCGG - Intronic
1006570091 6:34995534-34995556 AAGAACATGGAAAAATTTTGGGG - Intronic
1007012373 6:38430172-38430194 AATAATAAGGAAAAAAAGTAAGG - Intronic
1007125948 6:39425802-39425824 AAAAAAAAGGAAAAATCATAAGG + Intronic
1007127055 6:39434266-39434288 AAGAAAAATGAAAAATGGCAGGG + Intronic
1007191228 6:40020642-40020664 GAGAAGATGGAAAAATGTTAGGG - Intergenic
1007585340 6:42985591-42985613 AAAAAAAAGGAAAAATGCAAAGG - Intronic
1007603503 6:43099221-43099243 AAAAAAAAGGAAAAATAGTTGGG - Intronic
1007732554 6:43956439-43956461 AAGAACAAGGAAAAATGAACAGG + Intergenic
1008880818 6:56378499-56378521 AAGAGGAAGGAAGAATGGGAAGG + Intronic
1008908738 6:56709875-56709897 AAGAACAAAGGAAAAAGGCAAGG + Intronic
1009606157 6:65870297-65870319 AAGCAGAAGGGAAAATGGGACGG + Intergenic
1009727687 6:67556781-67556803 AAAATAAAGGAAAAATGTTAAGG - Intergenic
1009861279 6:69336501-69336523 AAGAAAAAGGAAAAATAACATGG + Intronic
1010375933 6:75170106-75170128 AAGAAAATGGAAAAGGGGTAAGG - Intronic
1010500175 6:76589746-76589768 AAAAAGAAAGAAAATTGGTATGG - Intergenic
1010744838 6:79548830-79548852 AGGAACAATGAAAAATGGCAGGG + Intergenic
1010749639 6:79603791-79603813 AAGAAAAAAGAAAAGTGGTCTGG - Intergenic
1011825846 6:91304349-91304371 AAGAGAAAGGATAAATGGCATGG - Intergenic
1011985575 6:93439882-93439904 AAGAAAAAGAAAAAATGGTGTGG - Intergenic
1012038308 6:94171390-94171412 AAGAAAAAGGAAAAATCTGAAGG + Intergenic
1012184934 6:96201461-96201483 AATAAGAAGGAAAAATGTTAAGG - Intronic
1012236881 6:96828564-96828586 AAAAAAAAAAAAAAATGGTAGGG + Intronic
1012333916 6:98030049-98030071 AAGAACAAGGATAAATAATTTGG - Intergenic
1012533193 6:100263551-100263573 AAGAAAAAGGAAAAGAGGAAAGG + Intergenic
1012642490 6:101636882-101636904 AAGAACAAGGAAAGGCTGTAGGG - Intronic
1012657051 6:101837560-101837582 AAGAAAAAGGGAAAATAGTCTGG + Intronic
1012691925 6:102325111-102325133 AAAAACAAGAAAAAATGGGCCGG - Intergenic
1012782965 6:103586533-103586555 AAGAACAACAACAAATGGGAAGG - Intergenic
1012969296 6:105710255-105710277 AAGAACAATGGAAAATGGTTTGG - Intergenic
1013136996 6:107291862-107291884 AAGAAAAAAGAAAAATGCCAAGG + Intronic
1013358901 6:109374964-109374986 AAGTACTAGGGTAAATGGTAGGG - Intronic
1013412572 6:109894573-109894595 CAGAACAAGGAACAATGGTAAGG + Intergenic
1013458414 6:110353422-110353444 AAGAAAGAGGAAAAATGGTATGG - Intronic
1013894880 6:115075050-115075072 AAGAAGAAGAAAAAAGGGAAGGG + Intergenic
1014075784 6:117232748-117232770 AAAAGCTAGGCAAAATGGTAAGG + Intergenic
1014259258 6:119197307-119197329 AAGAAAAAAAAAAAAAGGTAAGG + Intronic
1014438254 6:121444501-121444523 GAGAACAAGAAAAAATGAAATGG - Intronic
1014801893 6:125787755-125787777 AAGAACAGTGAAAAGTGTTAGGG + Intronic
1015112337 6:129607478-129607500 AAGCACAAGGAGAAGTGGTAGGG - Intronic
1015479882 6:133697052-133697074 AAGAACCAGGATACTTGGTATGG + Intergenic
1015610012 6:135006859-135006881 TACAACAAGGAAAAGTGGCATGG + Intronic
1015807731 6:137128551-137128573 AAAAACAAAGAAAAATGGATGGG - Intergenic
1015991424 6:138948298-138948320 AACAACATGGAAAAATACTAAGG + Intronic
1016090740 6:139975941-139975963 AGAAAGAAGGAAAAAAGGTATGG - Intergenic
1016724103 6:147340753-147340775 TAAAACAAGAAAAAATGGGAAGG - Intronic
1016916048 6:149245455-149245477 AGAAACAAGGAAAAATGTCATGG - Intronic
1016927370 6:149364331-149364353 AAGATCAAGCAAAATAGGTAGGG - Intronic
1017279796 6:152610710-152610732 GAAATGAAGGAAAAATGGTAAGG + Intronic
1017338688 6:153293188-153293210 AAGAAGAACGAAAAATTGTGAGG + Intergenic
1017398114 6:154027701-154027723 AAGAAAAAGGAAAAGTGGGAAGG - Intronic
1017556401 6:155575752-155575774 AAGGAAGAGTAAAAATGGTATGG - Intergenic
1018203930 6:161419369-161419391 AAGAAAAAAGAAAAAAGGAAAGG - Intronic
1018367283 6:163134093-163134115 ATGAATAAGGAAGAATGGAAAGG + Intronic
1018533641 6:164795221-164795243 AATAACAAAGAAATATGGTGTGG - Intergenic
1019054171 6:169210170-169210192 CTAAACAAGGAAAAATGGAAAGG + Intergenic
1019651949 7:2164578-2164600 AAGAAGCAGGAAAAATGGGGGGG + Intronic
1020376528 7:7493658-7493680 AAGAAAAAGGGGAAATGGGAAGG - Intronic
1020533629 7:9365528-9365550 AAAAACCAGGAAAATTGTTAAGG + Intergenic
1020668697 7:11078357-11078379 ACTAACTAGGAAAAATGGTGGGG + Intronic
1020756188 7:12206526-12206548 AAAATCAAGGACAAATGGAAGGG - Intergenic
1021264328 7:18500601-18500623 AAGAACAACCCAAAATGGTGAGG - Intronic
1021513330 7:21457223-21457245 AAGAAAAAGGAAATCTGGCAGGG - Intronic
1021757175 7:23863232-23863254 AAAAAAATGGAAAAATGTTAAGG - Intergenic
1022629067 7:32068404-32068426 AAGAAGAAGAAGAAGTGGTAAGG + Intronic
1023309630 7:38871065-38871087 AAGGATAAGGAAAAATGGAAAGG + Intronic
1023379103 7:39588213-39588235 TAGAAGAAGGAAAAATGGGCCGG + Intronic
1023521936 7:41058137-41058159 AAGAACAAGAAAAAATCATCAGG - Intergenic
1023678852 7:42662297-42662319 AAGAACAAGGAAGGATGGGAAGG + Intergenic
1023721007 7:43095036-43095058 AAGAACAAATAAAAATGTAATGG - Intergenic
1024195699 7:47056842-47056864 AAGAAGAAGGCAAACTGGTCTGG - Intergenic
1024747974 7:52429674-52429696 AGGAACAAGGAAAGAAGGAAAGG - Intergenic
1024770800 7:52720823-52720845 AAGAAAAAGAAAAAAATGTATGG + Intergenic
1025823184 7:64990694-64990716 CAGAACAAAGAATAATGTTATGG + Exonic
1025824554 7:64999714-64999736 CAGAACAAAGAATAATGGTATGG + Intronic
1025837327 7:65106466-65106488 AAGAAAAAGGAAAAAGGAAAAGG - Intergenic
1025922679 7:65928237-65928259 AAAAAGAAGGAAAAAAGGTAGGG - Intronic
1026073106 7:67140255-67140277 AAGAACAAGGTGATATGGTTTGG - Intronic
1026703779 7:72671959-72671981 AAGAACAAGGTGATATGGTTTGG + Intronic
1027155960 7:75768125-75768147 AAGAAGTTGCAAAAATGGTATGG - Intergenic
1027535683 7:79397946-79397968 AAAAACAAGGAAATATATTAGGG - Intronic
1028000486 7:85491637-85491659 AAGGAAAAGGGAAAATGGTTAGG - Intergenic
1028072127 7:86463577-86463599 AAAAAAAAGGAAAATTGGCAAGG + Intergenic
1028435664 7:90800581-90800603 AGTTACAAGGAAAAATGGTATGG - Intronic
1028655227 7:93197406-93197428 AAGAGAGAAGAAAAATGGTAAGG + Intronic
1029469597 7:100745878-100745900 AAGAAAAAGGAAAAAAGAAAAGG + Intronic
1029576874 7:101409237-101409259 AAGGACCAGGAAAAATAGCAAGG - Intronic
1030225895 7:107150208-107150230 AAGAACTAGTAAAAATTTTAAGG - Intronic
1030903260 7:115150274-115150296 AAGAACAAGGAAGAAATGAAAGG - Intergenic
1031388458 7:121182547-121182569 AATAACAAGGAGAAATGAAAAGG - Intronic
1031644447 7:124206548-124206570 AGGAACAAGGAGAAAAGTTAAGG - Intergenic
1032026908 7:128450296-128450318 AAATGCAAGAAAAAATGGTAAGG - Intergenic
1032260655 7:130333751-130333773 AAGAACCAAGAAAAATTGTCTGG + Intergenic
1032682461 7:134199277-134199299 ATGAACAAGGAAAAATATGAGGG + Exonic
1032734369 7:134677406-134677428 AACAACTATGAAAAATGGAAAGG - Intronic
1032763596 7:134968229-134968251 AAGAAAAATGAATAATAGTATGG - Intronic
1032896580 7:136257570-136257592 CATAACAATGAAAAATGGAAGGG + Intergenic
1032946675 7:136861772-136861794 AAGAAGATGGACAAATGGTAAGG - Intergenic
1033602224 7:142896688-142896710 AAGAACAAGGAAAGGTGGCAGGG + Intergenic
1033854390 7:145540714-145540736 AAGAAGAAGGAAAAAAAGGAAGG - Intergenic
1034031051 7:147764074-147764096 GAGAACAAGGGAAAAAGCTATGG - Intronic
1036415565 8:8544539-8544561 AAGAACAAAGAAAAAGGGAAGGG + Intergenic
1036544729 8:9756812-9756834 AAGAAGAAGATAAAATGGCATGG - Intronic
1037680569 8:21093791-21093813 AAGAACAAGAGAAAAGGGAAGGG + Intergenic
1038292774 8:26264775-26264797 AAGAAGAAGGAAAGAAGGCAGGG + Intergenic
1038573221 8:28681166-28681188 AAAAAGAAGGAAAATTGGCAAGG - Intronic
1038631759 8:29252020-29252042 AGGAAAAAGGAAAAAGGGAAGGG + Intronic
1038801441 8:30753089-30753111 AAGCACAAGGAGAGAAGGTAAGG + Exonic
1039632119 8:39123474-39123496 AACCACAAGGAAGAATGTTATGG - Intronic
1041411606 8:57562056-57562078 AACAGCAAGGAAACATTGTATGG + Intergenic
1041667472 8:60459693-60459715 AAGCACAAGGTAAACTGGGAAGG + Intergenic
1041713118 8:60910862-60910884 AAGAACAAAGAAAAATCTTAGGG - Intergenic
1041761248 8:61369064-61369086 AAGAAAAAGGAAGGATGGAAGGG - Intronic
1042188803 8:66164905-66164927 AAGGGAAAGGAAAAATGGGAAGG + Intronic
1042326988 8:67539422-67539444 GAAATCAAGGAAAAATGTTAAGG - Intronic
1042519916 8:69700475-69700497 GAGAACGAGAAAAAATGGCAAGG + Intronic
1042658613 8:71129471-71129493 TAGAACAAGGAATAATGACACGG - Intergenic
1042782494 8:72507449-72507471 AAAATCAAGGCAAAATGGCAAGG + Intergenic
1043164764 8:76889997-76890019 AGAAACAATGAAAAATGGCAGGG + Intergenic
1043276549 8:78403403-78403425 AAGAAAAAGGAAAAACAGAAGGG + Intergenic
1043612959 8:82088864-82088886 AATAGCAAGGAAAAATTGGAAGG + Intergenic
1044292599 8:90490434-90490456 GAAATGAAGGAAAAATGGTAAGG - Intergenic
1044339931 8:91035441-91035463 AAGAAAGAGCAAAGATGGTAAGG - Intronic
1044642301 8:94396073-94396095 AAGAAGAAGGAAAAAGAGTAAGG + Intronic
1044933811 8:97275360-97275382 AAGAATAAGGAAAGAAGGAAGGG + Exonic
1045313226 8:101021628-101021650 AAGAACAAAGAAAACTGGAGGGG + Intergenic
1045381643 8:101633663-101633685 AAGAACAAGGACACAAAGTAGGG + Intronic
1045536381 8:103032472-103032494 AAGAAAAAGAAAAAAAGGAAGGG - Intronic
1045605031 8:103763449-103763471 AAGAAGAAGGAAGAAAGGAAGGG + Intronic
1046282091 8:112046794-112046816 AAAAACAATGAAAATTGCTATGG + Intergenic
1047031757 8:120889581-120889603 AAGCAAAAGGGAAAATGGTTTGG - Intergenic
1047106861 8:121741743-121741765 AAGAAAAAGGAGAAATGAAATGG - Intergenic
1047416958 8:124672497-124672519 AAAAAAAAAGAAAAATGGGAAGG + Intronic
1047585686 8:126269396-126269418 AAAAACAAAGAAAAAAGGAAAGG + Intergenic
1047642332 8:126833818-126833840 AACAACACGGAGAAATTGTACGG - Intergenic
1047859866 8:128954013-128954035 AAGAAAATAAAAAAATGGTATGG - Intergenic
1048250966 8:132866611-132866633 AAGGAGAAGGAGAAAGGGTAGGG + Intergenic
1048680485 8:136836014-136836036 AAGAACAGGGAAAAATGAAGGGG - Intergenic
1049022557 8:139967740-139967762 AAGACAAAGGAAAAATGCTGGGG - Intronic
1049129062 8:140820562-140820584 AAGAAGAAGAAAGAAAGGTAGGG - Intronic
1050129436 9:2396229-2396251 AAAAACAAAGAATAAGGGTAAGG + Intergenic
1050479885 9:6078777-6078799 AAGAAAAAGAAAAAATGGGTGGG - Intergenic
1050489283 9:6170670-6170692 AAGAAGAAGGAAAAATAGGTAGG - Intergenic
1050802472 9:9632865-9632887 ATGAACAAGGAAGAATTGTTAGG + Intronic
1051138021 9:13945611-13945633 AGAAACAAGGAGAAATGGTCAGG - Intergenic
1051574988 9:18605105-18605127 CAGAAGAGGGAAAAAAGGTAGGG - Intronic
1051593537 9:18800397-18800419 AAAAAAAAGGAAAAATGGACAGG + Intronic
1051706837 9:19889583-19889605 AGGAACGAGGAAAAATGGTTTGG - Intergenic
1051777011 9:20645840-20645862 AAAAAAAAGGAAAATTGGTGAGG - Intergenic
1051948851 9:22606037-22606059 AAGAAGAAACAAAAGTGGTATGG - Intergenic
1052173528 9:25429548-25429570 AAGAAGAAGTAAATATGGGAAGG + Intergenic
1052222537 9:26044644-26044666 AAGAACAGAAAAAAATTGTAAGG - Intergenic
1052299299 9:26935443-26935465 GAGAACAAGGAAAAAAGAAAGGG + Intronic
1052481054 9:29026768-29026790 CAGAACAATGAAAAATGTAATGG - Intergenic
1052511221 9:29423292-29423314 AAGAACAAAGAAAAAAGTCATGG + Intergenic
1052573071 9:30253937-30253959 GAGAACAATGTAAAATGTTACGG - Intergenic
1052576827 9:30301625-30301647 TAGAACAAAGAATAATGATACGG + Intergenic
1052595768 9:30556648-30556670 AAGAACAAGGAAAATGAGTGAGG + Intergenic
1052618138 9:30869625-30869647 AAAAACAAGTCCAAATGGTATGG - Intergenic
1052906118 9:33835566-33835588 AAAAACAAACAAAAATTGTAAGG - Intronic
1055119263 9:72639848-72639870 ATGAACAACGAAAAAAGCTATGG - Intronic
1055576994 9:77670533-77670555 ATGTTAAAGGAAAAATGGTAAGG + Intergenic
1055869788 9:80861662-80861684 CAGAACAAGGAAAAATTTCAGGG - Intergenic
1056184959 9:84125512-84125534 AGACACAAGTAAAAATGGTAAGG - Intergenic
1056445171 9:86658605-86658627 AAGAACATGTAAAAATGGCCGGG - Intergenic
1056723499 9:89091217-89091239 AACAACAAGGAAGAATAGCAAGG + Intronic
1058071517 9:100605430-100605452 AAGAACACTAAGAAATGGTAAGG - Intergenic
1058728788 9:107829416-107829438 AAGGAAAAGGAGAAAGGGTAGGG - Intergenic
1058750040 9:108031011-108031033 AAAATGAAGGAAAAATGTTAAGG - Intergenic
1059551352 9:115232165-115232187 AAGAGAAAGGAAAGAAGGTAAGG - Intronic
1059641413 9:116220176-116220198 AAGAAGAAGGAAACTTGGAAGGG + Intronic
1059708424 9:116845110-116845132 AAAAAAAAGAAAGAATGGTATGG - Intronic
1059738851 9:117129815-117129837 AGGAACAAGGAAAAATCCTTAGG - Intronic
1059967974 9:119635013-119635035 TATATCAAGGAAAAAGGGTAAGG + Intergenic
1060030392 9:120209919-120209941 AAGAACAAGGATTAGAGGTAAGG + Intergenic
1061457732 9:130711616-130711638 AAGAAAGAGGAAAAAAGGAAAGG + Intergenic
1061686334 9:132282654-132282676 AGGAACAAGGAAGAAAGATATGG - Intronic
1185791725 X:2932356-2932378 AAGAAAAAGGAAGAAAGGGAGGG - Intergenic
1185978548 X:4749396-4749418 AAGGAAAAGGCAAAATGGGAGGG - Intergenic
1186038339 X:5448601-5448623 AAGAAAAAGGAAAAAAGGCCGGG - Intergenic
1186306461 X:8264935-8264957 AAGGACAAGGGTAAATGATAGGG - Intergenic
1186331325 X:8537442-8537464 AAGAAAGAGGCTAAATGGTAAGG + Intronic
1187693190 X:21892657-21892679 AAAAACAGGGAAAAATGAAAAGG + Intergenic
1187804402 X:23102992-23103014 AAGAAGCAGGAAAACTAGTAAGG - Intergenic
1188077365 X:25794629-25794651 AAGAAATAAGAAAAATGGAAGGG - Intergenic
1188416679 X:29943873-29943895 AACAGCAATGAAATATGGTAAGG - Intronic
1188745499 X:33836830-33836852 AAAAAAAAGGAGAAATGGAAAGG + Intergenic
1188881000 X:35492083-35492105 AACAACAACAAAAAATGGAAGGG - Intergenic
1189048308 X:37617102-37617124 AGGAACAAGGAAAAGTGGGTGGG + Intronic
1189250173 X:39594591-39594613 AAGAACAAAGAAAAAGAGTGAGG - Intergenic
1189283626 X:39836708-39836730 AAGGATGAGGAAAGATGGTAGGG + Intergenic
1189711243 X:43814523-43814545 AAGTACAAGTTAAGATGGTAGGG - Intronic
1189738467 X:44095075-44095097 AGGAACCAGGAAAAATGAGATGG - Intergenic
1190203285 X:48381923-48381945 AAGAACAACCAAAAATAGCATGG + Intergenic
1190207251 X:48413481-48413503 AAGAACAACCAAAAATAGCATGG - Intergenic
1190571315 X:51784954-51784976 AAGAAGAAGGCAAACTAGTAAGG - Intergenic
1192309249 X:69996433-69996455 ATAAACAAGGAAACATGATAAGG + Intronic
1192343283 X:70281345-70281367 AAGGAAAAAGAAAAATGGGAAGG - Intronic
1192592932 X:72375966-72375988 ACTAACAAGAAAAAATGGAATGG - Intronic
1192918358 X:75678930-75678952 AAGAAAAAAGAAAAATTGAAAGG + Intergenic
1192931557 X:75811722-75811744 AAGCACAAGGAAGAGTGGGAAGG - Intergenic
1193097435 X:77565980-77566002 AACAACAGAGAAAAATGGAATGG + Intronic
1193164160 X:78262773-78262795 AAAATGAAGGAAAAATGCTAAGG - Intergenic
1194037029 X:88887338-88887360 AAGACGAAGGAAGAATGGGAAGG - Intergenic
1194070166 X:89313591-89313613 AAGCAGAAGGAATAATGGTTTGG - Intergenic
1194081311 X:89468162-89468184 AAGAAGAAGGAAAACTGGTAAGG - Intergenic
1194802111 X:98286722-98286744 AAGAAATACCAAAAATGGTAAGG + Intergenic
1194899765 X:99496406-99496428 AAAAAAAAGAAAAAATGGTTTGG + Intergenic
1194939324 X:99990287-99990309 GAGAAGAAGGAATAATGGTGGGG + Intergenic
1195010558 X:100729402-100729424 AAGAACAATGTAATAAGGTAGGG + Intronic
1195935455 X:110121350-110121372 CAGAACAAGGAAAGAAGGAATGG - Intronic
1196011046 X:110888374-110888396 AAGAGCAAGGAATAATCGGAAGG - Intergenic
1196306496 X:114108913-114108935 AAAAACAAAGAAAAAGGGTTTGG + Intergenic
1196989269 X:121309909-121309931 AAGAAAAAATAAAAAAGGTAAGG + Intergenic
1197020532 X:121682522-121682544 AAAAACAAGATAAAATTGTAGGG + Intergenic
1197026455 X:121755871-121755893 CAGAACAAAGAATAATAGTACGG + Intergenic
1197187185 X:123600757-123600779 AATTACAAGAAAAAATGGCAAGG + Exonic
1197356902 X:125446180-125446202 AAAATGAAGGAAAAATGTTAAGG + Intergenic
1197566027 X:128088131-128088153 AGAAACAAAGAAAAAGGGTAAGG + Intergenic
1197617731 X:128713893-128713915 TATCACAAAGAAAAATGGTAGGG - Intergenic
1197889499 X:131255104-131255126 AAGAACAAAGAAAAATTGAAAGG - Intergenic
1197935894 X:131740204-131740226 CAGAACAAAGAATAATGGTATGG + Intergenic
1198100729 X:133419503-133419525 AAGAAAAAGAAAAAAAGGTGGGG - Intergenic
1198314052 X:135449361-135449383 AAGAACAAAGGAAATGGGTAGGG + Intergenic
1198421897 X:136476809-136476831 AAAGACAAGGAAAATTGGAAAGG + Intergenic
1198589599 X:138162607-138162629 AAGAAAAAGGAAAAATGAACTGG + Intergenic
1199073910 X:143509283-143509305 AAGAACAAGGTGAAATCATAGGG + Intronic
1199596077 X:149506844-149506866 AAGGAGAAGGGAAAATGGCAGGG + Intronic
1199658893 X:150026553-150026575 AAGAACAAAGAAAATTACTAAGG + Intergenic
1200051815 X:153436678-153436700 AAAAACAAGTAAAAATGTAAAGG + Intergenic
1200433983 Y:3124359-3124381 AAGAAGAAGGAAAACTGGTAAGG - Intergenic
1201272726 Y:12270989-12271011 AAGAAAAAGGAAGAAAGGGAGGG + Intergenic
1201408718 Y:13675718-13675740 CAGAACAAAGAATAATGGTATGG + Intergenic
1201782274 Y:17736694-17736716 AACAAAAAGAAAAAATGTTAAGG - Intergenic
1201819279 Y:18169294-18169316 AACAAAAAGAAAAAATGTTAAGG + Intergenic