ID: 994104481

View in Genome Browser
Species Human (GRCh38)
Location 5:95931160-95931182
Sequence CTGGAGCCAGAGTTGGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 354}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994104481_994104485 2 Left 994104481 5:95931160-95931182 CCAGTTTCCAACTCTGGCTCCAG 0: 1
1: 0
2: 4
3: 38
4: 354
Right 994104485 5:95931185-95931207 TCTACCATCTGTGTTACCTTGGG No data
994104481_994104484 1 Left 994104481 5:95931160-95931182 CCAGTTTCCAACTCTGGCTCCAG 0: 1
1: 0
2: 4
3: 38
4: 354
Right 994104484 5:95931184-95931206 ATCTACCATCTGTGTTACCTTGG 0: 1
1: 1
2: 10
3: 89
4: 665

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994104481 Original CRISPR CTGGAGCCAGAGTTGGAAAC TGG (reversed) Intronic
902304398 1:15525222-15525244 CTGGTGCCAGAATTGCAAAAGGG - Intronic
903461842 1:23525829-23525851 GGGGATCCAGAGTTGGAAAGAGG - Intronic
903846910 1:26284246-26284268 CTACAGGCAGAGTTGGGAACCGG + Intronic
904692494 1:32304260-32304282 CTGGAGCCAGTGGAGGCAACTGG + Intronic
904789467 1:33007838-33007860 GTGGAGCCAGACTTGGACTCAGG + Intergenic
905936914 1:41831957-41831979 ATGGAGCCAGGGTTGGAATCTGG + Intronic
906775344 1:48524385-48524407 CTGGAGACAGAGTCTGAAAAGGG + Intergenic
906815576 1:48874885-48874907 CAGGAGCCAAGGTTGGAAGCAGG - Intronic
908357352 1:63335936-63335958 ATGGAGCCAGAATTTGAAATCGG - Intergenic
912400846 1:109390710-109390732 GTGGAACCAGACTTGCAAACTGG + Intronic
912936807 1:114010823-114010845 GTGGATCCAGAGCTGGAACCAGG + Intergenic
912996443 1:114536571-114536593 CTGGTGACGGAGGTGGAAACTGG + Intergenic
913828896 1:123206240-123206262 TTGAGGCCATAGTTGGAAACGGG + Intergenic
914001502 1:143698619-143698641 CTGGCGCCAGAGATAGAAAGAGG + Intergenic
915491499 1:156252420-156252442 CTGGAGGCAGAGTTTAAAAAAGG - Exonic
916850233 1:168695938-168695960 TTGGAGGCAGAGCTGAAAACAGG - Exonic
917857158 1:179110107-179110129 CTGGAGCCAGAGTTGTATGTTGG + Intronic
920412259 1:205771537-205771559 CAACAGCCAGAGGTGGAAACAGG - Exonic
920533204 1:206720086-206720108 CTGGAGCCAGAGAGGGACACAGG - Intronic
922237276 1:223731549-223731571 CAGGAGACAGACGTGGAAACTGG - Intronic
923105938 1:230853912-230853934 CTGGGGCCAGAGTGGGAAACAGG - Intronic
923652971 1:235891153-235891175 CTTGAGCCAGAATTTGAAGCTGG + Intergenic
924215903 1:241822249-241822271 CCGGAGCCAGAATTGTAATCTGG - Intergenic
1064855356 10:19761048-19761070 CTGGAGGCAGAGCAAGAAACTGG - Intronic
1065179328 10:23108802-23108824 CTAGTGCCAGTGTTGGAAGCAGG + Intronic
1065268194 10:23999338-23999360 CTGGAGGCAGTGTTGGACCCTGG + Intronic
1066045753 10:31594375-31594397 CTGGATCGAGGGTTGGAAAAAGG + Intergenic
1066821843 10:39503660-39503682 TTGAAGCCATCGTTGGAAACGGG + Intergenic
1066823348 10:39526118-39526140 CTGAAGCCTTCGTTGGAAACCGG + Intergenic
1067202619 10:44186435-44186457 CTGGAGCCAGTGTTTGAAATAGG - Intergenic
1068405471 10:56583005-56583027 CTGGAGTCAGAGTAGGAAGAAGG - Intergenic
1068547483 10:58365251-58365273 CTTGAGCCCGAGTTCGAGACCGG + Intronic
1069965544 10:72112136-72112158 CTGGACCCAGAGATGGTGACAGG - Intronic
1070713590 10:78701285-78701307 ATGGAGCCAGAATTTGAAACAGG + Intergenic
1072328733 10:94324624-94324646 CTGTAGCCAGATCTGGAAGCTGG + Intronic
1074796903 10:116955844-116955866 CAGAAGCTAGAGTTGGAGACTGG - Intronic
1074881574 10:117663495-117663517 CTGAAGCCAGAGTTGAATGCAGG - Intergenic
1075316528 10:121457901-121457923 CTGAAACCAGAGAGGGAAACTGG + Intergenic
1075945025 10:126425337-126425359 CTAGAGGCTGACTTGGAAACCGG - Exonic
1077038061 11:504656-504678 TTGGGGCCAGAGTGGGAAACGGG - Intronic
1077672441 11:4168172-4168194 CTGGAGGCAGAGTTAGACAGGGG - Intergenic
1077925903 11:6682016-6682038 CTGGAGCTAGAGATGTAAAATGG - Exonic
1078069334 11:8097994-8098016 CTAGAGCCAGACTTGGAGATGGG + Intronic
1079241240 11:18723626-18723648 CTGGGGCCAGACTTGGAAGAGGG - Intronic
1079301744 11:19284604-19284626 CAGGAGACAGTGCTGGAAACTGG + Intergenic
1079968080 11:27003323-27003345 CTGGAGGCAGAGAGGGAAAGAGG - Intergenic
1081552580 11:44127661-44127683 CTGTAGTCAGAGTTGAACACCGG - Intronic
1083733307 11:64665361-64665383 CTGGAGCCAGAGTCTGGACCAGG - Intronic
1083876614 11:65527240-65527262 CTGGAGCCTGGGTTTGAACCCGG - Intronic
1084635392 11:70388852-70388874 CTGCAGTTAGAGTTTGAAACTGG - Intergenic
1086506464 11:87509699-87509721 CTAGATGAAGAGTTGGAAACTGG - Intergenic
1087419455 11:97902531-97902553 ATGGAGCTAGAGTGGTAAACAGG + Intergenic
1089341809 11:117763250-117763272 CTGGGGTCAGGGTTGGACACTGG - Intronic
1089341911 11:117763774-117763796 CTGGGGTCAGGGTTGGACACTGG + Intronic
1090864804 11:130690209-130690231 CTGGAGTCCCAGTTGGAAATGGG + Intronic
1090947359 11:131443086-131443108 CTGAAGACGGAGATGGAAACAGG - Intronic
1090964455 11:131585816-131585838 CTGGAGCCACAGTGGGAAAAAGG - Intronic
1091044681 11:132315209-132315231 CTGGAGACAGTTTTGGAAAAAGG - Intronic
1091198742 11:133754126-133754148 CTAAAGCAAGAGTTGGAAACTGG - Intergenic
1091642520 12:2248311-2248333 CAGGAACCAGAGTTGGATGCTGG + Intronic
1092737732 12:11599125-11599147 CTTGACCCTGAGTTGGACACAGG + Intergenic
1092983102 12:13817478-13817500 GTGGAGAAAGAGTTGAAAACAGG - Intronic
1094389036 12:29928948-29928970 CTGGAGGCAGAGTGGGCACCTGG - Intergenic
1094926721 12:35532945-35532967 TTGGGGCCATCGTTGGAAACGGG + Intergenic
1094931236 12:35605977-35605999 TTGGGGCCATCGTTGGAAACGGG + Intergenic
1094936549 12:35692213-35692235 TTGGGGCCTTAGTTGGAAACGGG + Intergenic
1094945119 12:35831159-35831181 TTGGGGCCATCGTTGGAAACGGG + Intergenic
1094946242 12:35849153-35849175 TTGGAGCCTTCGTTGGAAACGGG + Intergenic
1094946364 12:35851188-35851210 TTGGGGCCTTAGTTGGAAACGGG + Intergenic
1094951407 12:35933406-35933428 TTGGGGCCATCGTTGGAAACGGG + Intergenic
1094951554 12:35935784-35935806 TTGGGGCCTTAGTTGGAAACGGG + Intergenic
1094952614 12:35952763-35952785 TTGGGGCCTTAGTTGGAAACGGG + Intergenic
1094971242 12:36253399-36253421 TTGGGGCCTTAGTTGGAAACGGG + Intergenic
1094973186 12:36284662-36284684 TTGGGGCCTTAGTTGGAAACGGG + Intergenic
1094975115 12:36315568-36315590 TTGGGGCCATCGTTGGAAACGGG + Intergenic
1094985370 12:36481705-36481727 TTGGGGCCATCGTTGGAAACGGG + Intergenic
1094985713 12:36487140-36487162 TTGGGGCCATCGTTGGAAACGGG + Intergenic
1094995245 12:36641369-36641391 TTGGGGCCATCGTTGGAAACGGG + Intergenic
1095002595 12:36760423-36760445 TTGGGGCCTTAGTTGGAAACGGG + Intergenic
1095007608 12:36841856-36841878 TTGGGGCCATCGTTGGAAACGGG + Intergenic
1095016394 12:36983947-36983969 TTGGGGCCATCGTTGGAAACGGG + Intergenic
1095017741 12:37005696-37005718 TTGGGGCCATCGTTGGAAACGGG + Intergenic
1095026348 12:37144946-37144968 TTGGGGCCATCGTTGGAAACGGG + Intergenic
1095485500 12:42680216-42680238 CTGTAGCCAGAGTGGTAAATGGG + Intergenic
1097053273 12:56236285-56236307 CAGGTGCCAGAGGTGGAACCAGG + Intronic
1098866672 12:75771594-75771616 GTGGAGCCAGAGTTAAATACAGG + Intergenic
1099984991 12:89651803-89651825 CTGGAGCCAGAGTGAGACTCTGG + Intronic
1100853416 12:98737156-98737178 CTGGAGGCAGAGATGGCAGCTGG - Intronic
1100924338 12:99526947-99526969 CTGGAGACAGACTTGTACACAGG + Intronic
1101759253 12:107645594-107645616 CTGGAGCATGAGCTGGAAGCTGG + Intronic
1102245418 12:111352829-111352851 GCGGAGCCAGAGTTGAAACCAGG - Intergenic
1102363747 12:112313031-112313053 CTGGAGCCAGTGTTGCTATCCGG + Exonic
1102906065 12:116676063-116676085 CTGTTGCCAGAGGTGGAAATTGG + Intergenic
1103299320 12:119915858-119915880 CTGGAGCTGGAGGTGGAAATGGG - Intergenic
1103317667 12:120069642-120069664 AAGGAGCCGGAGGTGGAAACGGG - Intronic
1103386035 12:120533507-120533529 CAGGAGACAGAGGCGGAAACAGG - Intronic
1104173839 12:126309702-126309724 CTGAAGCCAGAGATGGTAAGTGG - Intergenic
1105299970 13:19124528-19124550 CTGGAGCCAGTGTTGCTATCTGG - Intergenic
1106125845 13:26899506-26899528 CTGGAGGCAGAGCTGCAAGCCGG - Intergenic
1107086159 13:36430402-36430424 CTGAAGCCAGTGTTGGAGTCGGG - Intergenic
1109438366 13:62336152-62336174 CTGGAGATAGACTTGGAAAAAGG + Intergenic
1110944865 13:81399845-81399867 GTGGAGCAAGAGTTGGTAAGAGG + Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113731027 13:112641661-112641683 CTGGAAGCAGACTTGGAGACTGG - Intergenic
1115354145 14:32429117-32429139 TTGGAGCCAGAGTTGTAACTCGG + Intronic
1118629036 14:67686181-67686203 GTGGAGCCAGGATTTGAAACTGG - Intronic
1122984794 14:105207119-105207141 CTTGAGCCAGAGTTGGAGGGTGG - Intergenic
1124035191 15:26048213-26048235 CTGATTCCAGACTTGGAAACTGG + Intergenic
1124046675 15:26156818-26156840 CTGGAGCCACAAGTGGAAACTGG - Intergenic
1125501600 15:40243065-40243087 TTGGACCCAGAGTTGGCAAAAGG - Intronic
1128213790 15:65920326-65920348 CTGGAGCCTGAGCTGCAAACAGG - Intronic
1128799694 15:70489649-70489671 CCGGTGCCAGAGTAGGAAAGGGG + Intergenic
1130214797 15:81958107-81958129 CTGTAGCCAAAGTTGGATTCAGG - Intergenic
1130636190 15:85622469-85622491 CCGGAGCCAGAGGTGGGACCTGG + Intronic
1131440871 15:92458702-92458724 CTGGAGCCAGGGAAGGACACTGG + Intronic
1131982339 15:98006278-98006300 CTGGAGACAGTGATAGAAACAGG - Intergenic
1132845148 16:1997592-1997614 CTGAAGCCAAATTTAGAAACAGG - Intergenic
1134518763 16:14908062-14908084 CTGGAGGCAGAGCTGGAGACAGG - Intronic
1134555165 16:15158154-15158176 CTGGAGGCAGAGGTGGAGACAGG + Intergenic
1134706434 16:16306715-16306737 CTGGAGGCAGAGCTGGAGACAGG - Intergenic
1134860295 16:17554720-17554742 GTGGAGCTAGAGTTAGAAGCAGG - Intergenic
1134961106 16:18405395-18405417 CTGGAGGCAGAGCTGGAGACAGG + Intergenic
1134965408 16:18487998-18488020 CTGGAGGCAGAGCTGGAGACAGG + Intronic
1136011550 16:27366843-27366865 CTGGAGCCAGGATTTGAACCCGG + Intergenic
1136908073 16:34120385-34120407 CAGAAGCCAGAGATGGTAACTGG - Intergenic
1137811300 16:51355351-51355373 CTGGAGCCAATGTTGCAACCTGG - Intergenic
1138332650 16:56227398-56227420 CTGGAGACAGGGTGGGAACCAGG - Intronic
1138569170 16:57857289-57857311 CTGGAACAAGATTTGGAAACAGG - Intronic
1138693493 16:58790481-58790503 CTGGAGCCAGCAGTGGCAACCGG - Intergenic
1139141187 16:64264463-64264485 CTGGAGCCAGATTGGGAAACTGG + Intergenic
1139203882 16:65006580-65006602 CTGAACACAGAGTTGGGAACTGG + Intronic
1139408361 16:66737908-66737930 CTTGAGCCAGAGAAGAAAACAGG + Intronic
1140326732 16:74011835-74011857 CAGGAGCCTGGGTTGGAAACAGG - Intergenic
1140650828 16:77086289-77086311 CAGGAGACAGAGTTGAAAGCTGG - Intergenic
1140930572 16:79623905-79623927 CTGGAGCCAGAGTCAGGGACTGG - Intergenic
1141463218 16:84190814-84190836 CAGGAGCTAGAGTGTGAAACTGG + Intergenic
1141988236 16:87593930-87593952 CTGGATCCAGGGTCTGAAACAGG + Intergenic
1142112237 16:88339127-88339149 CTGGAGCGAGAGTGGGAGCCAGG + Intergenic
1143141231 17:4742912-4742934 CTGGAACCAGACTTAGAACCAGG + Intronic
1143539595 17:7561311-7561333 CTGGAGATAGTGATGGAAACTGG - Exonic
1145888871 17:28400807-28400829 GTGGTGCCAGAGTTGGAATATGG - Exonic
1147048181 17:37770504-37770526 GTAGAGCCAGAATTGGAATCTGG + Intergenic
1147195066 17:38760990-38761012 GTGGAGGCAGAGAGGGAAACTGG - Intronic
1147888440 17:43700100-43700122 CTGGAGCCAGATGTAGAATCTGG - Intergenic
1148961563 17:51397567-51397589 TTGGGGCCAGAGTTGGAGCCAGG + Intergenic
1149487509 17:57054434-57054456 ATCTAGCCAGAGCTGGAAACTGG - Intergenic
1150320253 17:64207663-64207685 CTGGAGGCAGAGTGGAAATCTGG + Intronic
1151814886 17:76466932-76466954 CAGGAGCCCGAGATGGACACAGG + Intronic
1152982887 18:295533-295555 CTTGAGCCAGGGTTGCAAACTGG - Intergenic
1153291003 18:3501460-3501482 ATGGTGACAGAATTGGAAACGGG + Intronic
1153595530 18:6721340-6721362 CTGGAGACAAAGCTGGAGACAGG - Intergenic
1153909411 18:9693749-9693771 CAGAATCCAGAGTTGGAAAGGGG + Intergenic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1155454801 18:25999677-25999699 CTGGAGCCAGGGATGGGGACAGG + Intergenic
1156969814 18:43140482-43140504 CTGGAGCCAGCAGTGGCAACTGG + Intergenic
1157594195 18:48853929-48853951 CTGGAGCCAAAGTTTTAATCTGG - Intronic
1158039219 18:53072181-53072203 CAGTAGCCAGAGTTGCAAACAGG + Intronic
1158274930 18:55756897-55756919 CTTAAGCCAGAGTTGGAAGAGGG - Intergenic
1158285611 18:55878242-55878264 CTGATTCCAGAGTTGGAATCTGG - Intergenic
1159176384 18:64840771-64840793 GTGGACACAGAGTTGAAAACAGG - Intergenic
1159860873 18:73647824-73647846 GTGGAGCCAAGGTTGGTAACCGG + Intergenic
1160471030 18:79133892-79133914 CTGGAGTCAGAGCTGGAGCCAGG - Intronic
1160957651 19:1700753-1700775 CTGGGGCCAGAGGTGCAGACGGG + Intergenic
1161111422 19:2472908-2472930 CTGGAGCCAGGGCTGGAAAAAGG + Intergenic
1161352539 19:3801924-3801946 CGGGAGCCAGGGATGGGAACGGG + Intronic
1162937261 19:13987407-13987429 CTGGACCCAGACTTGGAGCCTGG - Intronic
1163347536 19:16753212-16753234 CTTGAGCCACAGTTGGCATCAGG + Intronic
1164346865 19:27274466-27274488 CTGAAGCCTTCGTTGGAAACGGG + Intergenic
1164346974 19:27276862-27276884 TTGAAGCCTTAGTTGGAAACGGG + Intergenic
1164572401 19:29383914-29383936 CTGGAGCTAGTGGTGGAAAGTGG - Intergenic
1164812457 19:31168489-31168511 CTGGAGCCAAAGCTAGAAATTGG + Intergenic
1165418704 19:35711660-35711682 CTGGAGCCAAAGGAAGAAACGGG + Intronic
1165544493 19:36523085-36523107 CTGGAGCAAGAGTTTGAATAGGG - Intronic
1165733668 19:38162516-38162538 CTGGAGCCAGAATGTGAACCTGG - Intronic
1165846060 19:38818398-38818420 CTGGGGACACAGGTGGAAACAGG - Intronic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166566830 19:43770575-43770597 CTGGAGCCAGCGTTTGTGACTGG - Intronic
1166678759 19:44754910-44754932 CCGGGGCCAGAGTTGCAAATTGG - Intronic
1166724057 19:45014879-45014901 CTGAATCCAGATTTGGAGACAGG - Intronic
1166767213 19:45258865-45258887 CTGGGGCCTGAGTTTGAAAAGGG + Intronic
1166782596 19:45350282-45350304 CTGGATGCAGTGTTGGGAACTGG + Exonic
1166988038 19:46674096-46674118 ATGGAGGAGGAGTTGGAAACTGG - Intergenic
1167055161 19:47105964-47105986 CTGCAGGCAGAGTTAGAACCCGG - Intronic
1167604535 19:50474909-50474931 CTGGAGCCACAGTGGGACCCTGG + Intronic
1168002874 19:53463353-53463375 GTGGAGGCAGCTTTGGAAACCGG + Intergenic
925040650 2:731213-731235 CTGGAGCCGCAGTTGGCAACGGG - Intergenic
926695421 2:15767174-15767196 ATGGAGCCAGGGTGGGAACCCGG - Intergenic
928221414 2:29406333-29406355 CTGGAGGAAGAAATGGAAACAGG - Intronic
929623021 2:43376893-43376915 CTGGAGCCAGTGTCAGACACTGG + Intronic
932435402 2:71700210-71700232 CAGGAGCCAGAGGTGGACCCGGG + Intergenic
933182516 2:79243477-79243499 AAGGAGCAAGAGTTTGAAACAGG - Intronic
933688550 2:85161808-85161830 CAGGAGCCAGGGCTGGAAGCAGG + Intronic
934101945 2:88661440-88661462 ATGGACCCAGAGTTTGATACAGG - Intergenic
934567956 2:95350974-95350996 CTGAAGCCAGAGTTGGGAGTTGG + Intronic
937238629 2:120446143-120446165 CTGGAGGCTGAGGTGGAACCTGG - Intergenic
939070853 2:137540427-137540449 CTGCAGCTGGAGTTGGAAACAGG - Intronic
939994840 2:148910495-148910517 CAGGATCCAGAGTTAGAGACTGG - Intronic
940638983 2:156329032-156329054 CTGGAGCCGGAGTTGGAAGAGGG - Intronic
942113096 2:172701467-172701489 CAGGAGTCAGAGTTAGAATCTGG + Intergenic
943697397 2:190950944-190950966 CTGGAGCCAGGGTGAGAAGCCGG + Intronic
943701035 2:190988592-190988614 ATGAAGCCAGAGTTTGAGACCGG - Intronic
945323629 2:208456648-208456670 CTACAGCCAGGGTTGAAAACAGG - Intronic
945399621 2:209365269-209365291 CAGGAGCCAGTGATGAAAACTGG - Intergenic
947991590 2:234492290-234492312 CTTGAGCCAGATTTTGGAACTGG + Intergenic
948262361 2:236613605-236613627 CTGGACACAGAGCTGGAGACAGG - Intergenic
949031308 2:241798747-241798769 CTGGGACCAGAGGTGGGAACAGG - Intronic
1169362253 20:4960994-4961016 CTGCCTCCAGAGATGGAAACTGG + Intronic
1170166489 20:13364874-13364896 CTGTAGCCAGAGTGGCAAACAGG - Intergenic
1170566557 20:17611230-17611252 CTGGAGCCTGACATGGAACCTGG + Intergenic
1171311841 20:24150989-24151011 CTGGAGGCAGAGTTTGAGGCTGG - Intergenic
1171903506 20:30878949-30878971 CAGAAGCCAGAGATGGTAACTGG - Intergenic
1172779708 20:37428949-37428971 ATGGAGAATGAGTTGGAAACAGG - Intergenic
1172913153 20:38425067-38425089 CTGGAGCCAGTGAAGGAAACAGG - Intergenic
1173270883 20:41533712-41533734 TTGGAGACAGAGTGGCAAACAGG + Intronic
1173598335 20:44274737-44274759 GTGTAGCCAGACTTGGAAATAGG - Intronic
1173778904 20:45736813-45736835 CTGGAGCCAGCAGTGGCAACCGG + Intergenic
1173829518 20:46072242-46072264 CTGGAGAAAGATTTGGAAAGAGG - Intronic
1173847712 20:46198558-46198580 CTGGAGCCTGAGAGGGAAACGGG - Intronic
1174435282 20:50502102-50502124 TTGGATCCAAAGATGGAAACCGG - Intergenic
1175042896 20:56072483-56072505 CAGGAGCCAGTGTGGGAAAGTGG + Intergenic
1175248918 20:57597280-57597302 CTGGGGCCACAGCTGGAAGCCGG + Intergenic
1175329035 20:58150040-58150062 GTGGACCCAGAGCTGGAAAATGG - Intergenic
1178665556 21:34543335-34543357 CTGGAGTCGGAGATGGAGACAGG + Intronic
1178875285 21:36409444-36409466 CTGAGGCCAGTGGTGGAAACAGG + Exonic
1180318367 22:11298323-11298345 CAGAAGCCAGAGATGGTAACTGG + Intergenic
1180336902 22:11584908-11584930 CAGAAGCCAGAGATGGTAACTGG - Intergenic
1180950050 22:19716881-19716903 GTGGACCCTCAGTTGGAAACTGG + Intronic
1181033595 22:20159535-20159557 CTGGAGCCAGAGTAGGAAAAAGG - Intergenic
1181509711 22:23383709-23383731 CTGGAGCCAGAGTGGGGAAAAGG + Intergenic
1181907415 22:26210322-26210344 CTGGGGGCAGAGAAGGAAACAGG - Intronic
1182276920 22:29195614-29195636 CTGCAGCCAGAGTTTGAATATGG + Intergenic
1182856194 22:33519533-33519555 CTGGAGCCTGAGAGGGAACCTGG - Intronic
1183107201 22:35622928-35622950 CTGGAGCCAGAGTGGGGAAGAGG - Intronic
1184099481 22:42334527-42334549 CTGGAGGCAGAGCAGGGAACAGG + Intronic
1184257662 22:43296338-43296360 CTGGACCCCGGATTGGAAACAGG - Intronic
1184280840 22:43436598-43436620 CTGGAGCCAGTGTGGGCAAGGGG - Intronic
1184350080 22:43937582-43937604 AGGGAGACAGAGTTGGAAAGGGG - Intronic
1184431819 22:44445454-44445476 CTGGAGCCAGTGTGACAAACGGG - Intergenic
1185244631 22:49766332-49766354 CAGGAGCCAGAGTGGGAGGCTGG + Intergenic
950037632 3:9898629-9898651 CTGGAGTCAGAGGGGGAAAAGGG - Intergenic
950548394 3:13652569-13652591 CTGGAGCCAGAGTTGAAGGGAGG + Intergenic
951097014 3:18644337-18644359 CTGGAGTAAGAGTTGGGAGCAGG - Intergenic
952001881 3:28795284-28795306 CAAGAGCCAAATTTGGAAACTGG + Intergenic
952899559 3:38100394-38100416 CTGGAGCTGGAGGTGGAAAATGG + Exonic
953393717 3:42549700-42549722 CTGGAGACAGAGTCTGAAACTGG - Intronic
954426544 3:50446439-50446461 ATGGAGGCAGAGTCCGAAACAGG - Intronic
954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG + Intergenic
955662533 3:61316506-61316528 CTGGAGCCACAGTTGCAAACTGG + Intergenic
956168749 3:66416243-66416265 AGGGCGCCAGAGTTGGGAACAGG - Intronic
956929860 3:74030710-74030732 TTGGCGCCAGAGTTGGCATCTGG - Intergenic
958248070 3:91191743-91191765 CTGAGGCCAGCTTTGGAAACGGG + Intergenic
960058302 3:113292666-113292688 CTGGAAGCAGAGTTAGAAACAGG + Intronic
960173035 3:114485408-114485430 ATGGATGCAGATTTGGAAACAGG - Intronic
962647451 3:137454381-137454403 CTAGAGTCAGAGTTGGACTCTGG - Intergenic
965960587 3:174424227-174424249 CTGAAGCCTGTGCTGGAAACTGG - Intergenic
966261527 3:177984625-177984647 GGGGAGCCAGAGTTGGGGACAGG - Intergenic
967166318 3:186783216-186783238 CCGGAGCCGGAGGCGGAAACCGG - Intronic
969349842 4:6592009-6592031 GTGGAGCCAGCGTTGGATTCAGG + Intronic
969973543 4:11073435-11073457 CTTGAGCCCCAGGTGGAAACAGG - Intergenic
972243188 4:37216449-37216471 ATGGAGACAGACTTGGATACAGG + Intergenic
973111740 4:46405211-46405233 CTGCCCCCAGAGTTGGAATCTGG - Intronic
973786429 4:54336955-54336977 CTGGAGCAAGATTTGGAGATGGG + Intergenic
974133597 4:57787387-57787409 CAGGAGGCAAAGGTGGAAACAGG + Intergenic
975574360 4:75848178-75848200 TTGGACCCAGAGTTAGAAAAGGG - Intergenic
977900212 4:102413846-102413868 CTGGAGCTAGAGGAGGAAGCAGG - Intronic
979603273 4:122609220-122609242 CTGGAGCCAATGTTTGAAGCTGG + Intergenic
980114803 4:128669143-128669165 CTGGACCCAGAGGTGGGAATGGG + Intergenic
980126226 4:128776870-128776892 CTGGAGCCAGGGTTGGGCATGGG + Intergenic
981836139 4:149056596-149056618 ATGGAGCCTTAGTTGGAATCAGG + Intergenic
985139800 4:186828394-186828416 CAGGACCCAGAGATGCAAACAGG - Intergenic
986174063 5:5337018-5337040 CTGAAGCCGGAATGGGAAACAGG + Intergenic
987238816 5:15971771-15971793 CTGGAGCAGGAGTTTGAAAAGGG - Intergenic
988856196 5:35230098-35230120 CAGGAGCCAGAGTCGGCAGCCGG - Intronic
988966368 5:36422394-36422416 CTGGATTTAGAATTGGAAACTGG + Intergenic
989895930 5:47082941-47082963 TTGAAGCCTCAGTTGGAAACGGG - Intergenic
989933670 5:49990915-49990937 TTGAAGCCAGTGTTGGAAATGGG + Intergenic
990508548 5:56468947-56468969 CTGGAGTGAGAGTTGGGAATGGG - Intronic
990982547 5:61615077-61615099 CTGGAGACAAGCTTGGAAACTGG + Intergenic
991092085 5:62703216-62703238 CGTGAGCAAGAGTAGGAAACAGG - Intergenic
994104481 5:95931160-95931182 CTGGAGCCAGAGTTGGAAACTGG - Intronic
994509681 5:100688248-100688270 CGGGAGCCAGTATTGGCAACCGG - Intergenic
995494708 5:112728809-112728831 CTTGAGCCAGAACTAGAAACTGG + Intronic
996014134 5:118512454-118512476 CTAGATCAAGAGCTGGAAACTGG + Intergenic
996780835 5:127185036-127185058 CTGGACCCAGATTTTGAATCTGG - Intergenic
997797170 5:136821924-136821946 GGGGAGCCAGAGTTTGAATCCGG + Intergenic
998128322 5:139638533-139638555 CTGGAGCTAGACTTGGAAGCAGG - Intergenic
998415494 5:141943375-141943397 CTGGAGCTATAGCTGGCAACTGG - Intergenic
998504482 5:142660907-142660929 CTGGAGCCAGAGAAGGAAGGAGG - Intronic
998923691 5:147099196-147099218 ATGGAGCCAGAAATGGAATCAGG - Intergenic
999380049 5:151114771-151114793 GTGGGGCCACAGTTGGAAATTGG + Intronic
999466638 5:151812815-151812837 CTGGAGCCATACTTGAAAACTGG - Intergenic
999750894 5:154627605-154627627 CTGGAGCCAGAGATGGGAAGAGG - Intergenic
1000062792 5:157671579-157671601 TTGGAGAAAGAGTTGGAAACTGG - Exonic
1000604501 5:163313779-163313801 CGGGAGCCATGTTTGGAAACTGG - Intergenic
1001096827 5:168781837-168781859 ATGGAGCCAGGATTGGAACCTGG - Intronic
1001773866 5:174314425-174314447 CTGGGGCCACAGTGGGGAACGGG + Intergenic
1002487647 5:179550615-179550637 CTGGAGCCGGAGCTGGAGCCGGG + Exonic
1003080268 6:3015942-3015964 CTGGAGCCAGGGCTGGCCACCGG - Intronic
1003422701 6:5972984-5973006 CTGGTGACAGAGGTGGAAAATGG + Intergenic
1003978300 6:11365022-11365044 CTGGAGCAAGAGTTGGAGGTGGG + Intronic
1004069921 6:12288612-12288634 CTGAAGCAAGAGTTGGAGATGGG - Intergenic
1005009343 6:21321381-21321403 CAGGAGCCAGTGATGGAACCAGG - Intergenic
1006298883 6:33182823-33182845 CTGGCCCTAGAGTTGGGAACAGG - Intronic
1006334282 6:33412324-33412346 CTGGGGCCAGAGGTGGGAGCAGG - Exonic
1007010449 6:38412263-38412285 CTGAAGCCTGTGTTGAAAACTGG + Intronic
1007603175 6:43096565-43096587 CTGGAGCCAGAGTCATAAAGAGG + Intronic
1007850033 6:44793928-44793950 CAGGAGCCAGAGTGGGAAAGTGG - Intergenic
1008602165 6:53106871-53106893 CTGGAGCCTCATTTGTAAACTGG + Intergenic
1009059265 6:58378092-58378114 CTGAAGCCAGAATGGTAAACTGG + Intergenic
1009231581 6:61069033-61069055 CTGAAGCCAGAATGGTAAACTGG - Intergenic
1009347151 6:62627736-62627758 CTGAGGCCAAAGTTTGAAACTGG + Intergenic
1010495280 6:76527266-76527288 ATGGGGACAGAGTTGGAAAGAGG + Intergenic
1012662619 6:101921510-101921532 CTGAAGCAAGATCTGGAAACAGG + Intronic
1012965279 6:105667221-105667243 CTGAGGCCAGTGGTGGAAACAGG + Intergenic
1014184236 6:118417132-118417154 CAGGAGCCAGAATTTAAAACTGG + Intergenic
1014984396 6:127984781-127984803 CTGTTCCCAGAGTTGGAGACAGG + Intronic
1015999951 6:139031883-139031905 CTGGTGCCAGAATGGGAAATGGG + Intronic
1016745545 6:147575532-147575554 ATGAAACCAGAGTTGAAAACAGG - Intronic
1016937102 6:149455590-149455612 CTGGAGGCAGAGAGGGACACAGG - Intronic
1018394151 6:163364477-163364499 CTATAGCCAGGGTTGGAAAAGGG - Intergenic
1019107163 6:169677789-169677811 CTGAGGCCAGAGCTGGAGACGGG - Intronic
1019282228 7:206294-206316 CTGGAGCCAACGGTGGACACTGG - Intronic
1019475977 7:1244403-1244425 CGGGGGCCTGAATTGGAAACAGG + Intergenic
1023689830 7:42774283-42774305 CTGGAGCAGGAGGTGGAAATTGG - Intergenic
1024118297 7:46213147-46213169 CTGAAGACAGAGTTGGAGAGGGG + Intergenic
1025098747 7:56117531-56117553 CTGGGGCCACAGGTGGACACAGG - Intergenic
1029690028 7:102175188-102175210 CTGGACCCAGAGTGGGGACCGGG - Intronic
1030336251 7:108330487-108330509 TGGGAGCCAGAGTGAGAAACGGG - Intronic
1032197871 7:129799681-129799703 CTGGACCCAGGGCTGGAAGCTGG - Intergenic
1036059213 8:5296091-5296113 CTAGAGCCAGAGTTGCCCACTGG + Intergenic
1036132324 8:6127211-6127233 TTGAGGCCAGAGTTGGAAATAGG + Intergenic
1037431062 8:18813688-18813710 CTGGAGCCAGTGTTTGAACTTGG - Intronic
1037804205 8:22050183-22050205 CTGGAGCCACAGCTGATAACTGG + Intronic
1039322672 8:36449900-36449922 CTGGAGCCAGGCTGGGAAAGGGG - Intergenic
1039534485 8:38295726-38295748 CTGTATCCAGAGTATGAAACTGG + Intronic
1039657884 8:39429997-39430019 CTGGGGCTATGGTTGGAAACAGG - Intergenic
1041276497 8:56165162-56165184 CTGTAGCCAGGGTTAAAAACTGG - Exonic
1041449948 8:57995131-57995153 CTGGAGCCGGGGTTGGAGCCAGG + Intronic
1041896326 8:62928749-62928771 CTGGAGCCACAGTATCAAACGGG + Intronic
1042227196 8:66523114-66523136 CTGGAGCTGGAGCTGGGAACTGG + Intergenic
1042651121 8:71042379-71042401 CTGGAGCTTGGGTTAGAAACTGG + Intergenic
1044316707 8:90757536-90757558 TTGGAGCCAGACATGGAACCGGG + Intronic
1044634215 8:94306480-94306502 CTGGAGCTAGGGGTGGAAATGGG + Intergenic
1044772286 8:95648959-95648981 CTGGAGATAGAGGTGGATACTGG - Intergenic
1045378231 8:101597323-101597345 CTGGAGCCACAGTTAGAAATAGG + Intronic
1046059410 8:109118784-109118806 CTTGAGCCAGAGTTGGCTATAGG + Intronic
1046886301 8:119371052-119371074 GTGGAGCCAGGATTGTAAACTGG - Intergenic
1047138343 8:122106990-122107012 CAGGAGCCAAAGTCTGAAACTGG + Intergenic
1047289965 8:123521200-123521222 CTGGGGGTAGAGTGGGAAACAGG - Intronic
1047544434 8:125802292-125802314 AGGGAGACAAAGTTGGAAACAGG + Intergenic
1047948298 8:129905102-129905124 CTGGAGCAGAAGTTGCAAACTGG - Intronic
1049396012 8:142401128-142401150 CTGGAGCTTGAGATGGAATCAGG - Intronic
1049721121 8:144116018-144116040 GTGGAGCCAGGGGTGGAGACTGG + Intronic
1050365474 9:4869686-4869708 CTGGAGCCAGCCCTGGAAAATGG - Intronic
1050636041 9:7614256-7614278 CTGGAGCCATAGTGGGAAGAGGG - Intergenic
1050981931 9:12030243-12030265 CTAGAGCCAGAATTAAAAACTGG + Intergenic
1051485037 9:17598886-17598908 GTGGAGGCAGAGTTTGACACTGG + Intronic
1052252410 9:26414062-26414084 CTGGAGTCTGTCTTGGAAACTGG - Intergenic
1054458722 9:65450458-65450480 CTGGAGCCAGGGCTGGAGCCAGG + Intergenic
1055085053 9:72305332-72305354 CTGGAGCCAGGGTTGGATGATGG - Intergenic
1056390819 9:86140107-86140129 CTGGAGCCACTGTAGCAAACGGG + Intergenic
1056546072 9:87614946-87614968 CTGGAGTGAGGGTTGGAGACAGG + Intronic
1056800097 9:89685162-89685184 CTGGAGCCAGAGTTCCCGACAGG - Intergenic
1059412987 9:114145300-114145322 ATAGAGCCAGAGATGGAAACTGG + Intergenic
1059959226 9:119548995-119549017 CTGGAGCCTCAGTTGGGAAGAGG - Intergenic
1061044839 9:128159632-128159654 CTGGGCCCAGCCTTGGAAACGGG - Intergenic
1062139958 9:134950524-134950546 CTCCAGCCAGAGTCGGAACCTGG - Intergenic
1203366595 Un_KI270442v1:264085-264107 CAGAAGCCAGAGATGGTAACTGG + Intergenic
1186152456 X:6689972-6689994 CTGGAGCCAGCAGTGGCAACCGG - Intergenic
1186171189 X:6878772-6878794 CTGTTGCCACTGTTGGAAACAGG - Intergenic
1186199212 X:7139393-7139415 TGGGAGCCACAGCTGGAAACTGG - Intronic
1186312439 X:8335473-8335495 CTGGTGGGAGAGCTGGAAACAGG - Intergenic
1187573241 X:20527228-20527250 CTGGAGCCAGACTTTGAACCAGG - Intergenic
1187733699 X:22282584-22282606 ATGAAGCCAGAGAGGGAAACAGG - Intergenic
1187768239 X:22666825-22666847 CTTGAGCAAGAGTTGGGAAAGGG - Intergenic
1187805812 X:23119251-23119273 CTGGGGCTAGAGTTGGGCACTGG - Intergenic
1188125392 X:26361564-26361586 GGGGAGCCAGAGTTTGAATCAGG + Intergenic
1188729339 X:33627530-33627552 CTAGAGCTAGAGATGGAAATAGG + Intergenic
1189488579 X:41451886-41451908 CTGGAGCCAGGGGTGGGAAAAGG + Intronic
1190043362 X:47090535-47090557 AAGGAGCCATAGTTGGAAACTGG + Intronic
1191690347 X:63932820-63932842 CTGGAGCCTCAGTTGTAAATGGG - Intergenic
1191783661 X:64894692-64894714 CTGGAGTCAGAGTTGGGAGTAGG + Intergenic
1191943574 X:66504942-66504964 CTGGAACAAGACTTGGAATCAGG - Intergenic
1192345425 X:70299962-70299984 CAGAAGCCAGTGTTGAAAACAGG + Intronic
1193937007 X:87635732-87635754 CTGGAGCAATGGTTGGAAGCAGG - Exonic
1194345551 X:92759691-92759713 GTGGAACCAGTTTTGGAAACTGG - Intergenic
1195394706 X:104398364-104398386 CTGGTGCCAGAGTTGGGACTAGG - Intergenic
1196066212 X:111467536-111467558 CTGGGGCCAAAGTTGGAGAGGGG + Intergenic
1196070754 X:111518905-111518927 CTGTTGCCAGAGTGGGAAAATGG - Intergenic
1196459649 X:115917153-115917175 CTGGAGCCATGTTTGGAAAATGG - Intergenic
1196580938 X:117378383-117378405 CAGGAGCCAGAGCAGAAAACAGG - Intergenic
1196607558 X:117673337-117673359 GTGGACTCATAGTTGGAAACTGG - Intergenic
1196869693 X:120100958-120100980 CTGGAGCCATGTTTGGAAAATGG + Intergenic
1197916262 X:131539308-131539330 GTGGAGAAAGAGTAGGAAACTGG + Intergenic
1200424567 Y:3006956-3006978 CTGGAGGCTGAATTGGAAATAGG + Intergenic
1200653894 Y:5876342-5876364 GTGGAACCAGTTTTGGAAACTGG - Intergenic
1201574359 Y:15446296-15446318 TGGGAGCCACAGGTGGAAACTGG - Intergenic