ID: 994106494

View in Genome Browser
Species Human (GRCh38)
Location 5:95955282-95955304
Sequence GCCAAATGCCCTTTCTGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994106492_994106494 14 Left 994106492 5:95955245-95955267 CCATTTGTTTAACAATCTAGTTA 0: 1
1: 0
2: 1
3: 22
4: 315
Right 994106494 5:95955282-95955304 GCCAAATGCCCTTTCTGTAGAGG 0: 1
1: 0
2: 0
3: 14
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994106494 Original CRISPR GCCAAATGCCCTTTCTGTAG AGG Intronic
900347876 1:2219349-2219371 GCCACAGGCCCTTTCTGAATGGG - Intergenic
902190104 1:14756385-14756407 GACAAATGCCATTTTTGCAGGGG - Intronic
904052974 1:27651414-27651436 ACCAAATATCCTTCCTGTAGCGG - Intergenic
906687279 1:47770804-47770826 GCCAAAGGCCCTTTCTGCTAGGG + Intronic
908831167 1:68179983-68180005 GCCAGTTGCCCATTCAGTAGAGG + Intronic
924490858 1:244536091-244536113 GCCCAGTGCCCTTTCTGCTGTGG + Intronic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1066690286 10:38019865-38019887 GCAAAATGCTCTGTATGTAGTGG + Intronic
1067002477 10:42629989-42630011 GCAAAATGCTCTGTATGTAGGGG - Intronic
1068979059 10:63042198-63042220 GACAAATGGCCTTTGGGTAGTGG - Intergenic
1071255213 10:83866182-83866204 GCCAAAATGCATTTCTGTAGGGG - Intergenic
1071342458 10:84661429-84661451 TCAAAATGACCTTTGTGTAGTGG - Intergenic
1073523541 10:104157263-104157285 GCACATTGCCCTCTCTGTAGAGG - Intronic
1074356580 10:112790966-112790988 ACCAAATGCCCTTTGAGGAGGGG - Intronic
1074391047 10:113058400-113058422 GCCAAATGCTGTTTTTGGAGTGG + Intronic
1076122259 10:127945546-127945568 GCCAAACCCCATTCCTGTAGAGG - Intronic
1077030033 11:461342-461364 GCCCAGTGCCCTGTCTGTAGGGG + Intronic
1078030666 11:7748028-7748050 TTCAACTGCCCTTTTTGTAGGGG + Intergenic
1085154834 11:74283840-74283862 CCCAATTGCCTTTTCTTTAGAGG + Intronic
1085465696 11:76721888-76721910 CCCAAACGCCCTTTCTCTTGAGG + Intergenic
1087618831 11:100519479-100519501 ACTAAATGCCCTCTCTGTAAAGG - Intergenic
1091624895 12:2114244-2114266 GCCACATGGCCTCTCTGTTGAGG + Intronic
1091996605 12:4998621-4998643 GCAAGATGCACTCTCTGTAGCGG - Intergenic
1092786714 12:12033106-12033128 GGCAATTTCCCTTTCTGTATGGG - Intergenic
1095737345 12:45572176-45572198 TTCAAATGCCCATTCTGGAGTGG + Intergenic
1102208755 12:111108966-111108988 GCCACATGCCCTTCTGGTAGAGG + Intronic
1110155096 13:72307053-72307075 GGCAAATGCCCTGTCTGAGGAGG + Intergenic
1114487374 14:23070944-23070966 CCCACATGCCCTTTCTGTATGGG - Intronic
1115457534 14:33621887-33621909 ACAAAATGCCATTTCTGTAATGG + Intronic
1116372519 14:44154414-44154436 GAGAAATGCCCTTTTTGTGGGGG + Intergenic
1116764213 14:49050979-49051001 GCCAATTACATTTTCTGTAGAGG - Intergenic
1118161980 14:63299731-63299753 TCCCAGTGCCTTTTCTGTAGTGG + Intergenic
1120135269 14:80859718-80859740 GCCATTTTCCTTTTCTGTAGGGG - Intronic
1122669635 14:103360451-103360473 CCCACATACCCTTTCTGGAGAGG - Intergenic
1124910921 15:33919681-33919703 GCCAAAGGCATTTTCTGTAGGGG + Intronic
1130989517 15:88867904-88867926 GCCAAATGTCTTTTCTGACGGGG - Intronic
1131958549 15:97764018-97764040 GCCCAGTGACCTTTCTGCAGGGG + Intergenic
1136040552 16:27575546-27575568 GACAAATGCCCTTTCATTATAGG - Intronic
1140339380 16:74141917-74141939 ACCACATGCTCCTTCTGTAGTGG - Intergenic
1140895989 16:79324672-79324694 GCCTCCTCCCCTTTCTGTAGAGG - Intergenic
1144088379 17:11831423-11831445 GATAAATGCCCTTCCTGTGGGGG - Intronic
1144219494 17:13087187-13087209 GCCAAATCCCCCATCTCTAGAGG + Intergenic
1146135633 17:30318385-30318407 GCCACATGCCCTGGCTGTAGTGG - Intronic
1147693005 17:42329515-42329537 GCCAGAGGCCCTTTGTGAAGGGG + Intronic
1147874137 17:43608823-43608845 GCCACATCACCTTTCTGTTGAGG + Intergenic
1150209554 17:63434643-63434665 GCCAAATGCCCTTTGTATCCTGG + Intronic
1152572387 17:81126558-81126580 GCCACACCCCCTTTCTGCAGGGG - Exonic
1152853942 17:82653231-82653253 CCCTTATCCCCTTTCTGTAGTGG + Intergenic
1154218317 18:12431691-12431713 CCCAAATGCCTTTCCTGGAGTGG + Exonic
1154256632 18:12786770-12786792 GCCAAGTGCCCTGTCTTTAAAGG - Intronic
1161067195 19:2244454-2244476 GCGGGATCCCCTTTCTGTAGAGG - Intronic
1167392986 19:49208997-49209019 GTCAAATGCCTTTTCTGTGTTGG + Intronic
925439123 2:3868678-3868700 GCCAAAGGGACTTTCTGTACTGG - Intergenic
925803881 2:7629611-7629633 GCCCACTGCCCTGTCTGTTGTGG + Intergenic
928737097 2:34304391-34304413 GTGAAATGCCTTTTCTGTGGAGG - Intergenic
929508288 2:42546039-42546061 GCCAATTGCCCTTTCAGGAGTGG - Intronic
936475183 2:112833488-112833510 GCCTGAAGCCCTTGCTGTAGTGG + Exonic
937912746 2:127083630-127083652 CCCAAATGCCCTTTATGTCTGGG + Intronic
943034683 2:182727495-182727517 GGCAAATGACCATTCTATAGAGG - Intronic
947918834 2:233852520-233852542 GCCAAATAACCTTGCTGTGGAGG - Intronic
1169918385 20:10706522-10706544 TCCACATGCCCTTCCTGTACTGG - Intergenic
1170129036 20:12999394-12999416 ACCAAGTGCCCTTTTAGTAGAGG - Intergenic
1171361137 20:24587107-24587129 GGGAAATGCACTTTCTATAGAGG + Intronic
1172753912 20:37270142-37270164 GCCAGATGCCCTTTCTCCTGTGG - Intergenic
1173681869 20:44887670-44887692 GCAAAATGCACTTTTTGTAGCGG - Exonic
1174947335 20:55002625-55002647 GCCTAAGGCCCTTTGTGTAGCGG - Intergenic
1181464491 22:23103532-23103554 GGCAAATTCCCTTTCTCCAGCGG - Intronic
1182599252 22:31447496-31447518 GCCACATGACCTTGCTGTACAGG - Exonic
1183210770 22:36449891-36449913 GGCCAATTCCCTTTGTGTAGGGG - Intergenic
1184227291 22:43136400-43136422 ACCCACTGCTCTTTCTGTAGGGG + Intronic
1184406368 22:44302973-44302995 GCCCAAAGCCCTGTCTCTAGTGG - Intronic
949178261 3:1093469-1093491 GCTACACGCCCTTTCTGTAACGG + Intronic
954569667 3:51630093-51630115 TCCAAATTCCCTTTCTCTACTGG - Intronic
963182961 3:142379707-142379729 GACAAATGGCCTTTCTGCAAAGG - Intronic
972153690 4:36129430-36129452 GCCCAATCCCCATTCTGTTGGGG + Intronic
976479911 4:85529692-85529714 GCCAAATGTCCTCTGTGGAGTGG + Intronic
980214710 4:129836863-129836885 GCCACATGCTGTTTCTGAAGTGG + Intergenic
982362497 4:154535304-154535326 CCCAAATGCCCTGTCAGTAAGGG - Exonic
986103421 5:4635557-4635579 GCCATATGTGCTTTCTATAGGGG + Intergenic
991983528 5:72258578-72258600 TCCACAAGCCCTTTTTGTAGTGG - Intronic
993761531 5:91802022-91802044 GCCTAATGTCTTTTATGTAGGGG - Intergenic
994106494 5:95955282-95955304 GCCAAATGCCCTTTCTGTAGAGG + Intronic
996461438 5:123748292-123748314 TCTAAATGCTCTTTCTGAAGTGG + Intergenic
998154571 5:139777211-139777233 GGCAATGGCCCCTTCTGTAGTGG + Intergenic
1001043054 5:168350606-168350628 GCCAGATGCCCTTTATGTTGGGG - Intronic
1007414865 6:41685501-41685523 TCCAATTGCCCTTTGTGTAAAGG + Intronic
1007690296 6:43696657-43696679 GCCAGATGCCCTTTCTGAAAAGG + Intergenic
1008456061 6:51712083-51712105 GCAATAGGCCCTTTCTGTGGAGG - Intronic
1009549501 6:65069411-65069433 GCAAAAAGCAATTTCTGTAGAGG - Intronic
1011207214 6:84913029-84913051 GCCCAATTCCCTTTTTATAGTGG - Intergenic
1011248548 6:85345727-85345749 GCCAAATTGCTTTTCTGAAGTGG - Intergenic
1011464361 6:87640076-87640098 GCCTCATGCCTTTTCTTTAGTGG + Intronic
1012333385 6:98022422-98022444 GCCAAATATCCATTCTGTATGGG + Intergenic
1012581450 6:100874921-100874943 TCCAAATGCACATTCTGTAGGGG - Intronic
1013233367 6:108176012-108176034 GCCAAAAGCTATTTCTGTGGGGG + Intronic
1020245640 7:6427186-6427208 AGCAGATGCCCTTTTTGTAGTGG + Intronic
1020346797 7:7174012-7174034 GCCAAATTCACTTTCTGGTGAGG + Intronic
1023145256 7:37144675-37144697 GCCATCTCCCCTTTCTCTAGGGG - Intronic
1024929064 7:54650714-54650736 GCCAGATGGCCTTTGTGTAGGGG + Intergenic
1025093409 7:56080945-56080967 GCCAAGTGCTCCTTCTGCAGAGG + Exonic
1028105215 7:86868668-86868690 GCCATAAGCCCCTTCTGAAGAGG - Intergenic
1029531863 7:101130690-101130712 TCCAAATTCCCTTTCTCTTGAGG - Intronic
1030495615 7:110295790-110295812 GCCAAAGGGCATTTCTGTTGTGG + Intergenic
1035739319 8:1914291-1914313 GCCAAGTGGCCGTTCTGTGGAGG + Intronic
1037620990 8:20563286-20563308 CCCAAATGCCCTTTCTGTGAAGG - Intergenic
1041840517 8:62265090-62265112 GCCAAACTCCTTTTCTGTAATGG - Intronic
1044045599 8:87427869-87427891 GCCAACTGCCCTTTATGTTATGG - Intronic
1048861212 8:138725440-138725462 ACCAAATGCTCTTTCTCTACAGG - Exonic
1049809012 8:144554951-144554973 GCCAGCTGCTGTTTCTGTAGGGG - Intronic
1053166603 9:35848339-35848361 GCCAGATGCCCTTTCTACTGTGG + Intronic
1059324823 9:113497752-113497774 CCTAAACGCCCTGTCTGTAGAGG - Intronic
1061072987 9:128323081-128323103 GCCAACAGCCCTTTCTGCAGCGG - Exonic
1187075118 X:15927213-15927235 TCTACATGCCCTTTCTGTAGGGG + Intergenic
1194002346 X:88446137-88446159 CCAAGATGCCCTTTCTGAAGTGG - Intergenic
1200285622 X:154819608-154819630 GCAAAATGCCCTTTCTCTTTGGG + Intronic