ID: 994106820

View in Genome Browser
Species Human (GRCh38)
Location 5:95959094-95959116
Sequence CTCCCTTCTGGGGCCTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 571
Summary {0: 1, 1: 0, 2: 5, 3: 69, 4: 496}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994106816_994106820 3 Left 994106816 5:95959068-95959090 CCATACAAAGGTAGGAAAACAAA 0: 1
1: 0
2: 1
3: 41
4: 479
Right 994106820 5:95959094-95959116 CTCCCTTCTGGGGCCTCCAGTGG 0: 1
1: 0
2: 5
3: 69
4: 496

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994106820 Original CRISPR CTCCCTTCTGGGGCCTCCAG TGG Intronic
900703340 1:4061310-4061332 GTTCCTTCTGGAGGCTCCAGGGG - Intergenic
900795006 1:4702607-4702629 CTTCCGTCTGGGGCGTCCTGGGG + Intronic
901008081 1:6181204-6181226 CTCCCTTCACGGGCCTTCTGGGG - Intergenic
901643419 1:10704546-10704568 CTCCCTTCTCCGTCCTCCTGGGG + Intronic
902108298 1:14056457-14056479 GTCCCTTCTGGAAGCTCCAGGGG - Intergenic
902156156 1:14488140-14488162 CTCCCTTTTGGGCTCTCCAGAGG + Intergenic
902455336 1:16529867-16529889 CTCCCTTCTGGTGTCCCCTGCGG + Intergenic
902620571 1:17648446-17648468 CAGGCTTCTGGGGCCTGCAGTGG + Intronic
903810001 1:26029847-26029869 CTCCCCTCTGGGGCTCCCAGAGG + Intronic
903875717 1:26472087-26472109 CCCTCTTCTGGGGCCCCCAGCGG + Intergenic
904679525 1:32219299-32219321 CTCCATGCTGGGGCCTCCCAGGG - Intronic
905462415 1:38130311-38130333 CCCTGTTCTGGGCCCTCCAGGGG - Intergenic
908324015 1:63005736-63005758 CTCCATTCTTGGGGCTCAAGAGG - Intergenic
908791931 1:67791495-67791517 CTCCCTTCTTGGGGCTCCCAGGG + Intronic
910050946 1:82973450-82973472 CTCCCTTCTGGCTCCCCCATCGG + Intergenic
910159329 1:84256641-84256663 ATTCCTTCTGGAGCCTCTAGAGG - Intergenic
911236210 1:95415166-95415188 ATTCCTTCTGGAGGCTCCAGGGG + Intergenic
911299515 1:96155323-96155345 CTCTCTTCTGGGTGCTCCAGAGG + Intergenic
911408096 1:97466920-97466942 CCCCCTTTAGGGGCCTGCAGTGG + Intronic
913044058 1:115058377-115058399 CTCCCTTCTGGAACATTCAGTGG - Intronic
913073001 1:115318094-115318116 CTCCCTTCCATGGCCTGCAGGGG + Intronic
913176384 1:116276735-116276757 CCTCCTGCTTGGGCCTCCAGGGG + Intergenic
913314101 1:117535424-117535446 CAGCCTGCTGGGGCCTCCACTGG + Intergenic
913608623 1:120489720-120489742 CCCTCTTCTGGACCCTCCAGTGG + Intergenic
914370364 1:147019498-147019520 CCCTCTTCTGGACCCTCCAGTGG + Intergenic
914484330 1:148093912-148093934 CCCTCTTCTGGACCCTCCAGTGG - Intergenic
915977328 1:160400106-160400128 CTCCCTTCTCGGACCCCTAGGGG + Intergenic
916345984 1:163792018-163792040 TTCCCTTCTAGGGGCTCTAGAGG - Intergenic
916874374 1:168953312-168953334 TTCTTTTCTGGGGCCTCTAGAGG + Intergenic
917028728 1:170667211-170667233 CTGCCTTCTGCGGCCTCCTCCGG - Intronic
917444117 1:175092295-175092317 CAGCCTGCTGGAGCCTCCAGAGG + Intronic
917976877 1:180245404-180245426 CTCCCTCCAGGGGCCATCAGGGG - Intronic
918362364 1:183772076-183772098 CTCCCTTCTGGCTCCCCCATCGG + Intronic
918366244 1:183810843-183810865 GTCCCTTCTGTGTGCTCCAGAGG + Intronic
919313081 1:195936510-195936532 CTCTCTTCTGGGGTCTCCAGAGG + Intergenic
919834767 1:201566076-201566098 CTCCTTCCTGTGGGCTCCAGGGG + Intergenic
920437539 1:205957221-205957243 CTGCCTTCTAGAGCCTCAAGAGG - Intergenic
922221683 1:223613239-223613261 CTCACTTCTGGAGCCCCCATGGG + Intronic
922322979 1:224503883-224503905 CTCCCTCCTGGAGCGGCCAGAGG - Intronic
923383786 1:233447025-233447047 CTCCCTTCTGGCTCCCCCATAGG - Intergenic
923467513 1:234262570-234262592 CTCCCTTCCTGGTCCTCCGGAGG + Intronic
924825756 1:247536578-247536600 CTCCCTCCTGAAGGCTCCAGGGG - Intronic
1063163443 10:3438165-3438187 GTTCCTTCTGGGGGCTCCAGGGG + Intergenic
1063180190 10:3591091-3591113 CTCCCTTCTGGGATCTCCAGTGG - Intergenic
1063217444 10:3937395-3937417 CTGCCTTCTCGGGGGTCCAGGGG - Intergenic
1063612669 10:7576368-7576390 CTTCCTGCTGGGGCTTCCTGTGG + Intronic
1064965884 10:21014747-21014769 CTGCCTTCTGGAGCTTCCAAAGG + Intronic
1065918068 10:30368617-30368639 GGCCCTGCTGGGGGCTCCAGGGG + Intronic
1066694333 10:38064569-38064591 CTCCCATCTGTGATCTCCAGAGG + Intronic
1067153980 10:43759540-43759562 CTCCCTTCTGGACCCTCCTAGGG + Intergenic
1067561449 10:47307572-47307594 CTCCCTGCTGGGGACTGCTGGGG - Intronic
1068258331 10:54543147-54543169 CTCCCTTCTGGCTCCCCCATTGG + Intronic
1070113594 10:73508079-73508101 CTCCCTTCAGGAGGTTCCAGTGG - Intronic
1070499716 10:77060920-77060942 GTTCCTTCTGGGGGCTCTAGAGG - Intronic
1071409487 10:85374732-85374754 CTCCTTTCTGGAGCCTCTAAAGG - Intergenic
1071774310 10:88768065-88768087 GTCCCTTCCTGGGCCTCCACTGG - Intronic
1072910521 10:99496931-99496953 GTTCCTTCTGGAGGCTCCAGGGG - Intergenic
1073298515 10:102456183-102456205 ATCCCTTCTGGAGGCTCCAGGGG - Intergenic
1073615493 10:104990824-104990846 ATTCCTTCTGGAGGCTCCAGGGG - Intronic
1074362557 10:112834847-112834869 GTCTCTTCAGGGGCCTTCAGCGG + Intergenic
1074534558 10:114319602-114319624 CACCCATCTGGGGACTCCAGTGG + Intronic
1075068829 10:119307577-119307599 GTGCCTTCTGGAGACTCCAGGGG - Intronic
1075514503 10:123098265-123098287 GTCCCTTCTGGAGGCTCCAAGGG - Intergenic
1075607207 10:123820660-123820682 TTCCTTTCTGGAGGCTCCAGAGG + Intronic
1075998365 10:126895946-126895968 CTCCCTTCTGGGTGCTGCAGGGG - Intergenic
1076146242 10:128124994-128125016 CCCCCTTCTCAGGCCTCTAGTGG + Intronic
1076827501 10:132976721-132976743 CTTCCTTCTGGGGGCTCCAGGGG + Intergenic
1076869602 10:133186897-133186919 CTGCTTTCTGGGTCATCCAGAGG - Intronic
1077136759 11:1003421-1003443 GTCCCTTCTGGGGCCGTGAGAGG + Intronic
1077173514 11:1178732-1178754 CTCCCTTCTGGGGGCTCCTTGGG - Intronic
1077288139 11:1776647-1776669 GTTCCTTCTGGAGGCTCCAGGGG + Intergenic
1077305187 11:1865769-1865791 GTGGCTTCTGGGGCCTCCCGTGG + Intronic
1077635472 11:3839012-3839034 CTACCTTCTGGGGCCTGCCTAGG - Intronic
1078391030 11:10935518-10935540 GTTCCTTCTGGGGGCTCTAGGGG + Intergenic
1078519595 11:12052497-12052519 TTCCTTTCTGGAGCCTACAGAGG - Intergenic
1079655705 11:22984245-22984267 ATCCCTTTTGGGGCCTGCAATGG + Intergenic
1080940522 11:36912945-36912967 CTCCTTTCTGGAGGCTCTAGGGG + Intergenic
1081395501 11:42581971-42581993 GTTTCCTCTGGGGCCTCCAGAGG - Intergenic
1081493448 11:43583800-43583822 CTCTCCTATAGGGCCTCCAGAGG - Intronic
1081542779 11:44048322-44048344 CTTCCTTCTGAGGACTCTAGGGG + Exonic
1081861443 11:46335481-46335503 CTCCCTTCTGGGGCCACCCAGGG - Intronic
1082790014 11:57340634-57340656 CGCCCTCCTGGGGCTTACAGCGG + Intronic
1083033324 11:59614693-59614715 CTCCATTCTGGGCTGTCCAGAGG + Intronic
1083288462 11:61676229-61676251 CTTCCATCTGGGTCCTCCATGGG + Intergenic
1083938928 11:65884799-65884821 CTCCCGTCAGCGGCCACCAGAGG + Intronic
1085446154 11:76602579-76602601 CTCCCCTCCTGGGCCTCCTGGGG + Intergenic
1085684077 11:78605834-78605856 CTCCCTTCTGGCTCCCCCATTGG + Intergenic
1085695612 11:78702078-78702100 CTCGTTGCTGGGGCCCCCAGTGG - Exonic
1085779431 11:79394965-79394987 CTCCTTCTTGGGGGCTCCAGGGG - Intronic
1087054148 11:93917084-93917106 CAAGCTTCTGGGGCCTCCTGAGG - Intergenic
1087157776 11:94921713-94921735 CTTCCTTCTGGAGGCTCTAGGGG + Intergenic
1087271779 11:96119440-96119462 CTTCCTTCTGGAGGCTCTAGGGG - Intronic
1087952730 11:104243801-104243823 CTTTCTTCTGGAGGCTCCAGGGG + Intergenic
1088572508 11:111236739-111236761 GTCTCTCCTGGAGCCTCCAGAGG - Intergenic
1089582264 11:119488856-119488878 CTCCCTCCTGAGGTCTGCAGAGG - Intergenic
1089648305 11:119894826-119894848 CTCTCTAACGGGGCCTCCAGGGG + Intergenic
1090754818 11:129780719-129780741 CTCTCTTCTGGGTGCTCCAGGGG + Intergenic
1090835099 11:130448525-130448547 CTCGCTGCCGGAGCCTCCAGGGG - Intergenic
1092278008 12:7076820-7076842 CTCAGTTCTGTGACCTCCAGGGG + Intergenic
1093684211 12:22038167-22038189 GTTCCTTCTGGAGGCTCCAGGGG + Intergenic
1094586569 12:31782429-31782451 CTCCCTTCTGGCTCCTCCATCGG + Intergenic
1095418315 12:41999221-41999243 CTCCCTTGATGGGACTCCAGTGG + Intergenic
1095727430 12:45469218-45469240 GTCCTTCCTGGGGCCCCCAGGGG - Intergenic
1096284070 12:50283237-50283259 CTCACTTCTGGGGCCTGCGCTGG - Intronic
1096771960 12:53940746-53940768 CTCCCTTCTGATACCTACAGAGG + Intronic
1096825489 12:54273729-54273751 CTCTCTCCTAGAGCCTCCAGAGG + Intronic
1096862813 12:54542161-54542183 CCCCCTTCCGTGGCCTGCAGTGG + Intronic
1100019504 12:90052049-90052071 CTTCCTTCTGGAGGCTCTAGAGG - Intergenic
1100140555 12:91613526-91613548 CTCCCTTCTCTGGACTCCACTGG - Intergenic
1101057855 12:100937732-100937754 CTCCTCTCTGGAGGCTCCAGGGG + Intronic
1101817195 12:108154277-108154299 GTTCCTTCTGGAGGCTCCAGAGG + Intronic
1102011893 12:109624098-109624120 CCCCCTTCTGTGGCCTGGAGGGG - Intergenic
1102068065 12:109995809-109995831 CTCCCGGCTGCAGCCTCCAGAGG - Intronic
1102386743 12:112516397-112516419 TTTCCTTCTGGGGGCTCTAGGGG + Intergenic
1102647549 12:114413765-114413787 CTCTCTTCTGGGGCCTCAGTGGG - Intergenic
1102700478 12:114834877-114834899 TCCCCTTCTGGGGTCTCCATGGG + Intergenic
1103067608 12:117913152-117913174 TTCTCTTCTGGGGCCACCTGGGG - Intronic
1103201402 12:119090888-119090910 CACACTTTTGGGGCCACCAGAGG - Intronic
1103380174 12:120488119-120488141 CTGTCTTCTGCGGCCACCAGTGG - Intronic
1103680511 12:122690145-122690167 GCACCTTCTGGGGCCTCCTGTGG + Intergenic
1104472053 12:129037102-129037124 CTCCCTCCTAGGCCCTTCAGAGG + Intergenic
1104717094 12:131023289-131023311 CTCTCTTCTGGGTCCCCCACAGG + Intronic
1105278138 13:18948146-18948168 CTCCCTGCTGGGCCCTCCCATGG + Intergenic
1106319412 13:28624149-28624171 CTGCCTGCTAGGGTCTCCAGGGG - Intergenic
1106431957 13:29689155-29689177 ATTCCTTTGGGGGCCTCCAGAGG - Intergenic
1107632525 13:42356564-42356586 GTTCCTTCTGGAGGCTCCAGAGG - Intergenic
1108751771 13:53454982-53455004 TTCCCTTCTGGAGCCTCTAGGGG - Intergenic
1109903810 13:68810841-68810863 ATGCTTTCTGGGACCTCCAGAGG + Intergenic
1110835177 13:80074678-80074700 CTCCCTTCTGGCTCCTCCATTGG + Intergenic
1111292756 13:86188804-86188826 CTCCCTTCTGGCTCCCCCATCGG + Intergenic
1113592818 13:111512798-111512820 CTCCCTCCTGGGTCCGGCAGTGG + Intergenic
1113961516 13:114128790-114128812 CTCCCCGCTGGGGCTTCCTGTGG - Intronic
1115641496 14:35338298-35338320 GTCCTTTCTGAGGCCTCAAGGGG - Intergenic
1117433835 14:55697716-55697738 CTCCCTGCTGGAGCTGCCAGAGG - Intronic
1118381982 14:65224958-65224980 GTTCCCTCTGGGGCCTCCCGTGG + Intergenic
1118722418 14:68603925-68603947 CTGCCTGCTGGGGTCTCCGGAGG + Intronic
1119175163 14:72563364-72563386 CTCCCACCTGGGGCTGCCAGAGG - Intronic
1119198646 14:72736616-72736638 CTTCATTCTGGGACCTCCTGTGG - Intronic
1119544491 14:75461750-75461772 CTTCCTTCTTGGGCTTCCAGGGG - Intronic
1119654746 14:76409271-76409293 ATCTCTTTTTGGGCCTCCAGCGG + Intronic
1119699348 14:76742467-76742489 CACTCTTGTGGGGCATCCAGAGG + Intergenic
1119867761 14:77988360-77988382 TTCCTTTCTGGAGGCTCCAGGGG - Intergenic
1120194027 14:81463721-81463743 TTCCCTTTTAGGGCCTCCGGAGG - Intergenic
1120818978 14:88894493-88894515 TTCCCTTCTAGAGCCTTCAGAGG - Intergenic
1121742674 14:96265085-96265107 ATTCCTTCTGGAGGCTCCAGGGG - Intronic
1122045011 14:99017040-99017062 CTCCATTCTGATGCCACCAGAGG + Intergenic
1122115405 14:99525039-99525061 CTCACTTCTAGAGCCTCCAGAGG + Intronic
1122371151 14:101229772-101229794 CTCCCTTCTGGCTCCCCCATGGG - Intergenic
1122686984 14:103513512-103513534 CTCCATTCTGTGGGCTCTAGAGG + Intergenic
1122826660 14:104374005-104374027 GCTCCTTCTGGGGGCTCCAGGGG + Intergenic
1122914529 14:104852013-104852035 CTCCCTTCTGCCGCTTCCTGAGG + Intergenic
1122979462 14:105185121-105185143 GCTCCTTCTGGGGGCTCCAGGGG + Intergenic
1123060547 14:105592354-105592376 CTGCAGTCTGGGGCCCCCAGTGG - Intergenic
1123085025 14:105713325-105713347 CTGCAGTCTGGGGCCCCCAGCGG - Intergenic
1123768574 15:23506241-23506263 CTCTCTTCTGGGTGCTCCAGGGG + Intergenic
1123933760 15:25184267-25184289 CTCCCTGCTTAGGCATCCAGTGG - Intergenic
1123986181 15:25648229-25648251 CTTCCTCCAGGGGCCTCGAGGGG - Intergenic
1126228299 15:46296479-46296501 CTCCCTTCTGGCTCCCCCATTGG + Intergenic
1127372975 15:58357538-58357560 CACCCTCCTGGGGCCCCAAGAGG + Intronic
1127760166 15:62131824-62131846 GTGCCCTCTGGGACCTCCAGGGG - Intergenic
1127774494 15:62254538-62254560 CCCCCTGCTGGGGGCTCCAGGGG + Intergenic
1128708085 15:69851835-69851857 CTCCCCTCTGGGGTCTGCACTGG - Intergenic
1129068809 15:72933889-72933911 CTCTCTCCTGGAGCCTCCAGAGG + Intergenic
1129267469 15:74401669-74401691 CCTCCCTCTGGGGCCTCCTGTGG + Intergenic
1129674486 15:77625030-77625052 CACCTTCCTGGGGCCCCCAGGGG + Intronic
1129848415 15:78778550-78778572 CTGCCTTCTGGGGGCAGCAGTGG + Intronic
1130460225 15:84154643-84154665 CTCCCTTCTGGGGCCCTGAGTGG + Intergenic
1131364229 15:91824237-91824259 CAGCCTTCTGGGGCCTCTGGTGG - Intergenic
1131666597 15:94577507-94577529 CTTACTTCTGGGGCCTGAAGAGG - Intergenic
1132029608 15:98429144-98429166 GTTCCTTCTGGAGGCTCCAGGGG + Intergenic
1132228980 15:100167923-100167945 CTCCCTTCTGGGGCCTGCTCTGG + Intronic
1132311094 15:100858544-100858566 CTCCCTTCTGGGACCCTCAGGGG - Intergenic
1132395975 15:101474727-101474749 CCTCCTTCTGGTGCCTCCATTGG - Intronic
1132469662 16:94971-94993 TTCTCTTCTGGAGCTTCCAGAGG - Intronic
1132558668 16:583776-583798 CTCCCTTCATGGGCCTCCCAGGG + Exonic
1132743791 16:1428534-1428556 GGCCCTTCTGGGTCCTCCACTGG + Intergenic
1133330040 16:4967193-4967215 TCCCCTTCTAGAGCCTCCAGAGG - Intronic
1133485199 16:6213343-6213365 CACCATTTTGGGGCCTTCAGTGG + Intronic
1133862871 16:9612832-9612854 GTTCCTTCTGTGGGCTCCAGGGG + Intergenic
1134009847 16:10843804-10843826 CTAGCTTCTGTTGCCTCCAGAGG + Intergenic
1134070349 16:11256358-11256380 CTCTCTTCTGGACCCTCCCGCGG + Intronic
1134099508 16:11441810-11441832 GTTCCTTCTGGAGGCTCCAGAGG - Intronic
1135178501 16:20252511-20252533 CTCACCCCTGGAGCCTCCAGAGG - Intergenic
1135624148 16:23981182-23981204 CTTCCTTCTGGAGGCTCTAGGGG + Intronic
1135653464 16:24227170-24227192 GTTCCTTCTGGAGGCTCCAGAGG + Intergenic
1135732497 16:24906793-24906815 CTCCTTTCTGGGTGCTCCAGGGG - Intronic
1135856558 16:26016834-26016856 CTTCCTTCTGGGCACTCAAGAGG + Intronic
1136146965 16:28321503-28321525 CTCCCTTCTGGAGGCTGGAGGGG + Exonic
1136288627 16:29258633-29258655 GTTCCTCCTGGGACCTCCAGGGG + Intergenic
1137023497 16:35452458-35452480 CTTCCTTCTGGAGGCTTCAGAGG - Intergenic
1137330493 16:47490546-47490568 CTCTTTTCTGGAGGCTCCAGGGG + Intronic
1138332051 16:56223153-56223175 TTCCCTTCTGGGGCTTCTAGGGG + Intronic
1138449396 16:57084465-57084487 CTTCCTTCTGGGTCCCACAGTGG - Intergenic
1139489635 16:67279440-67279462 CTCCGTCCTCCGGCCTCCAGGGG + Exonic
1139509686 16:67420044-67420066 ATTCCTTCTGGAGCCTCTAGAGG - Intergenic
1139842643 16:69893945-69893967 TTGCTTTCTGGGCCCTCCAGGGG + Intronic
1140878235 16:79173219-79173241 CTCCCCTCCTGGGCCTCCTGAGG + Intronic
1140978538 16:80084256-80084278 CTCCCTTCAGGGCCCTACAGAGG + Intergenic
1141145904 16:81529817-81529839 GCTCCTTCTGGAGCCTCCAGAGG - Intronic
1141459320 16:84168123-84168145 GTACCTTCTGGGGGCCCCAGGGG + Intronic
1141471946 16:84244755-84244777 TTCCCTCCTGGAGGCTCCAGGGG - Intergenic
1141546461 16:84773364-84773386 CTCACTCCTGGGTCCTGCAGAGG + Intronic
1141570971 16:84933508-84933530 GTGCCTGCTGGGGGCTCCAGGGG - Intergenic
1141645267 16:85364114-85364136 GTTCCTTCTGGGGGCTCCAGGGG + Intergenic
1141760672 16:86026594-86026616 CTCCATCCTGGGGCCTCCCCGGG + Intergenic
1141763447 16:86043925-86043947 GTTCCTTCTGGCGGCTCCAGGGG - Intergenic
1141788184 16:86215688-86215710 GTTCCTTCTGGAGGCTCCAGGGG + Intergenic
1142094342 16:88231539-88231561 GTTCCTCCTGGGACCTCCAGGGG + Intergenic
1142250465 16:88989572-88989594 CTGCCTGGTGGGGCCCCCAGGGG + Intergenic
1142300953 16:89257503-89257525 CTCCCTTCCGGCTCCCCCAGCGG - Intergenic
1142335029 16:89482915-89482937 GTTCCTTCTGGAGGCTCCAGGGG - Intronic
1142703250 17:1677383-1677405 CTTCCTTCTGGGGCCTTGAGAGG - Intronic
1142933463 17:3308214-3308236 CTAATTTCTGAGGCCTCCAGGGG + Intergenic
1143681503 17:8479481-8479503 CTCCATTCTTTGGACTCCAGTGG - Intronic
1144016178 17:11198681-11198703 CTCCCTACTGGCTCCTCCACTGG + Intergenic
1144759687 17:17700383-17700405 CTCCCGGCTCGGGGCTCCAGCGG + Intronic
1144841200 17:18187098-18187120 CTCCTGTCTGAGGCCTCCATGGG - Intronic
1144929884 17:18850855-18850877 TTGCTTCCTGGGGCCTCCAGGGG - Intronic
1145284410 17:21494714-21494736 CTCCTTTCTGGGGGCTCCTGGGG + Intergenic
1145393046 17:22470777-22470799 CTCCTTTCTGGGGGCTCCTGGGG - Intergenic
1145807064 17:27742052-27742074 TTTCCTTCTGGAGGCTCCAGGGG + Intergenic
1145867357 17:28249849-28249871 CTCTCTTCTGGGGGCTCCCTTGG - Intergenic
1146501301 17:33367137-33367159 CTTCCTGCTGGTGCTTCCAGTGG + Intronic
1146811917 17:35910630-35910652 CTCTCTTCAGGAGACTCCAGAGG + Intergenic
1146891755 17:36510876-36510898 CTCGCTGCTGGGGCTCCCAGAGG - Exonic
1147134688 17:38428307-38428329 CTCCCTTCTGGGTGCCCCGGCGG - Intergenic
1147316315 17:39622076-39622098 CTCCCACCTGGGGGCGCCAGAGG + Intergenic
1148438706 17:47700812-47700834 CCCAGTGCTGGGGCCTCCAGGGG + Intronic
1148859177 17:50595228-50595250 CTCCCTTCCGTGTCCTCAAGGGG - Intronic
1148860816 17:50603530-50603552 CTCCCTTGTGTGGCCTCTAGGGG + Intronic
1149034472 17:52118549-52118571 CTCTCTTTTGGGTGCTCCAGGGG - Intronic
1150504583 17:65685147-65685169 CTCCCTTCTGTCCCCTCAAGCGG - Intronic
1150682304 17:67293669-67293691 CTCCTTTCTGTGGTCACCAGTGG - Intergenic
1150682900 17:67297365-67297387 CTCCTTTCTGTGGTCACCAGTGG - Intergenic
1150854632 17:68740324-68740346 CCACCTTCTGGAGTCTCCAGGGG + Intergenic
1151508441 17:74544011-74544033 CTCCTTCCTGTGTCCTCCAGTGG + Intronic
1153117655 18:1679050-1679072 ATTCCTTCTGAGGGCTCCAGAGG + Intergenic
1153667727 18:7381354-7381376 CTCCCTACTGGAGCGTCCATAGG - Intergenic
1153963707 18:10161508-10161530 CTGCTTTCTGGGGCCTCCAGAGG - Intergenic
1154309981 18:13259891-13259913 TCCCCTCCTGGGGCCTCCATTGG - Intronic
1155026608 18:21946313-21946335 CTTCCTTCTGGAGGCTGCAGGGG + Intergenic
1155109493 18:22699840-22699862 ATTCCTTCTGGAGGCTCCAGGGG + Intergenic
1155578596 18:27277499-27277521 CTGCCTTATGGGGCCAGCAGCGG - Intergenic
1155791130 18:29971900-29971922 CTGCCTACTAGGGTCTCCAGGGG + Intergenic
1157275848 18:46310809-46310831 CCCCATTCAGGGGCCTGCAGTGG - Intergenic
1157786035 18:50483409-50483431 CTCATTTCTGTGTCCTCCAGAGG - Intergenic
1157858913 18:51123999-51124021 CTCCCTTCTGGCTCCCCCATTGG - Intergenic
1158015219 18:52775523-52775545 CTCCCTTCTGGCTCCCCCATTGG - Intronic
1158674519 18:59506302-59506324 GTTCCTTCTGGAGGCTCCAGAGG - Intronic
1158703765 18:59772102-59772124 TGCCCCTCTGGGGCTTCCAGAGG + Intergenic
1158968309 18:62643126-62643148 GTCACCACTGGGGCCTCCAGAGG - Intergenic
1159017281 18:63111474-63111496 CTCCCTTCTGGAGGCCCTAGGGG - Intergenic
1160139387 18:76307544-76307566 CTTCCTTCTGGAGGCTCTAGGGG + Intergenic
1160751469 19:736378-736400 CTCCCTCCTGGGGCCCGCTGGGG + Intronic
1160782890 19:885625-885647 GTCCCTCCCGGGGGCTCCAGGGG - Intronic
1160840249 19:1143569-1143591 GTCCCTCCCGGGGGCTCCAGGGG + Intronic
1160956230 19:1693287-1693309 GTCCCTCCTGGAGGCTCCAGGGG + Intergenic
1161031717 19:2060832-2060854 GTCCCTCCTGGGGGCTCCAGGGG - Intergenic
1161095567 19:2388512-2388534 GGCCCTTCTGGGGGCTCCAGGGG - Intergenic
1161124329 19:2547335-2547357 GTCCCTCCTGGAGGCTCCAGGGG + Intronic
1161140004 19:2641574-2641596 GTCCCTCCTTGGGGCTCCAGGGG - Intronic
1161518770 19:4711942-4711964 TTCTCCTCTGGAGCCTCCAGAGG + Intronic
1161534690 19:4811841-4811863 CTCCCTGCAGCGGCCACCAGAGG + Intergenic
1161557998 19:4955265-4955287 GGCCCTCCTGGGGGCTCCAGGGG + Intronic
1161661152 19:5547071-5547093 AACCCTTCTGGGGGCTACAGCGG + Intergenic
1161972500 19:7590508-7590530 CTGCCTCCAGGGGCCTCCACTGG - Intergenic
1162349514 19:10140158-10140180 CTCCCTTCTGGGGCAGCCGCTGG + Exonic
1162356537 19:10188946-10188968 TTCCTTTCTGGGGGCTCCAGGGG - Intronic
1162808891 19:13152737-13152759 CTCCCGTCTGGAGGCCCCAGTGG - Exonic
1163753054 19:19089949-19089971 CTCCCTCCAGGGACCCCCAGTGG - Intronic
1163765397 19:19160815-19160837 CCCTCTCCTGGGGGCTCCAGCGG + Intronic
1164106616 19:22112422-22112444 CTCTCTTCTGGATGCTCCAGGGG + Intergenic
1164615508 19:29665086-29665108 GTGCCTTCTGGTGCCTCCGGCGG - Exonic
1165010680 19:32844045-32844067 CTCCCTTCCTGAGCCTCCCGAGG - Intronic
1165339369 19:35199699-35199721 CTCCCTTCTGGGGGAAACAGTGG - Intergenic
1165800753 19:38548174-38548196 CTCCCTTCTGGGGCCCCACCAGG - Intronic
1165909341 19:39215188-39215210 CTTCCTTCTGGAGGCTCCAGGGG + Intergenic
1166321167 19:42019802-42019824 GTTCCTTCTGGAGGCTCCAGGGG - Intronic
1166793023 19:45409034-45409056 GTCCCCCCTGGGGACTCCAGAGG - Exonic
1166797960 19:45439610-45439632 ATCCCTGCGGGGGCCACCAGGGG + Intronic
1166820685 19:45577725-45577747 ATCCCTTCAGGGGACTCCTGAGG - Intronic
1167717318 19:51152113-51152135 GTTCCTTCTGGAGGCTCCAGGGG + Intronic
1167758609 19:51428878-51428900 ATTCCTTCTGGAGGCTCCAGAGG - Intergenic
1168267738 19:55231618-55231640 CTGCCTTCTGTGGCTTCCTGAGG + Exonic
1168280812 19:55304635-55304657 CTGCCTTCTCGGGGCCCCAGGGG + Exonic
925813205 2:7721661-7721683 CTCTCTTACTGGGCCTCCAGTGG + Intergenic
925903917 2:8527825-8527847 ATCCCTGCTGGCTCCTCCAGAGG + Intergenic
926164105 2:10507420-10507442 AGCCCTGCTGGAGCCTCCAGGGG + Intergenic
926206210 2:10835717-10835739 CTCCCTCATGGGACCGCCAGGGG + Intronic
926311065 2:11676707-11676729 TTCCCTTCTGGGAGCTCTAGGGG + Intergenic
926889168 2:17624710-17624732 TTCCCTTCTGGAGGCTTCAGGGG - Intronic
928041955 2:27887306-27887328 CTCCATTCTGGAGACTCTAGAGG - Intronic
928194498 2:29205550-29205572 GTCCCTTCTGGAGGCTCTAGGGG + Intronic
928264596 2:29800930-29800952 CTCCCTCCTGTGGGCTCCCGTGG + Intronic
929116230 2:38446645-38446667 CTCCTCTCTGTGGCCTCCTGGGG + Intergenic
929571897 2:43027924-43027946 GTTCCTTCTGGAGGCTCCAGGGG + Intergenic
929827205 2:45318195-45318217 GTTCCTTCTGGAGGCTCCAGGGG - Intergenic
930917307 2:56709012-56709034 TTTCCTTCTGAGGGCTCCAGAGG - Intergenic
931267353 2:60672566-60672588 ATCCCTTCTGGGGCATCCCCTGG - Intergenic
934131568 2:88953815-88953837 ATTCCTTCTGGAGGCTCCAGAGG - Intergenic
934771322 2:96909390-96909412 CTCCCTCCTGGAGGCCCCAGAGG - Intronic
935262555 2:101367902-101367924 CTTCCTTCTGGAGGCTACAGAGG - Intronic
936072540 2:109380871-109380893 TGCCCTGCTGGGGCCTCCAAAGG - Intronic
936660214 2:114534895-114534917 CCCCCTTCTGGGGCCCCTTGAGG + Intronic
936714230 2:115165720-115165742 CACCCTTCTGCTGACTCCAGTGG + Intronic
937854934 2:126665583-126665605 CTCCCTTCTGGGCCCCTCACAGG - Intronic
938302436 2:130226683-130226705 CTCCATTCTGGGCTCTGCAGTGG - Intergenic
938324442 2:130388978-130389000 TTTCCTTCTGGGGTCTCTAGGGG + Intergenic
938454248 2:131447568-131447590 CTCCATTCTGGGCTCTGCAGTGG + Intergenic
940908439 2:159189404-159189426 CTCCCTCCTGTGCCTTCCAGAGG + Intronic
942004905 2:171688046-171688068 TTCCCTTCTCGACCCTCCAGAGG + Intronic
946002416 2:216493565-216493587 CTCCCTTTGTGGGCCTCAAGCGG + Intergenic
946136226 2:217649443-217649465 CAGCCATCTGGGGGCTCCAGGGG - Intronic
946740903 2:222800292-222800314 ATCCCTGCTTGGGCTTCCAGGGG - Intergenic
947388829 2:229619496-229619518 CTCCATCCAGTGGCCTCCAGTGG - Intronic
947530632 2:230906804-230906826 CTCCCTTCTCTGACCTCCTGTGG - Intergenic
947672566 2:231947633-231947655 CTCCCGTGAGGGGCCTCCCGTGG - Intergenic
947809857 2:232997503-232997525 CACCCTCCTTGGGCCTACAGTGG + Intronic
947989325 2:234474340-234474362 GTTCCTTCTGGAGGCTCCAGGGG - Intergenic
948030253 2:234811920-234811942 TTCCTTTCTGGAGCCTCTAGAGG + Intergenic
948090169 2:235286807-235286829 CTCCCATCTAGAGACTCCAGGGG + Intergenic
948270512 2:236670009-236670031 CTCCCTGCTGGGGCTGCCATTGG + Intergenic
948388529 2:237596544-237596566 CCCACTTCTGAGGCCTGCAGGGG + Intronic
948424594 2:237878946-237878968 CAACCCTCTGGGGTCTCCAGGGG + Intronic
948989376 2:241544833-241544855 TTCTCTCCTAGGGCCTCCAGAGG - Intergenic
949008591 2:241665632-241665654 CTCCCATCCGGGGCCTGCAGTGG + Intronic
1169031127 20:2407942-2407964 CACTCTACTGGGGCATCCAGAGG + Intronic
1169765098 20:9140356-9140378 CTGCCTTCTAGAGCCTTCAGTGG - Intronic
1169775547 20:9248939-9248961 TTCCTTTCTGGGGGCTCCTGAGG + Intronic
1170683644 20:18548749-18548771 CTCCTTTCATGGGCCACCAGAGG + Exonic
1172230233 20:33331439-33331461 CTCCCTACTAGGGACACCAGGGG - Intergenic
1172916636 20:38448235-38448257 CACACACCTGGGGCCTCCAGGGG + Intergenic
1173052344 20:39575574-39575596 ATTCCTTCTGGAGGCTCCAGGGG - Intergenic
1174186526 20:48710068-48710090 CTCATTGCTGGGGCCTCCAGAGG - Intronic
1174194451 20:48763273-48763295 CGCCCATCTGGGGCCTGCATGGG + Intronic
1174552883 20:51374329-51374351 CTTCCTTCTGGAGGCTCTAGGGG + Intergenic
1175055402 20:56193115-56193137 CGTCCTTCTGGAGGCTCCAGTGG + Intergenic
1175156104 20:56972750-56972772 CTGCCTTCTGGGGCCCCAAATGG - Intergenic
1175274657 20:57759963-57759985 TTCCTTTCTGGGATCTCCAGGGG + Intergenic
1175870927 20:62209025-62209047 CTCCCTGCTGGGGCCACTCGAGG + Intergenic
1176019842 20:62957002-62957024 CGCCCCACTGGGGCCTCCAGGGG + Intronic
1176128490 20:63486539-63486561 GACTCTCCTGGGGCCTCCAGAGG + Intergenic
1176162913 20:63657698-63657720 CTCCCTCCTGGGGCCTTCTGGGG + Intergenic
1177567713 21:22845711-22845733 CTCCTTTCTGGATCCTCCAGGGG + Intergenic
1178515060 21:33239538-33239560 CTCCCTCCTGGGGCCCAGAGTGG + Intronic
1178515088 21:33239744-33239766 CTCCCTCCTGGGGCCCAGAGTGG + Intronic
1178515136 21:33240053-33240075 CTCCCTTCTGGGCCCCAGAGTGG + Intronic
1179022929 21:37656389-37656411 CTCCCTGCTGGGGCCTTCCCGGG + Intronic
1179464626 21:41563316-41563338 CTTCCTGCTGGGGCAGCCAGAGG - Intergenic
1179596757 21:42448165-42448187 GTTTCTTCTGGAGCCTCCAGGGG + Intergenic
1179642606 21:42757283-42757305 CTCCCATCTGTGGCCGCAAGTGG + Intronic
1179806975 21:43845561-43845583 CTCCCTGTTGGGGCCTTCAGGGG + Intergenic
1179914069 21:44464966-44464988 TTCTCTCCTGGAGCCTCCAGAGG + Intergenic
1179956552 21:44743118-44743140 CTCTCTTCTGGGTGCTCCAGGGG - Intergenic
1180046619 21:45309198-45309220 CTCCCTCCAGGGGGCGCCAGGGG - Intergenic
1180086561 21:45510337-45510359 CTCCCCTCTAGGGCCTCTGGAGG + Intronic
1180929466 22:19579161-19579183 CTCCCTCCTGGGGTCTCAAGGGG + Intergenic
1181388162 22:22559286-22559308 CTCGCGTCTGGGGCCAGCAGGGG + Exonic
1181458755 22:23074035-23074057 CACTCTGGTGGGGCCTCCAGGGG - Intronic
1182296052 22:29311691-29311713 CTGCCTCCTGGGGCCCCCCGGGG - Intronic
1183110066 22:35642367-35642389 CTCCCTTCTGGAGCATCATGAGG + Intergenic
1183485587 22:38086204-38086226 CCCTCTCTTGGGGCCTCCAGCGG - Intronic
1184249424 22:43251675-43251697 TTTCCTTCTGGAGGCTCCAGGGG - Intronic
1184522302 22:45002393-45002415 TTGCCTTCTGGGGCTTCCAGAGG + Intronic
1184951499 22:47845879-47845901 ATTCCTTCTGGAGGCTCCAGGGG + Intergenic
1185031189 22:48443799-48443821 CCTCCCTCTGGGGACTCCAGAGG + Intergenic
1185040564 22:48501724-48501746 CACACCCCTGGGGCCTCCAGGGG - Intronic
1185044052 22:48520162-48520184 GTTCCTTCTGGGAGCTCCAGGGG - Intronic
1185236843 22:49718822-49718844 CTGTCGTCTGGGGCCTCAAGGGG - Intergenic
1185314629 22:50173745-50173767 CTGCCTTCTCCGGCCTCCAGAGG + Intronic
949479131 3:4476802-4476824 TTCCTTTCTGGGGGCTCTAGAGG - Intergenic
949510194 3:4760648-4760670 CTCCTTTCTGGAGGCTCTAGGGG + Intronic
950425924 3:12924726-12924748 CTCCCTTCTCAGGCTTCCTGGGG + Exonic
950476841 3:13220164-13220186 CTGCCTCCTGGGGCCGGCAGTGG + Intergenic
951798282 3:26566608-26566630 TTCCTTCCTGGGGCCTCCAAAGG + Intergenic
952315997 3:32232738-32232760 CTCCCTGCAAGGCCCTCCAGAGG - Intergenic
952457247 3:33484796-33484818 CTTCCTTCTGGAGGCTCTAGGGG + Intergenic
952580260 3:34824568-34824590 CTCCCTTCTGGCTCCCCCACTGG + Intergenic
952889229 3:38029745-38029767 CCCCCTTCTGGGGACGCGAGAGG + Intronic
952986850 3:38793442-38793464 CTCTGGCCTGGGGCCTCCAGAGG - Intronic
953088388 3:39697473-39697495 CTCCCTTCTGGCTCCCCCATCGG + Intergenic
953285107 3:41598938-41598960 CTCCTTTCTGGAGGCTCCAGGGG + Intronic
953441316 3:42920495-42920517 CTCTCTTCTGGATGCTCCAGGGG + Intronic
954085503 3:48241073-48241095 CTTTCTTCTGGCGCCGCCAGTGG + Intergenic
954124509 3:48520689-48520711 CTCCCTTCTGGCCCATCCATTGG - Intronic
954894144 3:53961408-53961430 GTTCCTTCTGGGGGCTCCAGAGG - Intergenic
959013569 3:101107950-101107972 TTCCCTTCTAGGTCCTCCAGAGG + Intergenic
961203398 3:125061983-125062005 CTCTCTCCTGGAGCCTTCAGAGG - Intergenic
962294216 3:134166266-134166288 CTCTCTTCTGGGTCCTCATGTGG - Intronic
962419878 3:135218545-135218567 CTCCATTCTGGGCCCCACAGGGG + Intronic
962528562 3:136257376-136257398 CTCCCTTCTGGAGGCTCCAGGGG - Intronic
964446777 3:156767569-156767591 CTCCCTTCCAGGGCCACAAGGGG + Intergenic
965321021 3:167251172-167251194 CTCCCTTCTGGCTCCCCCAGTGG + Intronic
966688135 3:182718221-182718243 CTCTCTTCTGGATGCTCCAGGGG + Intergenic
967219054 3:187234108-187234130 CTCCCATCAGGGGTCTCAAGTGG - Exonic
969174752 4:5390023-5390045 CTTCCTTCTGGAGCCCACAGAGG - Intronic
969212315 4:5697150-5697172 TTCGCTTCTGGAACCTCCAGAGG + Intronic
969212853 4:5701042-5701064 CTCTTTTCTGGAGGCTCCAGGGG + Intronic
969324356 4:6432311-6432333 CTGCCTTCTGGGGCTCACAGTGG + Intronic
969521669 4:7681507-7681529 TTCCTTTCTGGAGGCTCCAGAGG - Intronic
969547702 4:7842581-7842603 CTTCCTGCTGGGGTCTCCACTGG + Intronic
969844935 4:9913072-9913094 ATTCCTTCTGGAGACTCCAGAGG - Intronic
971423734 4:26496446-26496468 CTGCCTTCTGTGGGCACCAGGGG - Intergenic
972575095 4:40344143-40344165 ATTCCTTCTGGAGACTCCAGGGG - Intronic
972733151 4:41814755-41814777 TTCTCTCCTGGAGCCTCCAGAGG - Intergenic
972745368 4:41926959-41926981 CTCCTTTCTAGAGGCTCCAGTGG - Intergenic
975014481 4:69396608-69396630 CTTCCTTCTGCTGCCTCCATTGG - Intronic
976692797 4:87886490-87886512 CTCTCTGCTGGGGCCTCTGGTGG - Intergenic
977457335 4:97277911-97277933 GTTCTTTCTGGAGCCTCCAGAGG - Intronic
977558325 4:98506919-98506941 CCCCCTACTGAGGCCACCAGTGG - Intronic
978352425 4:107833978-107834000 CTCCTTTCTGGAGGCTCCACGGG - Intronic
978389094 4:108205876-108205898 CTTCCTTCTGGGGGCTCCAAGGG + Intergenic
979015931 4:115433786-115433808 TTTCCATCTGGAGCCTCCAGCGG + Intergenic
981042697 4:140237990-140238012 CTCTCTCCTGTGGCTTCCAGAGG + Intergenic
984163996 4:176286227-176286249 CTCCCCTCTGTGTCCTCCAGAGG - Intergenic
985927771 5:3031041-3031063 CTCTCTACTGGGGCCTTCAAGGG - Intergenic
986101369 5:4614725-4614747 ATACCTTCTGGGGACTCTAGAGG + Intergenic
986673319 5:10162387-10162409 CTCCCATCTGGGGCCCCGAAGGG + Intergenic
986788707 5:11139844-11139866 GTTCCTTCTGGGGGCTCCAGGGG + Intronic
989445599 5:41524888-41524910 TTTCCTTCTAGGGCCTTCAGAGG + Intergenic
989610591 5:43286997-43287019 CTCCTTTCTGGAGGCTCCAGGGG + Intergenic
992031202 5:72723093-72723115 TTCCTTTCTGGAGGCTCCAGCGG - Intergenic
992857285 5:80875494-80875516 CTCCCCTCTGGGGCTGGCAGGGG + Intronic
992950914 5:81857281-81857303 ATTCCTTCTGAGCCCTCCAGTGG - Intergenic
994106820 5:95959094-95959116 CTCCCTTCTGGGGCCTCCAGTGG + Intronic
994669181 5:102746284-102746306 TTCCCTTCTGGTGGCTCTAGAGG + Intergenic
995182769 5:109244429-109244451 GTCCCTTCTGGAGGTTCCAGGGG - Intergenic
995738090 5:115324905-115324927 AGCCCTTCAGGGGCCTCCATGGG - Intergenic
998877813 5:146618344-146618366 CTCCTTTCTGGAGGCTCTAGGGG - Intronic
1000697062 5:164399632-164399654 CTCTGTTCTGTGGACTCCAGAGG + Intergenic
1000741080 5:164970958-164970980 CTCTCTTCTGGATGCTCCAGGGG + Intergenic
1001162201 5:169329958-169329980 CTCCTTTCTGGAGGCTCTAGGGG + Intergenic
1001307683 5:170587536-170587558 GTTCCTTCCGGGGGCTCCAGGGG + Intronic
1002329495 5:178431668-178431690 CTTCCTTCTGGAGGCTCCAGGGG - Intronic
1002432804 5:179212960-179212982 CTTCCTTCTGGGTCTTTCAGGGG - Intronic
1002617203 5:180463388-180463410 TTCTCCTCTGGAGCCTCCAGAGG + Intergenic
1003507226 6:6750080-6750102 CTTCCCTCTGTGGCTTCCAGCGG + Intergenic
1003804601 6:9713073-9713095 CTTCTTTCTGGAGCCTCCAGAGG - Intronic
1004053460 6:12111469-12111491 CTGTCTTCTGGAGGCTCCAGGGG + Intronic
1004274212 6:14221388-14221410 ACTCCTTCTGGGGCCTGCAGAGG - Intergenic
1005164009 6:22898061-22898083 ATTCCTTCTGGAGGCTCCAGAGG - Intergenic
1005959512 6:30685651-30685673 CTCCGCTCCCGGGCCTCCAGAGG + Exonic
1006094830 6:31649320-31649342 CTCCCTTCTGGGGCATCTTCTGG - Exonic
1006627477 6:35407431-35407453 ATCCCTTCTGAGGCCTCCCGTGG + Intronic
1006677847 6:35776877-35776899 CTCCCCTCTGAGGCCACCAGGGG - Intronic
1007380710 6:41488527-41488549 CACACTTCAGGGGCCTCCAAGGG + Intergenic
1009735489 6:67671618-67671640 CTCTCTTCTGGATGCTCCAGGGG + Intergenic
1010772390 6:79846207-79846229 GTCCCTGCTTTGGCCTCCAGAGG + Intergenic
1011753314 6:90474919-90474941 GTTCCTTCTGGAGGCTCCAGAGG + Intergenic
1013372447 6:109482938-109482960 CTCCCTGCTGGGACCACCCGGGG - Intronic
1014954837 6:127601944-127601966 CTCCCTTTTGGATACTCCAGGGG + Intergenic
1016152727 6:140763621-140763643 CTTCCTTCTGGAGTTTCCAGGGG + Intergenic
1017650857 6:156581373-156581395 TTCCCTTCTGGAGACTCCAGGGG + Intergenic
1017655171 6:156620659-156620681 TTCCCTTCTGGAGGCTCTAGGGG - Intergenic
1018948603 6:168364338-168364360 GCCCCTTCTGGGGCCACCACTGG - Intergenic
1019123603 6:169824700-169824722 CTGTCTTATGGGGCCTGCAGAGG + Intergenic
1019256510 7:55916-55938 CTCCCTCCTGTGGCCTCAGGTGG + Intergenic
1019297276 7:284786-284808 CTCCCTTCTGGGGCGAGCCGAGG + Intergenic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1020097515 7:5377087-5377109 GAACCTCCTGGGGCCTCCAGTGG + Intronic
1020192165 7:6008858-6008880 CGCCACTCCGGGGCCTCCAGGGG + Intronic
1020892240 7:13892835-13892857 GTTCCTTCTGGAGGCTCCAGGGG - Exonic
1022067936 7:26879971-26879993 ATTCCTTCTGGAGGCTCCAGGGG - Intronic
1022478469 7:30727431-30727453 CTCCCTCCTCCTGCCTCCAGAGG - Intronic
1022488103 7:30795725-30795747 ATTCCTTCTGGAGCCTCTAGGGG + Intronic
1023047677 7:36225065-36225087 CTCTCCTCTCGAGCCTCCAGAGG + Intronic
1024203061 7:47126030-47126052 CTCCCTTCTGGCTCCCCCATGGG - Intergenic
1025995418 7:66524537-66524559 CCCCCTTTTGGGGGCTCCTGTGG - Intergenic
1026987068 7:74561403-74561425 CCCCCTTCTGGGGGTTCCCGTGG - Intronic
1027228233 7:76258208-76258230 CTCCCCTCTGCAGCCTCCAGGGG - Intronic
1027342510 7:77224235-77224257 TTCCTTTCTGGAGGCTCCAGGGG + Intronic
1027693918 7:81384729-81384751 ATTCCTTCTGGATCCTCCAGGGG + Intergenic
1028495712 7:91457451-91457473 TTCCTTTCTGGAGACTCCAGGGG - Intergenic
1028527647 7:91803042-91803064 TTCCTTTCTGGGGGCTCTAGAGG + Intronic
1029264302 7:99326135-99326157 CTCCCTGCCGGGGCCTCCTGAGG + Intronic
1029425131 7:100489925-100489947 CTCCCTTCCCGGGGCTGCAGGGG + Intronic
1029972725 7:104805056-104805078 CTCCCCTCAGGGGCCCCCATAGG + Intronic
1030589227 7:111460024-111460046 TTGTCTTCTGGGGCCTCTAGAGG - Intronic
1030979268 7:116167042-116167064 TTCCTTTCTGGGGGCTCTAGAGG - Intergenic
1031583779 7:123508247-123508269 TTCTCTTCTGGATCCTCCAGAGG + Intronic
1031681972 7:124686549-124686571 GTTCCTTCTGGAGGCTCCAGGGG - Intergenic
1032495205 7:132356194-132356216 TTCCCAACTGGGCCCTCCAGTGG + Intronic
1032509121 7:132457895-132457917 ATTCCTGCTGGAGCCTCCAGAGG - Intronic
1032544994 7:132734374-132734396 CTCCCTTCTGGCTCCCCCATCGG + Intergenic
1033032777 7:137844023-137844045 CTCCCTTCTGGGGGCACCTGAGG - Intronic
1033128380 7:138724517-138724539 CCCACTTCTGGGTCCTACAGAGG - Intronic
1033241511 7:139683441-139683463 CTCCCTACGGGGGCCTCCACAGG + Intronic
1033263270 7:139861833-139861855 GTTCCTTCTGGGGGATCCAGGGG + Intronic
1033414226 7:141148081-141148103 GTCCCTTCTGGAGGCTCTAGGGG + Intronic
1033545498 7:142395829-142395851 CTCTCTTCTGGAGCCTACACTGG + Intergenic
1034150402 7:148910632-148910654 CTCACTGCTGCAGCCTCCAGGGG + Intergenic
1034941373 7:155232466-155232488 CATCCTTCTGGGGACTCCAGGGG - Intergenic
1034949907 7:155290158-155290180 GTTCCTTCTGGAGACTCCAGGGG - Intergenic
1034968633 7:155406112-155406134 CTTCCTGCTGGGGCGTCCTGTGG - Intergenic
1035644800 8:1210682-1210704 TTCCCTTCTTTGGCCTCAAGTGG - Intergenic
1036595288 8:10206443-10206465 TTCCCTTCTGGGGCTTCCACTGG - Intronic
1037696575 8:21228958-21228980 TTCCTTTTTGGGGCCTCAAGAGG + Intergenic
1038670117 8:29576477-29576499 CTCCATTTTGGGGGCTCAAGAGG + Intergenic
1039248645 8:35636698-35636720 CTCCCTCATCAGGCCTCCAGAGG + Intronic
1039498174 8:37997048-37997070 TTCCCTTCTGCGGACTCCAACGG - Intergenic
1040276964 8:46018759-46018781 CTGCCTTATGGTGCCTCCTGTGG + Intergenic
1040374294 8:46808508-46808530 CTCTCTTGTGGGTACTCCAGGGG + Intergenic
1040493869 8:47949074-47949096 CTCACTTCTCCAGCCTCCAGAGG + Intronic
1040919742 8:52602944-52602966 CTCTCTTCTGGATACTCCAGGGG - Intergenic
1041213857 8:55580385-55580407 GTTCCTTCTGGGGGTTCCAGGGG + Intergenic
1041936203 8:63334749-63334771 CCTCCATCTGGGGCCTGCAGGGG + Intergenic
1041955768 8:63556764-63556786 CTCCCTGCTGGGTCCTCCTGAGG - Intergenic
1042927942 8:73986017-73986039 CTCCCACCTGAAGCCTCCAGGGG + Intergenic
1043238456 8:77899695-77899717 CTCCCTTCTGGCTCCCCCATCGG - Intergenic
1044046112 8:87434598-87434620 CTCCCCTCTGGGGCTTTCTGAGG + Intronic
1044590622 8:93910857-93910879 CTTCCTTCTGGGGGCTCTAAGGG - Intronic
1045548823 8:103152185-103152207 GTCCCTTCCTTGGCCTCCAGGGG + Intronic
1045559310 8:103245607-103245629 CTCCCTTCTGGGGACTCACTTGG + Intergenic
1046692248 8:117298955-117298977 ATTCCTTCTGGAGGCTCCAGGGG - Intergenic
1047286730 8:123493690-123493712 TTCCCTTCTGGGAGCTCTAGGGG + Intergenic
1047306276 8:123655337-123655359 CTCCCTGCTTGTGCCTCCATGGG - Intergenic
1047964939 8:130039520-130039542 GTTCCTTCTGGAGGCTCCAGGGG - Intergenic
1048440104 8:134453445-134453467 ATCCCTTCTGGAGGCTCCAGGGG + Intergenic
1048555797 8:135474887-135474909 CTCCTTTCTGGAGGCTTCAGGGG + Intronic
1048603282 8:135941860-135941882 CTCCATTCTGAGGAGTCCAGTGG - Intergenic
1049021720 8:139961638-139961660 GTCCTTTCTGGGGCCCCCAAGGG - Intronic
1049040624 8:140110065-140110087 GTCTCATCTGGGGCCTCCCGTGG - Intronic
1049094346 8:140539679-140539701 CAACCTCCTGGGCCCTCCAGGGG - Intronic
1049163777 8:141114030-141114052 CTGCCTTCTGGGACCTCCCAAGG - Intergenic
1049791813 8:144475717-144475739 CTCCCGCCTGGGGCCCCCAGAGG - Exonic
1051873771 9:21769051-21769073 CTTCCTTCTGGAGGGTCCAGAGG - Intergenic
1052059610 9:23944298-23944320 CTCTCTTCTGGATGCTCCAGAGG + Intergenic
1052764526 9:32627151-32627173 GTTCCTTCTGGAGGCTCCAGAGG + Intergenic
1053021978 9:34701431-34701453 CTCCCTTCCTGGGCCTGCAGGGG + Intergenic
1053363831 9:37508837-37508859 CTACCTCCTGGGGCCCCCAAAGG - Intergenic
1054918832 9:70521702-70521724 CTTGATTCAGGGGCCTCCAGTGG + Intergenic
1055740182 9:79379824-79379846 GTTCCTTCTGGAGGCTCCAGGGG + Intergenic
1056774228 9:89499241-89499263 TTCCGTTCTAGGGCCTCCTGTGG + Intergenic
1057192164 9:93094370-93094392 GCCCCCTCTGGGTCCTCCAGGGG + Intergenic
1057533329 9:95874734-95874756 CTCCTTTCTGGTGACTCCACAGG - Intergenic
1058079858 9:100690303-100690325 CTTCCTTCTGGAGGCTCAAGAGG + Intergenic
1059533500 9:115059729-115059751 CTCTCTGCTGAGGCCTCCACAGG - Exonic
1059534047 9:115064646-115064668 CTCTCTGCTGAGGCCTCCACAGG - Exonic
1061409037 9:130408633-130408655 CTGCCTCCAGGGGCCTCCAGAGG - Intronic
1062021051 9:134319596-134319618 CACCCTGCTGGGGCCTCCCATGG - Intronic
1062252435 9:135605060-135605082 CTCCCTTCTGGTTCCTTCCGGGG + Intergenic
1062555656 9:137112483-137112505 CTCCATGCTGGGGACCCCAGGGG + Intronic
1203733562 Un_GL000216v2:113924-113946 GTTCCTTCTGGAGGCTCCAGGGG - Intergenic
1185622013 X:1455772-1455794 CTTCCTTCTGGAGGCTCTAGGGG + Intergenic
1185691067 X:2155615-2155637 GTTCCTTCTGGGGGCTCTAGGGG + Intergenic
1186421061 X:9426846-9426868 CTCCTTTCTGGAGACTCTAGGGG - Intergenic
1187992207 X:24886962-24886984 GTCCCTACTGGGGGCTCCACAGG + Intronic
1188793715 X:34437360-34437382 TTCCCTACAGGGGCCTCCAGTGG + Intergenic
1188915932 X:35910948-35910970 CTCCTTTCTGGTGGCTCTAGGGG + Intergenic
1189080898 X:37971755-37971777 CCCCCTTCTGGGCGCTCCATAGG - Intronic
1189120892 X:38393836-38393858 GTTCCTTCTGGAGGCTCCAGAGG + Intronic
1189399075 X:40648055-40648077 CCCCCTTCTGGGTGGTCCAGTGG - Intergenic
1190248451 X:48705804-48705826 CTCCCTGCTGGGTCCTGCATGGG + Intronic
1191189656 X:57653054-57653076 CTTCCTTCTGGATGCTCCAGGGG - Intergenic
1192212409 X:69136500-69136522 CTCCCTTCTTGGGAGGCCAGAGG + Intergenic
1193691950 X:84657110-84657132 CTCTCTTCTAGAGGCTCCAGGGG + Intergenic
1195278771 X:103310215-103310237 CTCCATTTTGGTGCCTGCAGAGG - Intronic
1196563216 X:117175413-117175435 CTCTCTTCTGGATTCTCCAGGGG - Intergenic
1196904902 X:120421467-120421489 CTCCAATCTGGAGCCTCCTGTGG + Intergenic
1197010775 X:121560559-121560581 TTCCTTTCTGGGGGCTCTAGAGG + Intergenic
1199169199 X:144716973-144716995 GTTCCTTCTGGAGCCTCCATAGG + Intergenic
1199628360 X:149760198-149760220 CCCCTACCTGGGGCCTCCAGGGG - Intergenic
1200034516 X:153319082-153319104 CTCCCAGCTGGGACCTCCTGGGG + Intergenic
1200707997 Y:6459043-6459065 CTTCATTCTGGGCCCCCCAGGGG + Intergenic
1200768283 Y:7099925-7099947 CTCCCTTCTTTGCCCTCTAGTGG + Intergenic
1201026115 Y:9705665-9705687 CTTCATTCTGGGCCCCCCAGGGG - Intergenic
1201903884 Y:19069766-19069788 GTTCCTTCTGGAGGCTCCAGTGG - Intergenic
1202086877 Y:21147250-21147272 CTCTCTTCTGGATGCTCCAGGGG - Intergenic
1202182055 Y:22147995-22148017 CTTCATTCTGGGTCCCCCAGGGG + Intergenic
1202209305 Y:22438407-22438429 CTTCATTCTGGGTCCCCCAGGGG - Intergenic
1202627447 Y:56874494-56874516 GTTCCTTCTGGAGGCTCCAGGGG + Intergenic