ID: 994107076

View in Genome Browser
Species Human (GRCh38)
Location 5:95960756-95960778
Sequence AGTCCTCAGGTCTCTCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 230}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994107071_994107076 14 Left 994107071 5:95960719-95960741 CCGATGTCTTGCTCCCGGGGAGC 0: 1
1: 0
2: 0
3: 7
4: 87
Right 994107076 5:95960756-95960778 AGTCCTCAGGTCTCTCCCCAGGG 0: 1
1: 0
2: 0
3: 20
4: 230
994107073_994107076 0 Left 994107073 5:95960733-95960755 CCGGGGAGCGCTAAGTGTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 50
Right 994107076 5:95960756-95960778 AGTCCTCAGGTCTCTCCCCAGGG 0: 1
1: 0
2: 0
3: 20
4: 230
994107066_994107076 21 Left 994107066 5:95960712-95960734 CCAGAACCCGATGTCTTGCTCCC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 994107076 5:95960756-95960778 AGTCCTCAGGTCTCTCCCCAGGG 0: 1
1: 0
2: 0
3: 20
4: 230
994107065_994107076 30 Left 994107065 5:95960703-95960725 CCTCTCTCTCCAGAACCCGATGT 0: 1
1: 0
2: 2
3: 10
4: 118
Right 994107076 5:95960756-95960778 AGTCCTCAGGTCTCTCCCCAGGG 0: 1
1: 0
2: 0
3: 20
4: 230
994107072_994107076 1 Left 994107072 5:95960732-95960754 CCCGGGGAGCGCTAAGTGTGCGT 0: 1
1: 0
2: 0
3: 1
4: 33
Right 994107076 5:95960756-95960778 AGTCCTCAGGTCTCTCCCCAGGG 0: 1
1: 0
2: 0
3: 20
4: 230
994107070_994107076 15 Left 994107070 5:95960718-95960740 CCCGATGTCTTGCTCCCGGGGAG 0: 1
1: 0
2: 0
3: 8
4: 71
Right 994107076 5:95960756-95960778 AGTCCTCAGGTCTCTCCCCAGGG 0: 1
1: 0
2: 0
3: 20
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994107076 Original CRISPR AGTCCTCAGGTCTCTCCCCA GGG Intronic
901652788 1:10752593-10752615 AGTCCCCAGGCAGCTCCCCAGGG + Intronic
902211012 1:14904619-14904641 AGTGCTCAGGTCTCACCACCAGG + Intronic
902712507 1:18249964-18249986 TGTCCACACCTCTCTCCCCAGGG - Intronic
902796439 1:18803777-18803799 TGTCCTCAGGTCCCCTCCCAGGG + Intergenic
903522974 1:23967849-23967871 AGTTCCCAGGTCTTTCCCCTGGG + Intronic
904562050 1:31405526-31405548 ATTCCTCGGATCCCTCCCCAGGG - Intergenic
905082521 1:35336832-35336854 AGTCCTCATGTCTCTACAAAAGG + Intronic
906144452 1:43551553-43551575 AGTCCCAAGGTCTCCCTCCAGGG + Intronic
908043727 1:60145226-60145248 AGTCCTCACATCACTACCCAAGG + Intergenic
909318023 1:74248051-74248073 AGGCCTCAGCTGCCTCCCCATGG - Intronic
910991469 1:93061051-93061073 AGTCAGTAGTTCTCTCCCCAGGG - Intergenic
913061615 1:115213714-115213736 AGACCTCAGGTCTCTTTTCACGG + Intergenic
913463657 1:119116728-119116750 AGTCCTCAGCTCAAGCCCCAGGG + Intronic
914928262 1:151907604-151907626 AGTTCTCCTGTCTCACCCCATGG + Intronic
915752887 1:158228452-158228474 AGCACAGAGGTCTCTCCCCAGGG - Intergenic
915951695 1:160193554-160193576 AGGCCTGAGGTCTCTGCCCCTGG - Intronic
916814902 1:168342483-168342505 AGTCCTCAGAGCTCTCTGCAGGG + Intergenic
916900943 1:169222619-169222641 AGTCCTGAGGTCTCAGCCCGGGG - Intronic
917965420 1:180175671-180175693 AGTCGTCAGGACTTTCCCCAAGG - Intronic
920435949 1:205947337-205947359 AATCCTCACTTCTCTCCCCTGGG + Intergenic
920456099 1:206102287-206102309 AGTAGTGAAGTCTCTCCCCAGGG + Exonic
920830002 1:209455928-209455950 AGACTTCACGGCTCTCCCCAGGG - Intergenic
921283508 1:213589082-213589104 AGCCCTCAGGTGACTCACCAGGG - Intergenic
923168689 1:231392905-231392927 AGTCCTCAGTTCTCACCCCTAGG + Intronic
923211970 1:231811648-231811670 AATCCTCAGGCCTCTCACCTGGG - Intronic
923833233 1:237580870-237580892 TCTCCTGAGGTCTCTCTCCATGG - Intronic
1062833209 10:619745-619767 AGCCCTCTGGTGCCTCCCCATGG + Intronic
1062996416 10:1870806-1870828 AGTCCTCAGTGATCCCCCCAGGG - Intergenic
1064723573 10:18254736-18254758 AGTCCTCATTTCTCTCCTTAGGG - Intronic
1066352198 10:34646387-34646409 AGTTTTCACCTCTCTCCCCAGGG + Intronic
1066963491 10:42241904-42241926 AGTCCCCAGGTTCCGCCCCACGG + Intergenic
1074850024 10:117432308-117432330 AGTCATCTGGCCTCTCCCCAAGG - Intergenic
1075635449 10:124027324-124027346 AGTGACCATGTCTCTCCCCAAGG + Intronic
1076088079 10:127653448-127653470 AGGCCTCAGTCCTTTCCCCATGG - Intergenic
1076685297 10:132195939-132195961 AGTCCTCAGTCCTGTGCCCACGG + Intronic
1076827242 10:132975223-132975245 GTTCCTCAGGTCCCTCCGCAGGG + Intergenic
1077379329 11:2221571-2221593 TGTCCTCAGTCCTTTCCCCAAGG + Intergenic
1078663002 11:13302209-13302231 ATTCCTCAGGTCTCACCTCCTGG - Intronic
1081486756 11:43536940-43536962 ATTCCCCAGGTATCTCCCTAGGG + Intergenic
1082195391 11:49298500-49298522 GGGCCTCAGGCCTCTGCCCAGGG + Intergenic
1083233682 11:61338844-61338866 AGTCACCAGCTCCCTCCCCAGGG - Intronic
1084089488 11:66870671-66870693 AGGCCCCAGGGCTGTCCCCAAGG + Intronic
1084271932 11:68033567-68033589 TGGCCTCAGGTGTCACCCCATGG - Intronic
1084497546 11:69513697-69513719 AGTCATCACAGCTCTCCCCATGG - Intergenic
1085253975 11:75161962-75161984 TGTCCTCAGTTATCACCCCATGG + Intronic
1086173619 11:83863842-83863864 TGTCCTCAAGTCTCTCTCCTTGG - Intronic
1086660541 11:89411052-89411074 GGGCCTCAGGCCTCTGCCCAGGG - Intronic
1089533140 11:119144899-119144921 AGTCCTCCTGTGGCTCCCCAAGG - Intergenic
1090161349 11:124498833-124498855 ATTCCTCTGGCCTCTCCCTATGG - Intergenic
1092132295 12:6120988-6121010 TTTCCCCGGGTCTCTCCCCACGG - Intronic
1093777923 12:23099129-23099151 AGTCTTCAGGCCTTCCCCCAAGG - Intergenic
1095728235 12:45475153-45475175 AGTCCTCAGGAAGCTCCCAATGG - Intergenic
1098144714 12:67486946-67486968 AATCCTCAGGTCACTCCACCAGG + Intergenic
1100364717 12:93909441-93909463 AGTCCTCCGATCTCTTTCCATGG - Intergenic
1103523621 12:121552711-121552733 AGTGGCCAGGTCCCTCCCCATGG + Intronic
1107560151 13:41551063-41551085 AGTCCTCTGGTCGCTCTCCCAGG + Intergenic
1111070884 13:83166831-83166853 AGTCTTGAGGTCTCCCTCCAAGG + Intergenic
1112460609 13:99600609-99600631 AGTCCCCTCCTCTCTCCCCAAGG + Intergenic
1112584618 13:100707343-100707365 AGTCCCCATGTCTCTCCCAGTGG + Intergenic
1114155564 14:20099414-20099436 AGGCCTCAGCTGCCTCCCCATGG + Intergenic
1115118297 14:29909213-29909235 GGGCCTCAGCTGTCTCCCCATGG + Intronic
1115459867 14:33648702-33648724 TGTCCTCACATCTCTCCCCTGGG + Intronic
1118612666 14:67553779-67553801 AGTCCTCAGGCCTGTCCCAGAGG - Intronic
1119182328 14:72613591-72613613 GGTCCTGAGGTGACTCCCCAGGG - Intergenic
1122070484 14:99202639-99202661 TGGCCTCTGCTCTCTCCCCAGGG - Intronic
1122225968 14:100279798-100279820 TGTCCTCAGGACCCTGCCCAAGG + Exonic
1123108964 14:105856413-105856435 AGGCCTCAGGTCTTTGTCCAAGG + Intergenic
1123825560 15:24078570-24078592 AGGCCTCAGCTGCCTCCCCACGG - Intergenic
1125109397 15:36013494-36013516 AGTCAACAGTTCTCTCCCCTTGG - Intergenic
1125506706 15:40271570-40271592 GGTTCTCAGGTGTCTCCCCTGGG - Intronic
1128250356 15:66159677-66159699 AGGCCCCAGGTCTATCCTCATGG - Intronic
1128889957 15:71322710-71322732 AGGCCTTAGTTCTCTCCACATGG + Intronic
1131097737 15:89666710-89666732 TGGCCTGAGGCCTCTCCCCACGG - Intronic
1131143937 15:90000040-90000062 AGACCTCACGTTTCTCCCCCTGG + Intergenic
1133188574 16:4116745-4116767 CGCCTTCAGGTCTCTCCGCAGGG - Intergenic
1134061536 16:11202410-11202432 AGTCCTCAGCTCCCTACCGAAGG + Intergenic
1136356658 16:29748570-29748592 AGGCCTCAGCTGCCTCCCCACGG + Intergenic
1136724639 16:32348384-32348406 AGTCCCCAGGTTCCGCCCCACGG + Intergenic
1136842966 16:33554424-33554446 AGTCCCCAGGTTCCGCCCCACGG + Intergenic
1137945709 16:52731625-52731647 AGGCCTCAGCTGCCTCCCCATGG + Intergenic
1138438414 16:57020046-57020068 AGTCTTGATGTCTCTGCCCAGGG - Intronic
1139955396 16:70690717-70690739 TGTCCTCAGCTCCCTTCCCAGGG + Intronic
1140995373 16:80253774-80253796 ACTCCTCACCTCACTCCCCAGGG + Intergenic
1203001791 16_KI270728v1_random:169371-169393 AGTCCCCAGGTTCCGCCCCACGG - Intergenic
1203133394 16_KI270728v1_random:1705777-1705799 AGTCCCCAGGTTCCGCCCCACGG - Intergenic
1203148165 16_KI270728v1_random:1816548-1816570 AGTCCCCAGGTTCCGCCCCACGG + Intergenic
1203153131 16_KI270728v1_random:1854722-1854744 AGTCCCCAGGTTCCGCCCCACGG + Intergenic
1143152887 17:4818148-4818170 ATTCCCCAGGTCTCTCTCCTGGG - Intronic
1144373611 17:14617366-14617388 ATTATTCGGGTCTCTCCCCATGG + Intergenic
1144730400 17:17522709-17522731 AGACCCCATGTGTCTCCCCAGGG - Intronic
1145304528 17:21666110-21666132 AGCCCTCTGGCCTGTCCCCAGGG + Intergenic
1148139151 17:45316490-45316512 AGTTCTCAGGTCACACCTCAAGG - Intronic
1150621353 17:66809911-66809933 GGTCCCCAGGTCTCTCACCTTGG + Exonic
1150899469 17:69255619-69255641 AGTCCTAAGATCTCTCCTAAAGG + Exonic
1151478327 17:74355970-74355992 GATCCTGAGGCCTCTCCCCATGG + Intergenic
1152561275 17:81079974-81079996 TGGCCTCACGTCTCACCCCAAGG + Intronic
1157422008 18:47555381-47555403 AGTCCCCAGGGCTCTTGCCATGG + Intergenic
1157685617 18:49640354-49640376 ATTCCTCAGCTTCCTCCCCATGG - Intergenic
1157773675 18:50373765-50373787 TGTCCTCAGGTCTTTCTCCCAGG - Intergenic
1159581193 18:70236236-70236258 AATCCTGAGATGTCTCCCCATGG + Intergenic
1159997340 18:74978927-74978949 AGCCCTCACGCCTCTCCCGATGG - Intronic
1160871994 19:1281909-1281931 AGGCCCCAGACCTCTCCCCACGG - Intergenic
1160940960 19:1620264-1620286 AGTCCTCATCTCTGCCCCCATGG - Intronic
1163327325 19:16613499-16613521 AGTCCCCAGCTCTCTACCCAAGG + Intronic
1163996451 19:21052932-21052954 AGTGCACAGGTCCCTCCCCCTGG + Intronic
1165638613 19:37364808-37364830 AATCCTCCTGTCTCACCCCATGG - Intronic
1166333876 19:42093882-42093904 TCTCCTCAGGTCACACCCCAAGG - Exonic
1167298403 19:48664819-48664841 AGTCCTCAGCTTTCTTCCCATGG + Intronic
1168253052 19:55151789-55151811 ATTCCTCAGGGCCCTCCTCAGGG + Exonic
925218368 2:2116853-2116875 AGTGCTCAGGTCTGGCCCCCGGG - Intronic
925429970 2:3782973-3782995 CGTGCTCAGGGCTCTCTCCAAGG + Intronic
925696297 2:6583453-6583475 AGTGCGCAGGTCCCTTCCCAGGG + Intergenic
927146679 2:20170799-20170821 AGTCCCCAGGGCACTGCCCACGG - Intergenic
929465615 2:42141258-42141280 AGTCCTCTGGCCCCTCTCCAGGG - Intergenic
931914219 2:66935267-66935289 AGTCTTCATAGCTCTCCCCAAGG - Intergenic
932744111 2:74317533-74317555 AATCCTCAGGTCTCTCCTCTAGG + Intronic
933243230 2:79946148-79946170 GGGCCTCAGTTCTCTCCCCTGGG - Intronic
933441609 2:82321694-82321716 AGTCCTCATCTTTCTCCCCATGG - Intergenic
937347724 2:121136952-121136974 TGTCCTCACGGCTCTCCTCAAGG - Intergenic
937632344 2:124117194-124117216 AGACCTCAGGTTTCTGCCCTAGG - Intronic
938606416 2:132897613-132897635 ACTCATGATGTCTCTCCCCAAGG - Intronic
940757608 2:157700521-157700543 AGTTCTCTTGTATCTCCCCAAGG - Intergenic
944428099 2:199604255-199604277 AGTCCTCAGGCCTCTCTCACTGG + Intergenic
946382384 2:219358125-219358147 AGTCCTGAAGTCCCTCCTCACGG - Intergenic
946860828 2:223998969-223998991 AGTCCTCAGTTCTATAGCCAAGG + Intronic
947181031 2:227411601-227411623 AATCCCCAGGTCTCTCTCAATGG - Intergenic
948226907 2:236318317-236318339 GGGCCTCAGGCCTCTTCCCAGGG - Intergenic
948280943 2:236747671-236747693 AGCACTCAGGCCTGTCCCCAGGG - Intergenic
948694421 2:239725996-239726018 AATGCTCAGCTCTCACCCCAGGG - Intergenic
948794021 2:240392988-240393010 GGTCCTTGGGTCTGTCCCCAGGG + Intergenic
1170984365 20:21244422-21244444 AGCCCTCAGGTTCCACCCCAGGG - Intronic
1172032881 20:31994109-31994131 AGTGCCCAGCTCTCACCCCAGGG - Intronic
1173309353 20:41883117-41883139 TGTCCTGAGCTCTGTCCCCATGG + Intergenic
1173825320 20:46044402-46044424 AGTCCTTAGGGATCTTCCCAGGG + Intronic
1174461674 20:50687403-50687425 AGTCCTCAGTCCTCTTCCAAAGG - Intronic
1175385152 20:58590076-58590098 AGGCCTCACGTGTCTCTCCAGGG - Intergenic
1175876111 20:62230969-62230991 GGCCATCTGGTCTCTCCCCAAGG + Intergenic
1176655847 21:9588537-9588559 AGCCCTCTGGCCTGTCCCCAGGG + Intergenic
1178857359 21:36261512-36261534 ATTCCGCAGGTTTTTCCCCATGG + Intronic
1178919309 21:36728334-36728356 AGCCCTCAGGTCTCTCCTCTGGG - Intronic
1178940596 21:36902040-36902062 ACTTCTCAGCCCTCTCCCCACGG - Intronic
1180309763 22:11159211-11159233 AGTCCCCAGGTTCCGCCCCACGG - Intergenic
1180548240 22:16521021-16521043 AGTCCCCAGGTTCCGCCCCACGG - Intergenic
1181030811 22:20148189-20148211 GGTCCTCAGGTCTTGCCCCCTGG - Intergenic
1181146699 22:20853552-20853574 AGTCCTCAGCCCTCTCCCTCTGG - Intronic
1181512510 22:23395195-23395217 AGTCCTCAGGTCTTGCCCCCTGG + Intergenic
1182281253 22:29218904-29218926 TGTCGCCAGGTTTCTCCCCAGGG + Intronic
1184587854 22:45459802-45459824 AGTCCCCAGCACTCACCCCAGGG + Intergenic
1185099137 22:48828280-48828302 AGTCCCCAGTGCTCTCCCCAGGG - Intronic
1185281111 22:49970290-49970312 AGTCCCCAGGGCTCTGCTCAGGG - Intergenic
949656482 3:6226743-6226765 ATTCATTAGGTCTCACCCCAGGG - Intergenic
950117663 3:10461920-10461942 AGTCTTCACGTCCCTGCCCACGG + Intronic
950678616 3:14569560-14569582 TGTCTCCAGGTCTCTCCCCCAGG - Intergenic
952005250 3:28835981-28836003 ATTCCTCGGGCCTCTTCCCATGG - Intergenic
952083848 3:29794260-29794282 GTTCCTTAGCTCTCTCCCCAGGG + Intronic
953926913 3:46987279-46987301 AGGCCTCAGGCTGCTCCCCAGGG - Intronic
954117418 3:48474872-48474894 AGGCCTCAGGTCACTTCCCCAGG + Intronic
954457170 3:50606106-50606128 AGTCCACAGCTCTCTCTCCCTGG + Intergenic
954571368 3:51643746-51643768 AGTGCTCAGATCTCACCCCTTGG - Intronic
954750522 3:52810983-52811005 CGTCCTCAGGTGTCTCCAGAAGG + Intergenic
954897435 3:53988085-53988107 AGCCCACCGGTCTCTGCCCAGGG - Intergenic
955515036 3:59717988-59718010 AGTCATCAGCTCTCTGCTCATGG + Intergenic
955954150 3:64271105-64271127 ATTTCTCTGGTCTCTCCCTATGG - Intronic
959189896 3:103097690-103097712 TGGCCTCATGACTCTCCCCATGG + Intergenic
961115885 3:124329758-124329780 AGTCCTGATGTTTCTTCCCAAGG + Intronic
961531054 3:127540701-127540723 AGACATCAAGTCTCTACCCAGGG - Intergenic
962471470 3:135712866-135712888 AGTGCCCAGGTCTACCCCCATGG + Intergenic
965092261 3:164179465-164179487 AGGCCTCAGCTGCCTCCCCACGG + Intergenic
965545052 3:169907659-169907681 AGCCCTGAGGTCATTCCCCAAGG + Intergenic
969650754 4:8466544-8466566 AGTCCTAAGGTAACTTCCCACGG - Intronic
969671099 4:8590851-8590873 AGTCTACTGGCCTCTCCCCAGGG + Intronic
970110882 4:12636862-12636884 ATTCCTCAGGTGTATACCCAGGG + Intergenic
971115375 4:23640274-23640296 TGTCCTCAAGGCTCTTCCCAGGG + Intergenic
971428151 4:26536168-26536190 AGTCTTCATGTTCCTCCCCAGGG + Intergenic
973041788 4:45477492-45477514 AGGCCTCAGCTGCCTCCCCACGG - Intergenic
976226263 4:82797832-82797854 TGTCCTCATCTCTGTCCCCAAGG + Intronic
976255231 4:83093190-83093212 AGTCCGCAGGTCGCTTCCCAGGG - Exonic
979487289 4:121283639-121283661 AGTCTCCAGGTATCTTCCCATGG + Intergenic
979716300 4:123842909-123842931 AGCCTTCAGGTCTCACCCAAGGG + Intergenic
980701797 4:136442021-136442043 CGTCCTCATGTCGGTCCCCAGGG - Intergenic
982128596 4:152206231-152206253 ATTCCTCAGGTGTTTCACCAAGG - Intergenic
985891141 5:2715974-2715996 TGACCTCCGGGCTCTCCCCAGGG - Intergenic
986651086 5:9964090-9964112 AGTGCTCACCTCTCACCCCAGGG - Intergenic
989856658 5:46303769-46303791 AGGCCTCAGTGCTCTCCCAAAGG + Intergenic
992405490 5:76453618-76453640 AGTCCTCTGGGCTGTTCCCAAGG - Intronic
992941183 5:81763626-81763648 AGTCCTCCAGTAGCTCCCCAAGG - Intergenic
993875904 5:93306382-93306404 ATTCCTCCGATCTCTCCCCATGG + Intergenic
994107076 5:95960756-95960778 AGTCCTCAGGTCTCTCCCCAGGG + Intronic
994787878 5:104187261-104187283 AGTCATCCGGTGTCTCCACAAGG - Intergenic
997212418 5:132085287-132085309 AGTACCCAGGTCTCTCCACTTGG - Intergenic
998208341 5:140175364-140175386 AGTTCTCAGGGCGCTCCCCAGGG - Intronic
998640976 5:144010829-144010851 TGTCCTCAATCCTCTCCCCAGGG + Intergenic
999721610 5:154402754-154402776 AGGCCTCAGCTCTCACCGCATGG + Intronic
1001673506 5:173493400-173493422 AGTCCTCAGGTGCCTTCCAAAGG - Intergenic
1002021801 5:176368399-176368421 AGTCTTCAGTTCTCTCCCCTGGG - Intronic
1005959974 6:30687433-30687455 GGTCCTCCGCTCTGTCCCCAGGG + Exonic
1007224401 6:40302804-40302826 TGGCCTCAGGCCTGTCCCCAAGG + Intergenic
1007963529 6:45983149-45983171 AATCCTCAGACCTCTGCCCAGGG + Intronic
1012593592 6:101014121-101014143 AGTCTTCATGTCTCTCTACAAGG + Intergenic
1013355073 6:109339398-109339420 GGTCCTTGAGTCTCTCCCCAGGG + Intergenic
1013768181 6:113597294-113597316 AGTCCCCATGTCTCTCCAGATGG - Intergenic
1017630317 6:156390715-156390737 AGAGCTTAGGTCTCTGCCCAAGG - Intergenic
1017914182 6:158819095-158819117 TCCCCTCAGGTCTCTCCCGAAGG - Intronic
1019517691 7:1447017-1447039 GGGCCTCAGCTCTCTCCCCAGGG - Intronic
1020452551 7:8336451-8336473 GATCCTCAGATCTCTCACCAGGG + Intergenic
1024470065 7:49759778-49759800 AGATGTCAGGTCTCTCCCAATGG + Intergenic
1024883180 7:54112336-54112358 AGTCCTCAGAGCTCTTCACAGGG + Intergenic
1026359999 7:69594962-69594984 AGTCATCAGCTCTCTCTCAAGGG + Intergenic
1026494394 7:70890036-70890058 AGAGCTCAGGTCTCCACCCAAGG - Intergenic
1026774247 7:73221190-73221212 AGTCCTCCCATCTGTCCCCAAGG + Intergenic
1027015104 7:74774576-74774598 AGTCCTCCCATCTGTCCCCAAGG + Intronic
1027072927 7:75171377-75171399 AGTCCTCCCATCTGTCCCCAAGG - Intergenic
1027657287 7:80946043-80946065 ATTCCTCAGGGCTCTCTCCTAGG - Intergenic
1027749688 7:82127163-82127185 AGTCCTGATGGCTGTCCCCAGGG + Intronic
1029184191 7:98726993-98727015 TGTCCTCAGGGCCCTCACCATGG + Intergenic
1031232255 7:119123348-119123370 TGTCCTCAGGCCTGTGCCCACGG + Intergenic
1031973913 7:128082101-128082123 AAACCCCAGGTCTCTGCCCAGGG - Intronic
1032780569 7:135162254-135162276 AGCCTTCAGGTCCCTTCCCAGGG + Intronic
1033028539 7:137801827-137801849 AGCCCTCAGCTCTCTCTCCTTGG + Intronic
1033031194 7:137828748-137828770 CTTCCTAAGGTCTCTCCCCTAGG + Intronic
1033477010 7:141701698-141701720 AGTCCTCAGCTCTCTCCCTCGGG - Intronic
1034875864 7:154724377-154724399 AGACCTCAGGTCACTTCCCATGG + Intronic
1039116456 8:34096485-34096507 AGGCCTCAGGTGTCTCATCAGGG - Intergenic
1041979285 8:63837270-63837292 AGACCTGAAATCTCTCCCCAGGG - Intergenic
1043921682 8:85990378-85990400 AGTCCTCAGCAGTCTCCCCGCGG + Intronic
1044539791 8:93395556-93395578 AGTCTTCTGTTCTCTGCCCAGGG - Intergenic
1048981796 8:139706389-139706411 AGTCCACGGGTCTATTCCCACGG - Intergenic
1049159888 8:141090208-141090230 AGCCCCCAGGTCTCCCACCATGG - Intergenic
1049240713 8:141536168-141536190 AGTCCTGAGGCCTCTCTCCCTGG - Intergenic
1049470213 8:142771926-142771948 TGTCCCCAGGTCCCACCCCAGGG + Intronic
1050335411 9:4585291-4585313 ACTCCTCCCGTCTCTCCCCAGGG + Exonic
1051973193 9:22915871-22915893 AGGCCTCAGGATCCTCCCCAGGG - Intergenic
1052012308 9:23424890-23424912 AGTCCTCAGGCCTCAACCCCAGG + Intergenic
1052110235 9:24573591-24573613 AGTCCACATGTCTCACCACAGGG + Intergenic
1055764158 9:79643727-79643749 AGTGCCCAGGTATCACCCCATGG - Intronic
1056214414 9:84393878-84393900 AGTGCTGAGTCCTCTCCCCAAGG - Intergenic
1056699493 9:88890473-88890495 AATCCACAGGGCACTCCCCATGG - Intergenic
1061221931 9:129257237-129257259 AGTCCTCAGGTCCCTCTTAAAGG + Intergenic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1062399333 9:136365583-136365605 TGTCCCCAACTCTCTCCCCAGGG - Intronic
1203633564 Un_KI270750v1:91998-92020 AGCCCTCTGGCCTGTCCCCAGGG + Intergenic
1185547708 X:958798-958820 ATTCCTCAGGCGTCTTCCCATGG - Intergenic
1185708666 X:2284464-2284486 AGTCTTTAGGTCTCTGGCCAGGG + Intronic
1189082862 X:37992751-37992773 ATTCCTCCTGTCTCTCCACAGGG - Intronic
1192430413 X:71107801-71107823 AGGCCCCAGGCCCCTCCCCAAGG + Exonic
1193447553 X:81622323-81622345 AATCTTCAGGTCTCTCACCATGG + Intergenic
1195292651 X:103444145-103444167 AGTGCTCAGGTCTCTACTCCTGG + Intergenic
1196756248 X:119159917-119159939 GGTCCTTATGTCTTTCCCCACGG - Intergenic
1197949499 X:131878865-131878887 TGTCTTCTGGTCTCTCCCAAAGG + Intergenic
1200057223 X:153468058-153468080 CTTCCTCAGGCCTCTCCCCAGGG - Intronic
1200150182 X:153947450-153947472 AGAGCTCAGGTCTCCCTCCAGGG + Intergenic