ID: 994109771

View in Genome Browser
Species Human (GRCh38)
Location 5:95988136-95988158
Sequence AGCAAAAATGTCTCCACACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994109771_994109775 29 Left 994109771 5:95988136-95988158 CCTTGTGTGGAGACATTTTTGCT No data
Right 994109775 5:95988188-95988210 CTAGAAGTAAACAAGCAAGTGGG No data
994109771_994109774 28 Left 994109771 5:95988136-95988158 CCTTGTGTGGAGACATTTTTGCT No data
Right 994109774 5:95988187-95988209 CCTAGAAGTAAACAAGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994109771 Original CRISPR AGCAAAAATGTCTCCACACA AGG (reversed) Intergenic
No off target data available for this crispr