ID: 994117434

View in Genome Browser
Species Human (GRCh38)
Location 5:96076447-96076469
Sequence CTTCATAACCCTAAGGGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994117430_994117434 -1 Left 994117430 5:96076425-96076447 CCTTCTGAACTAACAGGTACTTC No data
Right 994117434 5:96076447-96076469 CTTCATAACCCTAAGGGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994117434 Original CRISPR CTTCATAACCCTAAGGGGCT CGG Intergenic
No off target data available for this crispr