ID: 994117985

View in Genome Browser
Species Human (GRCh38)
Location 5:96082240-96082262
Sequence CCTCTGTGTCAGCACTTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994117985_994117990 22 Left 994117985 5:96082240-96082262 CCTTGCAAGTGCTGACACAGAGG No data
Right 994117990 5:96082285-96082307 ATGAGTAAATGGACATTTATTGG No data
994117985_994117989 11 Left 994117985 5:96082240-96082262 CCTTGCAAGTGCTGACACAGAGG No data
Right 994117989 5:96082274-96082296 AAGCTTTTTAAATGAGTAAATGG No data
994117985_994117991 26 Left 994117985 5:96082240-96082262 CCTTGCAAGTGCTGACACAGAGG No data
Right 994117991 5:96082289-96082311 GTAAATGGACATTTATTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994117985 Original CRISPR CCTCTGTGTCAGCACTTGCA AGG (reversed) Intergenic
No off target data available for this crispr