ID: 994119317

View in Genome Browser
Species Human (GRCh38)
Location 5:96096133-96096155
Sequence TCCTTTTAGGGCAGCTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994119317_994119324 30 Left 994119317 5:96096133-96096155 CCTCTGAAGCTGCCCTAAAAGGA No data
Right 994119324 5:96096186-96096208 CAGGGAACCTCCATGTATACTGG No data
994119317_994119322 12 Left 994119317 5:96096133-96096155 CCTCTGAAGCTGCCCTAAAAGGA No data
Right 994119322 5:96096168-96096190 TTTTTGCCATTTACTGTGCAGGG No data
994119317_994119321 11 Left 994119317 5:96096133-96096155 CCTCTGAAGCTGCCCTAAAAGGA No data
Right 994119321 5:96096167-96096189 CTTTTTGCCATTTACTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994119317 Original CRISPR TCCTTTTAGGGCAGCTTCAG AGG (reversed) Intergenic
No off target data available for this crispr