ID: 994121880

View in Genome Browser
Species Human (GRCh38)
Location 5:96123609-96123631
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994121876_994121880 28 Left 994121876 5:96123558-96123580 CCTGATGGAAAAGTCAACTCAGG No data
Right 994121880 5:96123609-96123631 TAGATTAGCAAAACAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr