ID: 994124337

View in Genome Browser
Species Human (GRCh38)
Location 5:96152576-96152598
Sequence TATGCAGAACCAACCCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994124335_994124337 24 Left 994124335 5:96152529-96152551 CCGGCTGGGAGACTGAACTGGTA No data
Right 994124337 5:96152576-96152598 TATGCAGAACCAACCCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994124337 Original CRISPR TATGCAGAACCAACCCAAGG AGG Intergenic
No off target data available for this crispr