ID: 994127704

View in Genome Browser
Species Human (GRCh38)
Location 5:96187706-96187728
Sequence CTGAGTGCCCACTTTGTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994127704_994127705 13 Left 994127704 5:96187706-96187728 CCTTGCACAAAGTGGGCACTCAG No data
Right 994127705 5:96187742-96187764 AGTAAATAGTTCAATAGTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994127704 Original CRISPR CTGAGTGCCCACTTTGTGCA AGG (reversed) Intergenic
No off target data available for this crispr