ID: 994128028

View in Genome Browser
Species Human (GRCh38)
Location 5:96191574-96191596
Sequence CTGTGAGGATATAATAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994128024_994128028 23 Left 994128024 5:96191528-96191550 CCTCTCTGCTACATTGCTTCCCA No data
Right 994128028 5:96191574-96191596 CTGTGAGGATATAATAAAGATGG No data
994128025_994128028 4 Left 994128025 5:96191547-96191569 CCCATAATTATGTCACTAGCAAA No data
Right 994128028 5:96191574-96191596 CTGTGAGGATATAATAAAGATGG No data
994128026_994128028 3 Left 994128026 5:96191548-96191570 CCATAATTATGTCACTAGCAAAT No data
Right 994128028 5:96191574-96191596 CTGTGAGGATATAATAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994128028 Original CRISPR CTGTGAGGATATAATAAAGA TGG Intergenic
No off target data available for this crispr