ID: 994138407

View in Genome Browser
Species Human (GRCh38)
Location 5:96315510-96315532
Sequence CTCTTTCTGATCTCAGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994138407_994138411 9 Left 994138407 5:96315510-96315532 CCAGAAACTGAGATCAGAAAGAG No data
Right 994138411 5:96315542-96315564 TGGTGAAGTCACTGACCATATGG No data
994138407_994138415 28 Left 994138407 5:96315510-96315532 CCAGAAACTGAGATCAGAAAGAG No data
Right 994138415 5:96315561-96315583 ATGGTCATTTGGGTCAAAGATGG No data
994138407_994138413 18 Left 994138407 5:96315510-96315532 CCAGAAACTGAGATCAGAAAGAG No data
Right 994138413 5:96315551-96315573 CACTGACCATATGGTCATTTGGG No data
994138407_994138412 17 Left 994138407 5:96315510-96315532 CCAGAAACTGAGATCAGAAAGAG No data
Right 994138412 5:96315550-96315572 TCACTGACCATATGGTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994138407 Original CRISPR CTCTTTCTGATCTCAGTTTC TGG (reversed) Intergenic
No off target data available for this crispr