ID: 994141262

View in Genome Browser
Species Human (GRCh38)
Location 5:96344110-96344132
Sequence TTATGTCAAATCTACATTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994141259_994141262 1 Left 994141259 5:96344086-96344108 CCTGCCTTTGTCAGGCTGGCAGC No data
Right 994141262 5:96344110-96344132 TTATGTCAAATCTACATTTTGGG No data
994141254_994141262 29 Left 994141254 5:96344058-96344080 CCCTTGTGACCTTGATAGAACTA No data
Right 994141262 5:96344110-96344132 TTATGTCAAATCTACATTTTGGG No data
994141256_994141262 20 Left 994141256 5:96344067-96344089 CCTTGATAGAACTAATAGTCCTG No data
Right 994141262 5:96344110-96344132 TTATGTCAAATCTACATTTTGGG No data
994141260_994141262 -3 Left 994141260 5:96344090-96344112 CCTTTGTCAGGCTGGCAGCTTTA No data
Right 994141262 5:96344110-96344132 TTATGTCAAATCTACATTTTGGG No data
994141255_994141262 28 Left 994141255 5:96344059-96344081 CCTTGTGACCTTGATAGAACTAA No data
Right 994141262 5:96344110-96344132 TTATGTCAAATCTACATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994141262 Original CRISPR TTATGTCAAATCTACATTTT GGG Intergenic
No off target data available for this crispr