ID: 994141759

View in Genome Browser
Species Human (GRCh38)
Location 5:96348914-96348936
Sequence AATTATGAGCAGAAAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994141758_994141759 -3 Left 994141758 5:96348894-96348916 CCACATGGGAAGTTAGGGTTAAT No data
Right 994141759 5:96348914-96348936 AATTATGAGCAGAAAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994141759 Original CRISPR AATTATGAGCAGAAAGTGCA AGG Intergenic
No off target data available for this crispr