ID: 994144893

View in Genome Browser
Species Human (GRCh38)
Location 5:96383826-96383848
Sequence CTATTGCAACAGAGTGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994144893_994144894 -5 Left 994144893 5:96383826-96383848 CCAGGGGCACTCTGTTGCAATAG No data
Right 994144894 5:96383844-96383866 AATAGCAATGTGAAAGAAGATGG No data
994144893_994144897 13 Left 994144893 5:96383826-96383848 CCAGGGGCACTCTGTTGCAATAG No data
Right 994144897 5:96383862-96383884 GATGGCAGTGTGGACCAGGATGG No data
994144893_994144895 3 Left 994144893 5:96383826-96383848 CCAGGGGCACTCTGTTGCAATAG No data
Right 994144895 5:96383852-96383874 TGTGAAAGAAGATGGCAGTGTGG No data
994144893_994144896 9 Left 994144893 5:96383826-96383848 CCAGGGGCACTCTGTTGCAATAG No data
Right 994144896 5:96383858-96383880 AGAAGATGGCAGTGTGGACCAGG No data
994144893_994144898 22 Left 994144893 5:96383826-96383848 CCAGGGGCACTCTGTTGCAATAG No data
Right 994144898 5:96383871-96383893 GTGGACCAGGATGGTAGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994144893 Original CRISPR CTATTGCAACAGAGTGCCCC TGG (reversed) Intergenic
No off target data available for this crispr