ID: 994145624

View in Genome Browser
Species Human (GRCh38)
Location 5:96391877-96391899
Sequence AATCAGAAGCAGAAACTGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 366}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994145624_994145628 9 Left 994145624 5:96391877-96391899 CCTGCCAGTTTCTGCTTCTGATT 0: 1
1: 0
2: 2
3: 33
4: 366
Right 994145628 5:96391909-96391931 GGAGCAATTTGGTGAGAATTTGG 0: 1
1: 0
2: 3
3: 18
4: 172
994145624_994145629 26 Left 994145624 5:96391877-96391899 CCTGCCAGTTTCTGCTTCTGATT 0: 1
1: 0
2: 2
3: 33
4: 366
Right 994145629 5:96391926-96391948 ATTTGGACACTATCAGTGATAGG 0: 1
1: 0
2: 0
3: 8
4: 111
994145624_994145627 -2 Left 994145624 5:96391877-96391899 CCTGCCAGTTTCTGCTTCTGATT 0: 1
1: 0
2: 2
3: 33
4: 366
Right 994145627 5:96391898-96391920 TTTGAAGCTTAGGAGCAATTTGG 0: 1
1: 0
2: 4
3: 42
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994145624 Original CRISPR AATCAGAAGCAGAAACTGGC AGG (reversed) Exonic
901598012 1:10400112-10400134 AATCAAATCCAGGAACTGGCCGG - Intronic
902274956 1:15332810-15332832 AGTCAGGAGAAGAAAATGGCTGG - Intronic
903437245 1:23359841-23359863 AAGCAGCAGCAGGAACTGGTTGG + Exonic
903479335 1:23641704-23641726 AGACAGAAGCAGAGACTGGAGGG - Intergenic
905203785 1:36331197-36331219 AATCAGATTCAGAAGCTGGGTGG - Intergenic
908170602 1:61500915-61500937 GATCAGAAGCAGAAGTTGGAGGG - Intergenic
908741632 1:67334773-67334795 AATCAAAAGAAGAATCCGGCCGG - Intronic
911706631 1:101021277-101021299 AATTATCAGCAGAAAATGGCAGG + Intronic
912018622 1:105073933-105073955 AATCAAAAGCAGAAAATAGGGGG + Intergenic
912583242 1:110738457-110738479 AACCAGAAGCAGAAGCTGTGAGG + Intergenic
914827660 1:151146915-151146937 ATACAGAAGCAGAGACAGGCTGG + Intergenic
915408270 1:155679295-155679317 CATCAGTAACAGAAGCTGGCTGG + Intronic
917137337 1:171800324-171800346 AATCAGATACAGACACTGGGTGG + Intronic
920072600 1:203313266-203313288 AATCAAAAGCTGAAAAAGGCTGG - Intergenic
920966631 1:210706530-210706552 AATTAGAACCACAAACTGTCAGG + Intronic
922408335 1:225342375-225342397 AATCAAAATCAGAAAGTGGAAGG + Intronic
922818179 1:228465995-228466017 ATTCACAAGCAGATACTGACTGG - Intergenic
924170326 1:241332720-241332742 AACCAAAAGCAGAAACTTACTGG + Intronic
924430463 1:243992091-243992113 AATGAAATCCAGAAACTGGCTGG + Intergenic
924597624 1:245461246-245461268 AAGCAGAAGCAGAATCAGTCTGG - Intronic
924680363 1:246224879-246224901 AAACAGAAGCAGAAAAAGGAAGG + Intronic
924888849 1:248252223-248252245 AATCAGAAACAGAAAGTGTTGGG - Intergenic
1062882979 10:993570-993592 AAGCAAGAGCAGAAACTGCCTGG + Intronic
1063100428 10:2945446-2945468 AATCACATGCAGAGGCTGGCTGG - Intergenic
1063182912 10:3622115-3622137 AAGCAGAAGCAAATACAGGCAGG + Intergenic
1063596385 10:7439652-7439674 AATGAGAAGGAGAAACTGCAAGG - Intergenic
1063989696 10:11546753-11546775 AATCAGAAGCTTAAACTGCCTGG + Intronic
1065266191 10:23978544-23978566 AAGCAGACCCAGAAACTGACAGG - Intronic
1067022223 10:42811337-42811359 AATAAGGGGCAGAAATTGGCCGG - Intronic
1067272070 10:44800851-44800873 AAGCAGAAACAGAAATTGACAGG + Intergenic
1067554235 10:47256945-47256967 ACTGAGAAGCAGACACTGCCTGG + Intergenic
1067728720 10:48793408-48793430 AATCAGAAGGAGAAGCTGCGTGG + Intronic
1068208193 10:53884713-53884735 AAGCAGAAGACAAAACTGGCAGG + Intronic
1070485454 10:76926285-76926307 AATTAGAAACAGAAAGAGGCAGG - Intronic
1070591202 10:77802467-77802489 AATCAGAAGCACAAAACTGCAGG + Intronic
1070737071 10:78870460-78870482 AATAAGAAGGAGAATCTGGGAGG + Intergenic
1071431231 10:85608678-85608700 GATCTGAAGCAGAGACAGGCAGG + Intronic
1073552189 10:104414023-104414045 GATCAGAAACAGCAACTGGTAGG + Intronic
1075050248 10:119178280-119178302 AAACAGCAGCAGAAACACGCGGG + Intronic
1075813265 10:125244477-125244499 AAAAAGAAGCAAAACCTGGCCGG + Intergenic
1075923948 10:126235687-126235709 AATCTGGAGCAGAAAGTGGGAGG - Intronic
1076293220 10:129363659-129363681 AAACAGAAGCAGAACCAGTCAGG - Intergenic
1076333114 10:129686146-129686168 CAGCAGAAACAGAAACTGGAGGG + Intronic
1077355440 11:2114669-2114691 AATCACAAGCAGAGAGTGGCGGG + Intergenic
1077573275 11:3356935-3356957 AATCAGAATCAGAAGCTGGGTGG + Intronic
1078130822 11:8612761-8612783 AACCAGGAGGAGAACCTGGCAGG - Exonic
1078279118 11:9881824-9881846 AATAAGAAGAAGAAATAGGCTGG + Intronic
1078369622 11:10734197-10734219 TATAAGAAACAGAAAATGGCCGG + Intergenic
1078497297 11:11831194-11831216 AATAAGAAAAAGAAACTTGCAGG - Intergenic
1078822692 11:14897873-14897895 GATAAGAAGCATAAACTGGAGGG - Intergenic
1079720913 11:23812874-23812896 AAACAGAATTAAAAACTGGCTGG + Intergenic
1080321717 11:31017741-31017763 AATCAAAACCAAAAACTAGCTGG - Intronic
1082811575 11:57482157-57482179 AAACCGAAGCAGACACTTGCAGG + Intergenic
1083967419 11:66051348-66051370 AGACAGAGGCAGAGACTGGCAGG - Intronic
1084743903 11:71155551-71155573 TAACTGAAGCAGAACCTGGCAGG + Intronic
1085312526 11:75525102-75525124 AAGCAGAGGCTGGAACTGGCTGG - Intronic
1087000549 11:93415622-93415644 AAGCAGAAGTAGAGACTGGAAGG - Intronic
1087365838 11:97217672-97217694 ACCCAGGAGCAGAAACTAGCAGG - Intergenic
1088621499 11:111689074-111689096 AAACAGAAGCAGAATGTTGCAGG + Intronic
1088743636 11:112786648-112786670 AAGGAAAAGCAGAGACTGGCTGG + Intergenic
1088838648 11:113603410-113603432 AGTCAGAAGCAGAGATTGGAGGG + Intergenic
1089536307 11:119162478-119162500 AATCAGAAGCAGAATGAGCCTGG - Exonic
1089636751 11:119819203-119819225 AAGCAGTAGGAGAAATTGGCAGG + Intergenic
1090973130 11:131659929-131659951 AAGAAGAAGAAGACACTGGCAGG + Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1092228628 12:6764916-6764938 AGTCAGAAAGAGAAACTGGGAGG + Intronic
1092239443 12:6828175-6828197 AATAAGAGGGAGAAACTGGGAGG - Intronic
1093079555 12:14793789-14793811 AATCAGATGGAGAAAGTGACGGG - Exonic
1093117753 12:15232993-15233015 AAGTAGAAGCAAAAACTGGTAGG + Intronic
1093227028 12:16497249-16497271 AATAAGAAACAGAAATTGACAGG + Intronic
1094241883 12:28237585-28237607 TATCAGAAGCTGGAACAGGCAGG + Intronic
1095406532 12:41872466-41872488 AATCAAAAGCAAAAAAAGGCAGG + Intergenic
1095582941 12:43820803-43820825 TATAAGAAGCATAAAGTGGCCGG + Intergenic
1096692977 12:53332597-53332619 AAAAAGAAGCAGAAATAGGCAGG + Intronic
1096752355 12:53769139-53769161 AATCAGAAGCAGACTGTGGGGGG - Intergenic
1100493774 12:95105725-95105747 AATCAAATGCATAAACAGGCAGG + Intronic
1100760476 12:97801332-97801354 AATCAATAGAAGAAACTGGGTGG + Intergenic
1103386057 12:120533709-120533731 AATAAGAACCATAAATTGGCCGG + Intronic
1103540905 12:121665790-121665812 AAACAGTAGCAGAAAATGCCAGG - Intronic
1103876367 12:124130594-124130616 AATAAGAAGCAAATTCTGGCCGG - Intronic
1104150761 12:126080440-126080462 AATAAGAAACAGAAGCTGTCAGG - Intergenic
1105646055 13:22318614-22318636 AGTTAGAAGAAGACACTGGCAGG - Intergenic
1106158458 13:27179085-27179107 GTTCAGAATCACAAACTGGCTGG - Intergenic
1106466636 13:30019737-30019759 AATCAGGAGCAGACACAGGCAGG + Intergenic
1106886445 13:34190125-34190147 GAACAGAAGCTGAAACTGGGAGG - Intergenic
1107383263 13:39879184-39879206 AAGCACAAGCACAAACTGCCGGG + Intergenic
1107658498 13:42615579-42615601 TATAAGAAGCAAAAACAGGCTGG - Intergenic
1108266531 13:48714410-48714432 GAACAAAAGCAGAAACTTGCGGG - Intergenic
1108446064 13:50510251-50510273 CATGAGAAGCAGAGACAGGCTGG - Intronic
1108695063 13:52895916-52895938 AAGGAGGAGCAGAAGCTGGCTGG - Intergenic
1109327873 13:60891389-60891411 AATAAGAATCAGAAACTAGAGGG - Intergenic
1109862160 13:68214143-68214165 AATAAGAAGCTGAACCTGTCAGG + Intergenic
1111184833 13:84720290-84720312 AGACAGCAGCAGACACTGGCAGG + Intergenic
1111331432 13:86764550-86764572 AATCAGAATCAGAAGCTGGGTGG + Intergenic
1111575689 13:90151600-90151622 AATCAGTAGCAGAGTCTGGGAGG - Intergenic
1112496759 13:99911400-99911422 AATCAGAGGGAGAAACAGGGAGG - Intergenic
1112770024 13:102784839-102784861 ACTCAGTGGAAGAAACTGGCTGG + Intronic
1112773786 13:102822142-102822164 AAACAGCAGGAGAAACTGGTAGG + Exonic
1116535506 14:46023655-46023677 TAACAAAAGCAGAAATTGGCAGG + Intergenic
1116612807 14:47099535-47099557 AATATGAAGAAAAAACTGGCAGG - Intronic
1117162517 14:53003205-53003227 CATCAGAAATAGACACTGGCTGG + Intergenic
1117564711 14:56981341-56981363 AGTCAGAAGAAGAAAGTTGCTGG - Intergenic
1117872085 14:60211682-60211704 GATAAGAACCAAAAACTGGCAGG - Intergenic
1118213814 14:63789483-63789505 TATCAGAAGTAGAATCTGGCCGG + Intergenic
1119396036 14:74326998-74327020 AATCAGGAGCACAAAGTGACAGG - Intronic
1119531844 14:75367245-75367267 AATGAGACGCAATAACTGGCAGG + Intergenic
1121928099 14:97947587-97947609 AAACACAAGCAGAACTTGGCTGG - Intronic
1121972831 14:98374544-98374566 AATCAGATGCAGGACCTGCCTGG + Intergenic
1122643655 14:103177346-103177368 AATCTGAAGCAGAAAGGAGCTGG + Intergenic
1122817789 14:104322043-104322065 AGTCAGGAGCAGAGACAGGCAGG - Intergenic
1123113798 14:105884836-105884858 AACCAGCAGCAAAAACTGACCGG - Intergenic
1123116026 14:105894474-105894496 AACTAGCAGCAAAAACTGGCCGG - Intergenic
1202933000 14_KI270725v1_random:56571-56593 ATTAAGAAGCAGAACTTGGCCGG + Intergenic
1124011786 15:25844921-25844943 AATCAGAAGCACACAGTGACTGG - Intronic
1124415357 15:29469168-29469190 AAAAAGAAGCAGAATCTTGCAGG - Intronic
1125713238 15:41804134-41804156 AAAAATAAGCAGAAAGTGGCCGG - Intronic
1125774783 15:42202666-42202688 AAAGAAAAGCAGGAACTGGCAGG - Intronic
1128129076 15:65213619-65213641 TATCAGAATCAGAAACAGCCAGG - Intergenic
1128215756 15:65933092-65933114 AGACAGAAGCAGAAAAGGGCTGG - Intronic
1130898353 15:88188202-88188224 AATCAGAAACAGAGAGTGGAGGG + Intronic
1131225315 15:90620074-90620096 TGTCAGAAGCAGAAACGTGCAGG + Intronic
1133623466 16:7548671-7548693 GAACAGCAGCCGAAACTGGCTGG - Intronic
1134153471 16:11823326-11823348 AATAAAAAGAAGAAAATGGCTGG + Intergenic
1134157775 16:11857779-11857801 AATCTGAAGCAGAAATTAGAAGG - Intergenic
1135845262 16:25912939-25912961 AATCAGAATCACAAAGTGGAGGG + Intronic
1135856425 16:26015333-26015355 ATGCAGAAGCAGAATCTGGTGGG + Intronic
1136493056 16:30623413-30623435 AATAAGAAGGAGACAATGGCAGG + Intronic
1136672001 16:31866795-31866817 ATTCTGCAGCAGACACTGGCTGG + Intergenic
1137026037 16:35475842-35475864 AAACAGAAGAAGAAATTAGCTGG + Intergenic
1137667078 16:50257261-50257283 ACTCAGAAGCAGCAAGTGGAAGG + Intronic
1138080948 16:54090992-54091014 ATACAAAAGCAGAAACTGCCAGG + Intronic
1138153523 16:54681703-54681725 AAGCCCAATCAGAAACTGGCAGG - Intergenic
1140280061 16:73545755-73545777 AAACAGAGGCAGAAATTGGGTGG + Intergenic
1140401953 16:74678922-74678944 AATCAGAAGCTCAAACTTCCTGG - Exonic
1140647348 16:77047166-77047188 CATCAGAAGAAGAAAATGGAAGG + Intergenic
1140744800 16:77971989-77972011 AATCAGATGCAGACACGGGTGGG + Intronic
1142732672 17:1872019-1872041 AATCAGAAGAAAAAGCTGGGTGG - Intronic
1143803280 17:9403163-9403185 AATCAAAAGACGAAACTGACAGG + Intronic
1144831654 17:18135160-18135182 AATAAAAAACAGAAACAGGCTGG - Intronic
1144837662 17:18165476-18165498 GACCAGAAGCAGAGGCTGGCAGG - Intronic
1147780238 17:42935694-42935716 ATTAAGAAACAGAAACAGGCTGG - Intergenic
1149893110 17:60407799-60407821 AAAAAAAAGCAGAAACAGGCCGG + Intronic
1150475889 17:65474605-65474627 AATGAGATGCAGAAAATGACAGG + Intergenic
1150588876 17:66543830-66543852 TGTCAGAAGCAGAAAATGGGAGG + Intronic
1151380205 17:73720456-73720478 AAAGAGATGCAGACACTGGCAGG - Intergenic
1151514675 17:74585309-74585331 AATAAGAAGAAGATAATGGCAGG - Intronic
1152391894 17:80008409-80008431 AACCACAACCAGAAGCTGGCCGG - Intronic
1152424766 17:80212892-80212914 TATAAGAAGCGGAAACAGGCCGG + Intronic
1152460684 17:80440747-80440769 AATCAAAAGGAGAAGCTGGTGGG - Intergenic
1152664790 17:81561287-81561309 AAGCAGAAGAAGAAGCTGGGCGG - Intronic
1153286664 18:3462347-3462369 AACCAAAAGCATAAACTGGAGGG - Intergenic
1153596880 18:6735200-6735222 ACGCAGAAGCAGAAACTTTCTGG - Intronic
1158613561 18:58965540-58965562 AAGCAGAAGTAAAAACTGGATGG - Intronic
1159959325 18:74543191-74543213 AATCAGGAGCAGACAGGGGCCGG + Intronic
1160304984 18:77724227-77724249 AATGAGGAGCAGAAACGGACAGG + Intergenic
1161324502 19:3656918-3656940 AGTCATAAGCAGAAGCTGTCAGG + Intronic
1162172884 19:8805218-8805240 AATGAGAGGTAGAACCTGGCGGG + Intergenic
1162505125 19:11079164-11079186 AAATAAAAGCAGAATCTGGCTGG + Intergenic
1163203336 19:15783851-15783873 AAACAAAAACAAAAACTGGCCGG + Intergenic
1163320796 19:16573367-16573389 AATTAGAAGCAGCAACCGGCTGG + Intronic
1164393565 19:27845546-27845568 AATCAGAATCAGAAGTTGGGTGG + Intergenic
1164414938 19:28039131-28039153 TCTCTGAAGCTGAAACTGGCAGG + Intergenic
1164801381 19:31079649-31079671 AGTCAGAACCAGAAAGGGGCAGG - Intergenic
1165012585 19:32859622-32859644 AAGCAGAGGCAGAAAGTGCCAGG - Intronic
1165576347 19:36822834-36822856 AAACAAAAACAAAAACTGGCTGG - Intronic
1167643023 19:50692530-50692552 AAGCAGAAGCAGGAACAGGGTGG - Intronic
925652989 2:6111951-6111973 AGTAAGCAGCAGAAACTGGCAGG + Intergenic
925686900 2:6482188-6482210 ACACAGCTGCAGAAACTGGCCGG + Intergenic
925741241 2:7007667-7007689 CATCAGAGGCAGGAACAGGCAGG - Intronic
925927272 2:8679238-8679260 AATCAGAAGCAGCTCCGGGCCGG - Exonic
926938374 2:18109882-18109904 AAGCACAAGCACACACTGGCTGG - Intronic
927709338 2:25315141-25315163 AAGCAGAACCAGGAACTGGAAGG - Intronic
927823141 2:26286905-26286927 ATTTAAAAGCATAAACTGGCCGG + Intronic
928343704 2:30470025-30470047 AATCAGATGCAGATTCTTGCTGG - Intronic
929847436 2:45544449-45544471 AATCAGAGGCAGTAGGTGGCAGG + Intronic
930014932 2:46963815-46963837 ACTCAGAAGGAGAGACTGCCTGG + Intronic
931418834 2:62106798-62106820 AAGCAGAAGCAGAGACTGTGTGG + Intronic
931469538 2:62524587-62524609 AAACAGAAGCAGATACTTGAAGG + Intergenic
931984633 2:67729833-67729855 AGTCAGATGCTGAAACTGGCAGG - Intergenic
932136280 2:69231803-69231825 AACAGGAAGCAGAAACTGTCAGG + Intronic
933140919 2:78792353-78792375 AAACACCAGCAGACACTGGCAGG - Intergenic
933197860 2:79412780-79412802 ATTGAGAAGGAGAAACTGGATGG + Intronic
933907519 2:86909884-86909906 ACTCAGAGGCAGAAACATGCTGG - Intronic
933908765 2:86919576-86919598 ACTCAGAGGCAGAAACATGCTGG - Intronic
934023961 2:87983809-87983831 ACTCAGAGGCAGAAACATGCTGG + Intergenic
935037166 2:99389154-99389176 AATCAAAAGCATAATCTGTCTGG - Intronic
935783832 2:106531393-106531415 CATCAGACGCTGAAACGGGCAGG + Intergenic
936364613 2:111841523-111841545 ACTCAGAGGCAGAAACATGCTGG + Intronic
937020206 2:118643546-118643568 GAGCAGAAGCAGAAGCTGTCAGG + Intergenic
937278964 2:120704371-120704393 AATTAGAATCAGAAGCTGTCGGG + Intergenic
939461163 2:142496942-142496964 TATGAGAAGCAAAAACTGACAGG + Intergenic
940391978 2:153142818-153142840 AATCAAAAGCAGAAAACGGTAGG + Intergenic
941938628 2:171009228-171009250 AGTCAGAAGCAGAAACGAGAAGG + Intronic
943547478 2:189298674-189298696 TACCAGAAGGAGAAACTGGCTGG - Intergenic
945872395 2:215242165-215242187 AAACAGTACCAGGAACTGGCAGG - Intergenic
946648161 2:221862517-221862539 TATCTAAAGCAAAAACTGGCAGG - Intergenic
947196278 2:227571219-227571241 AATAACAGGCAGAAACTGGAGGG + Intergenic
947231194 2:227888389-227888411 AAGCAGAAGCAGGATCAGGCGGG + Intronic
948301357 2:236909570-236909592 AATCAGAAGCCGAGACTGGAGGG - Intergenic
1168956157 20:1835901-1835923 AAACAGAAGCAGAAACCAGAGGG + Intergenic
1169052001 20:2587206-2587228 AATGAGAAGAAGACAATGGCAGG - Intronic
1169463695 20:5819156-5819178 ATTAAGAAGTAGACACTGGCGGG - Intronic
1170622536 20:18007829-18007851 ATTCAGAAGCAGAAGCTGCCAGG + Intronic
1170924157 20:20707739-20707761 AAGCAGAAGCTGAGGCTGGCTGG - Intronic
1172204702 20:33154769-33154791 AAGCAGAAGCAGAGCCTGCCTGG - Intergenic
1172234316 20:33359735-33359757 CCTCAGAACCAGAAGCTGGCAGG - Intronic
1172354627 20:34270952-34270974 AAACAAAAGCAAGAACTGGCTGG - Intergenic
1173499206 20:43540123-43540145 AAGCAGAGGCAGAGGCTGGCAGG - Intronic
1174064345 20:47853719-47853741 TCTCAGAAGCAGGAACTGGGGGG + Intergenic
1174720263 20:52804040-52804062 AATGAGAAGCAGCAGCCGGCTGG + Intergenic
1175637488 20:60598069-60598091 AAGCAGAAGCAGAATCTTACAGG + Intergenic
1176170391 20:63693944-63693966 AAACAGAGGCAGAAACAGGGAGG - Intronic
1176521153 21:7825560-7825582 AGGCAGAAGCAGAAACGGCCAGG - Exonic
1178655173 21:34455572-34455594 AGGCAGAAGCAGAAACGGCCAGG - Intergenic
1178973775 21:37204707-37204729 TATCAGAAGGAGAAGCTGGGAGG + Intergenic
1179075767 21:38120332-38120354 AATCCGTAGGAGAAGCTGGCAGG + Exonic
1179095898 21:38314209-38314231 AAACACCAGCAGACACTGGCAGG + Intergenic
1179554813 21:42165764-42165786 TATCAAAAGCAGCAGCTGGCCGG + Intergenic
1179931366 21:44573098-44573120 AAACAGTACCACAAACTGGCTGG - Intronic
1181958285 22:26604233-26604255 ACTCAGAAGTAGAAAATGACTGG - Intronic
1182165884 22:28172508-28172530 AACCAGAAGCAGAAGATGCCAGG - Intronic
1182672084 22:32004886-32004908 ATTGAGAAGCAGACACTGGCTGG - Intergenic
1182774642 22:32821834-32821856 AATCAGAAGCAGGGAGTGGAAGG - Intronic
1182943387 22:34299755-34299777 AATCAGGATGAGCAACTGGCTGG - Intergenic
1182992724 22:34783362-34783384 ATTCAGTAGCAGAGCCTGGCTGG + Intergenic
1183666353 22:39248565-39248587 ACTCAGAAAGAGAAATTGGCAGG - Intergenic
949360914 3:3231291-3231313 AAGGTGAAGCAGAAGCTGGCAGG + Intergenic
949808005 3:7976600-7976622 AGACACAAGCAGACACTGGCGGG + Intergenic
951448763 3:22812733-22812755 ATTAAGAAACATAAACTGGCTGG - Intergenic
951752501 3:26053319-26053341 AATCAGAAAAAGAAACTAGAAGG - Intergenic
952975138 3:38687582-38687604 AATCAGAATCAGAAACTGGGTGG - Intergenic
953227214 3:41031591-41031613 AAGCAGAAGCACCAACTGGCTGG + Intergenic
953321511 3:41976579-41976601 ATTTAAAAGCAGAATCTGGCCGG + Intergenic
953991874 3:47490080-47490102 AATAAGAAGAAGACACTTGCTGG - Intergenic
954245370 3:49327239-49327261 AAAGAGAACCAGAAACAGGCTGG + Intronic
954553442 3:51500693-51500715 AAACAGAAACAAAAATTGGCTGG - Intergenic
955062031 3:55501161-55501183 AATCAAATGCAGAAACTGATTGG + Intergenic
955817138 3:62856059-62856081 CAACAGAAACAGAAACTAGCTGG + Intronic
955824955 3:62936019-62936041 AAGCAGAAGCAGAAACTCTCAGG - Intergenic
955902668 3:63774093-63774115 TATAAGAAGGAGAAACTGGCCGG + Intergenic
956801433 3:72762960-72762982 AATTAAAAGTAGAAACAGGCCGG - Intronic
959374443 3:105571184-105571206 AAACAGAAACAGAAACTGTGGGG - Intronic
959794473 3:110407726-110407748 AATAAGAAGAAGAAAGTGGGAGG - Intergenic
959972671 3:112423797-112423819 AATCTCAATCAGATACTGGCAGG - Intergenic
960513523 3:118578152-118578174 AATCAGCAGGGGAAACTGGCTGG + Intergenic
961726546 3:128934513-128934535 AAACAAAAGCAAAAACAGGCCGG - Intronic
961992279 3:131204870-131204892 AATCAGAAGCAGAATATTGATGG + Intronic
962208258 3:133453712-133453734 AAAAAGATGCAGAATCTGGCAGG + Intronic
964003767 3:151807056-151807078 AATCAGAGTCAGAAGCTGGGTGG - Intergenic
965193881 3:165568688-165568710 ACTCAGAAACAGAAAGTGGAAGG + Intergenic
967793132 3:193570534-193570556 AATCAGAAGGGGAAACTATCAGG + Intronic
967938173 3:194746019-194746041 AAACAGAAAGAGAAACTGGAAGG + Intergenic
968234275 3:197022587-197022609 AACCAGCAGCAGAGACGGGCCGG + Intronic
968766488 4:2473514-2473536 AATTAGAAGTAGAGCCTGGCCGG + Intronic
969438521 4:7202815-7202837 CATCAGAAGCAGAAGCTGGGAGG - Intronic
970377455 4:15473780-15473802 AATCTGAAGCCAAAACTGGCAGG + Intronic
970604403 4:17665899-17665921 ACTAAGAAGCAGCAACTGGGGGG - Intronic
970702007 4:18752632-18752654 CATCAGAATTAGAAACTGGTTGG + Intergenic
971365859 4:25976696-25976718 AATCACTAGTAGAAACTTGCTGG + Intergenic
972157485 4:36182194-36182216 AGTAAGATGCAGAAACTGGCCGG + Intronic
972234312 4:37112765-37112787 AATCAAAAACAAAAACAGGCCGG - Intergenic
972435160 4:39026628-39026650 AATAAGAAACAAAATCTGGCTGG + Intronic
972680349 4:41300297-41300319 CATCAAAAGCAAAAACAGGCCGG - Intergenic
973875838 4:55217555-55217577 ACTCAGAAGCAAAAACAGGAAGG - Intergenic
974392926 4:61296261-61296283 AATCAGAATCAGAACTTGACAGG + Intronic
975573596 4:75841436-75841458 AACCAGTAGCAGAAACTCTCAGG - Intergenic
976821889 4:89216071-89216093 AACTGGAAGCAGAAACTGCCAGG - Intergenic
976954025 4:90871985-90872007 AATGAAAAGCAGAAAATGGCAGG - Intronic
977687721 4:99868300-99868322 AATCAGAAGCAGATGCTGATTGG + Exonic
977858379 4:101924523-101924545 AAACAGAAGCAGAAAGGGTCAGG + Intronic
978478790 4:109163781-109163803 GATCAGAACCAGAAACCAGCAGG - Intronic
978801482 4:112759652-112759674 AATCAAAATCAGAAAATGGGAGG - Intergenic
981475854 4:145186105-145186127 TATCACAAGGAGGAACTGGCTGG + Intergenic
982070750 4:151692482-151692504 AATCAGAAGGAGAAAATGGCAGG + Intronic
982080195 4:151782101-151782123 AGTCAGAAAGAGAAGCTGGCTGG - Intergenic
983356680 4:166669366-166669388 GATGAGAAGCAGAAAGTGACTGG + Intergenic
985262983 4:188132004-188132026 ACTCAGAAGCAGAAAGTAGAAGG - Intergenic
985747031 5:1653516-1653538 GCTCAGATGCAGAAACAGGCTGG - Intergenic
986435915 5:7731066-7731088 AATAAAAAGTGGAAACTGGCAGG - Intronic
986658387 5:10037510-10037532 AAACAGAGGCAGAAATTGGAGGG + Intergenic
989512509 5:42304862-42304884 ACTCAGAAGTAGAAAATAGCTGG + Intergenic
990908547 5:60830117-60830139 AAACAGTATCAGAAACTGTCAGG + Intronic
992728918 5:79638435-79638457 AAGCAACAGCAGAAACTGCCAGG - Intronic
992825773 5:80548496-80548518 AATAATAAAAAGAAACTGGCAGG - Intergenic
994145624 5:96391877-96391899 AATCAGAAGCAGAAACTGGCAGG - Exonic
994244782 5:97467165-97467187 AATCACAGCCAGCAACTGGCAGG + Intergenic
996366598 5:122707937-122707959 AATCAGAAGTAAAAAAAGGCTGG - Intergenic
997512541 5:134463452-134463474 CACCAGAACCAGAACCTGGCAGG + Intergenic
997736595 5:136216824-136216846 AAGCAGAAGCAGACACAGCCGGG + Intronic
998335753 5:141370935-141370957 ATTCAGAAGGAGAACCTGGATGG + Exonic
999032889 5:148314159-148314181 AGTCAGAACCACAAACTGGTAGG - Exonic
999420383 5:151436845-151436867 AAACAGAAGCCCAAACTGACGGG + Intergenic
999680964 5:154059692-154059714 AATCAGAAGCAGTAAGTGCTAGG + Intronic
999868149 5:155724129-155724151 AATTTTAAGCAAAAACTGGCAGG - Intergenic
1000783553 5:165514233-165514255 ATTAAGAAGTGGAAACTGGCAGG - Intergenic
1001227646 5:169959094-169959116 TATAAAAAGCACAAACTGGCTGG + Intronic
1001294085 5:170486601-170486623 AACCAAATCCAGAAACTGGCAGG - Intronic
1001300810 5:170532346-170532368 AAGCACCAGCAGAAACTGCCTGG - Intronic
1001309273 5:170599090-170599112 AACCAGAGGCAGAGACTGGAAGG + Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003462257 6:6340476-6340498 AAACATAAGCAGAAATGGGCCGG - Intergenic
1003660430 6:8055820-8055842 GAACAGCAGCAGAAACTGGGAGG - Intronic
1003666227 6:8114169-8114191 CATAAGAAGCAGACAATGGCCGG - Intergenic
1003814445 6:9822278-9822300 AATCAGAAGCAGGACCTTGAAGG - Intronic
1004620385 6:17326055-17326077 AATCAGAGTCAGAAGCTGGGTGG + Intergenic
1004846949 6:19654257-19654279 AAAAAGAACCACAAACTGGCCGG - Intergenic
1005508417 6:26490572-26490594 AATAGGAAGCTGAAAATGGCTGG - Intergenic
1006529212 6:34635926-34635948 AATCTTAAGAAGAAACTGGAAGG + Intronic
1006704461 6:36006585-36006607 AAATATAAGTAGAAACTGGCAGG + Intronic
1007162538 6:39803595-39803617 TGTTAGAAGCAGAAACTGTCAGG + Intronic
1007405169 6:41631286-41631308 AACCAGAAGCACACACTTGCTGG - Intergenic
1007696238 6:43735998-43736020 AACCAGGAGAAGAACCTGGCAGG - Intergenic
1008492626 6:52102188-52102210 AAACAGAGGCAGAAAATGGCAGG + Intergenic
1008959010 6:57246780-57246802 GGGCAGATGCAGAAACTGGCAGG - Intergenic
1011428205 6:87253681-87253703 AATCAGAAGCTTAAACTTGTAGG - Intronic
1011918392 6:92539894-92539916 AATTAGAAGCCCAATCTGGCTGG + Intergenic
1012990757 6:105923341-105923363 CATCAAGAGCAGAAACTAGCAGG + Intergenic
1013312852 6:108913777-108913799 AACCAGAAGGAGAAACAGGGAGG - Intronic
1014523214 6:122470614-122470636 AATCAAAAGAACAGACTGGCTGG + Intronic
1016808217 6:148234527-148234549 AAGAAGAAGGAGGAACTGGCCGG + Intergenic
1019099386 6:169616192-169616214 AATTACAAGAAGAAACTAGCTGG + Intronic
1020163623 7:5791407-5791429 AATAAGAACCAGAATTTGGCTGG - Intergenic
1020786308 7:12577552-12577574 AAGCAGAAACAAAAACAGGCCGG + Intronic
1020878927 7:13734574-13734596 AATCAGAAGCAGTTACTGGAGGG - Intergenic
1021439249 7:20659451-20659473 AACCAGAAACGGATACTGGCAGG + Intronic
1021671975 7:23043755-23043777 CATCAGAAATAGAGACTGGCTGG + Intergenic
1021694787 7:23266243-23266265 AATAAGACGTTGAAACTGGCCGG - Intronic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1023040714 7:36170729-36170751 ATTCAGAAGCCAAAACTAGCTGG - Intronic
1024587433 7:50854128-50854150 AATCAGAAGGTGAAACTGACAGG - Intergenic
1025191362 7:56898159-56898181 AATCTGAGGCTGAAACTGCCTGG - Intergenic
1025639311 7:63352594-63352616 ACTCAGAAGCAGAGAGTGGGAGG - Intergenic
1025643388 7:63395498-63395520 ACTCAGAAGCAGAGAGTGGGAGG + Intergenic
1025680586 7:63678775-63678797 AATCTGAGGCTGAAACTGCCTGG + Intergenic
1025875520 7:65477157-65477179 AATTAGAATCAGAATCTGGGTGG - Intergenic
1027201663 7:76067847-76067869 AAGCAAAAGCAGAAGCTGCCAGG + Intergenic
1027647069 7:80814993-80815015 AATCTTCAGCAGAAAATGGCAGG - Intronic
1028293521 7:89098187-89098209 ATTCTGAAGCAAAAACTGCCAGG - Intronic
1028314157 7:89378948-89378970 AATGAGAAGCAGAAATAGCCTGG + Intergenic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1029648494 7:101873879-101873901 TATCAAAAGGAGAACCTGGCAGG - Intronic
1032458988 7:132095401-132095423 ATTCAGAAGCAGAGGCTGGAAGG - Intergenic
1032832305 7:135640569-135640591 AAACAGAAGCAGACACTGGTAGG - Intronic
1033655176 7:143368422-143368444 AATGAGAACCAGGAACTGGAAGG + Intergenic
1035089380 7:156294112-156294134 GGACAGCAGCAGAAACTGGCTGG - Intergenic
1036121054 8:6018221-6018243 ATTCAGATGAAGAAAGTGGCAGG + Intergenic
1036980933 8:13469113-13469135 AATAAAAAGCAGACACAGGCTGG - Intronic
1037409478 8:18581004-18581026 AGAGAGAAGCAGAGACTGGCAGG + Intronic
1037550784 8:19969291-19969313 AACCAAAAGCAGAAGCTGCCAGG - Intergenic
1037611085 8:20476849-20476871 AGTCAGAACCAGAAACCTGCAGG - Intergenic
1037747116 8:21654565-21654587 AAGGAGAAACAGAGACTGGCTGG - Intergenic
1037933222 8:22896518-22896540 AATCAGAAACACAAAATGTCAGG - Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1041159267 8:55021279-55021301 AATCAAAAGCAGAAAGTAACAGG + Intergenic
1041196126 8:55402965-55402987 AATCAGAATCAGAAAGGGCCAGG + Intronic
1041969877 8:63728196-63728218 AATCAGAATTACAATCTGGCTGG + Intergenic
1042049663 8:64689862-64689884 AATTAGAAACAGAAGCAGGCCGG - Intronic
1044213567 8:89580491-89580513 ATTAAGAAGTGGAAACTGGCTGG - Intergenic
1044501288 8:92961323-92961345 AAGCAGAATCGGAAACTGGGAGG + Intronic
1045550973 8:103172124-103172146 AAACAGAAGTAGATACAGGCAGG - Intronic
1045555845 8:103213741-103213763 AGTCAGAAGGAGGAACTGGGTGG - Intronic
1045820070 8:106326503-106326525 AATCAGAAGCAGAAATCAACTGG - Intronic
1046776026 8:118164330-118164352 CAGCTGAAGCAGAAACTGCCTGG - Intergenic
1047466487 8:125120475-125120497 AAACAGAAGCAAATACTAGCAGG - Intronic
1048623414 8:136159250-136159272 AAACACCAGCAGACACTGGCAGG - Intergenic
1049828040 8:144683017-144683039 AAAAACAAGCAAAAACTGGCTGG + Intergenic
1050017203 9:1246552-1246574 AAACACAAGAAGAAACTGGTAGG + Intergenic
1050692184 9:8240581-8240603 AAACAGAAACAGAAACAGGTAGG + Intergenic
1050698969 9:8315280-8315302 AATCAGAAGAAGAAAATGAATGG - Exonic
1051427752 9:16950828-16950850 AGTAAGAAGCAGAAACAAGCTGG - Intergenic
1051640567 9:19221071-19221093 AATAAAAAGCAGAACCAGGCTGG + Intergenic
1051697242 9:19781556-19781578 AATCACAAGCAGTAACTGACGGG + Intronic
1051817322 9:21123255-21123277 AAACAAAAACATAAACTGGCAGG - Intergenic
1052116409 9:24653100-24653122 ATACAGATGAAGAAACTGGCTGG + Intergenic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1055617789 9:78091208-78091230 AATCAGAACCAAAAAATGGACGG + Intergenic
1056448298 9:86688183-86688205 AGGCAGAAGCAAAAACTGCCAGG + Intergenic
1056821058 9:89842449-89842471 AATGAGAAGCAGAAGCTGCCGGG + Intergenic
1056915340 9:90741220-90741242 AATCAGCATATGAAACTGGCAGG + Intergenic
1059023581 9:110601372-110601394 GATCATAAGCACACACTGGCTGG - Intergenic
1059199459 9:112400620-112400642 AAACAGAACCACAAACTGGATGG + Intronic
1059506897 9:114807364-114807386 AACCAGAAGTAGCAACTGGATGG - Intergenic
1060288503 9:122277154-122277176 AATTAAAAGAAGAAACTGGCTGG - Intronic
1060798030 9:126525842-126525864 CATAAGAACCAGAAACCGGCTGG + Intergenic
1061207110 9:129171184-129171206 AGACAGAAGCAGAACCTGGCTGG - Intergenic
1061546993 9:131310106-131310128 AAACAGAGGCAGAGAGTGGCGGG - Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186607546 X:11107809-11107831 AGTCAGAAGCAGACACTGGAAGG - Intergenic
1188386611 X:29567912-29567934 GGACAGAACCAGAAACTGGCTGG + Intronic
1188802008 X:34543911-34543933 TATAAGAAGAAGAAACGGGCCGG + Intergenic
1189146313 X:38658662-38658684 AAACAGAAGCAGAAGATGGTGGG - Intronic
1189764345 X:44354699-44354721 CAAAAGAAGCAGAAACTGGCCGG + Intergenic
1189975978 X:46461603-46461625 GATCTGGAGCAGAAACAGGCGGG + Intronic
1189983090 X:46530097-46530119 GATCTGGAGCAGAAACAGGCGGG - Intronic
1190097138 X:47490816-47490838 ATTCAGCAGCTGAAACTGGGAGG + Intergenic
1190843856 X:54172747-54172769 CTACAGAATCAGAAACTGGCGGG - Intronic
1192982970 X:76366882-76366904 AAACAAAAACAGACACTGGCAGG - Intergenic
1193550578 X:82887625-82887647 CAGCAAAAGCAAAAACTGGCGGG + Intergenic
1194739324 X:97553687-97553709 AAGAAGAAGAAGAAAATGGCTGG + Intronic
1200408982 Y:2843145-2843167 ACTTGGAAGCAGAAACTGACAGG - Intronic
1201147578 Y:11073245-11073267 TAACTGAAGCAGAACCTGGCGGG + Intergenic
1201274727 Y:12286754-12286776 AATCAGAATCAGAAGCTGGGTGG + Intergenic