ID: 994148753

View in Genome Browser
Species Human (GRCh38)
Location 5:96423821-96423843
Sequence ATGGAGAATCAGGATTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994148753_994148761 8 Left 994148753 5:96423821-96423843 CCCCCCAAATCCTGATTCTCCAT 0: 1
1: 0
2: 1
3: 25
4: 257
Right 994148761 5:96423852-96423874 TGAGCTCTCATTATATTGCCTGG 0: 1
1: 0
2: 17
3: 150
4: 704

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994148753 Original CRISPR ATGGAGAATCAGGATTTGGG GGG (reversed) Intronic
900696856 1:4017634-4017656 GTGGGGACACAGGATTTGGGAGG - Intergenic
902041475 1:13495649-13495671 AAGGAGCATCAGGTGTTGGGTGG - Intronic
902346572 1:15822542-15822564 ATGGAATATCAGGATTTCGAGGG - Intergenic
905226720 1:36483412-36483434 ATGGAGAAACAGGAATTCTGGGG + Intergenic
905547374 1:38810527-38810549 ATGAATAAGTAGGATTTGGGTGG - Intergenic
907257855 1:53193435-53193457 ATGGAGAATGGGGGTTGGGGAGG - Intergenic
907904540 1:58772391-58772413 AAGGAAAATCAGGATCTAGGAGG - Intergenic
909173253 1:72321877-72321899 AATTAGATTCAGGATTTGGGAGG - Intergenic
909485131 1:76164222-76164244 AAGGAGAATGAGGATTTCTGTGG + Intronic
909911637 1:81265589-81265611 GAGGAGAACCAGGAGTTGGGTGG + Intergenic
910869180 1:91816083-91816105 ATTTAGAATTAGGATTTGTGTGG - Intronic
911272037 1:95813765-95813787 ATGGAGAATGAGGAGTGGGAGGG + Intergenic
912368068 1:109151177-109151199 CTAGAGAATCAGGATCTTGGTGG + Intronic
912481671 1:109986063-109986085 ATGGAAAATCAAGATGTGGTTGG - Intronic
914255551 1:145959385-145959407 ATGGGGAATGAGGAATGGGGAGG - Intergenic
916297754 1:163238636-163238658 ATCAGGAATGAGGATTTGGGTGG + Intronic
916958912 1:169869269-169869291 ATGGATAATCAGGAAATGAGAGG - Intronic
916989565 1:170227651-170227673 ATGGAGAATGAGGAAAGGGGAGG + Intergenic
918943851 1:191034926-191034948 ATGGAGAATCAGATTTATGGAGG - Intergenic
919138818 1:193544418-193544440 ATGGACTATCAATATTTGGGTGG + Intergenic
920161711 1:204003666-204003688 ATGGACAGTCATGTTTTGGGAGG + Intergenic
922356579 1:224782302-224782324 AAGAAGATTCAGGAGTTGGGTGG - Intergenic
922924893 1:229340640-229340662 CTGAAGCATCAGGATTTGTGGGG + Intronic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
1063002941 10:1941643-1941665 ATGGAGAATCAGCATCTGATAGG + Intergenic
1063097991 10:2925133-2925155 AAGTAGGATCAGGAGTTGGGAGG - Intergenic
1063272251 10:4523546-4523568 ATGGGGCATCTGGATTTTGGAGG + Intergenic
1063718438 10:8553716-8553738 ATGGAGAAGAAGAATTCGGGTGG + Intergenic
1064565395 10:16633946-16633968 AATGAGAATTAGGAATTGGGAGG - Intronic
1065363672 10:24913851-24913873 GTGGAGAAACAGGATTTGTATGG + Intronic
1068248086 10:54399338-54399360 TTGGACACTGAGGATTTGGGAGG + Intronic
1068285172 10:54924142-54924164 ATGGTGAAGCAGGAAGTGGGGGG + Intronic
1069417939 10:68218261-68218283 AAGGAGCAGCAGGATTTGAGAGG + Intergenic
1070360947 10:75688620-75688642 AAGCAGAAGCAGGGTTTGGGAGG + Intronic
1070913932 10:80140702-80140724 ATGGTGAATCAAGAGTTGAGAGG + Intronic
1072541992 10:96405641-96405663 ATGGAGACGGAGGATTTGGAAGG + Intronic
1072962151 10:99939039-99939061 ATGGAGAAGTAGGATTTGGAAGG + Intronic
1074931518 10:118131464-118131486 ATGGAGAATCTGTATTTGTCTGG + Intergenic
1075030746 10:119023193-119023215 AGGGAAAATGAGGTTTTGGGAGG - Intergenic
1075224488 10:120614312-120614334 ATGTAGATACAGCATTTGGGTGG - Intergenic
1075264888 10:120991627-120991649 ATGGAAAAAAAGGATTTGTGAGG + Intergenic
1075352487 10:121736353-121736375 TTGGAGAATCTGGACTTGGAAGG - Intergenic
1075802827 10:125163016-125163038 ATGGAAAATCAGGCTTTTTGTGG - Intergenic
1076504171 10:130961017-130961039 TGGGAGGATCAGGTTTTGGGGGG - Intergenic
1076893849 10:133299112-133299134 ATGGGGAGTCAGGATTGGGTAGG + Intronic
1078317283 11:10304430-10304452 ATTGAGAATTGGGATTTGGAGGG - Intergenic
1079192104 11:18287396-18287418 ATGGAAGAGGAGGATTTGGGAGG - Intronic
1079593477 11:22210983-22211005 AGAGAGAATTAGTATTTGGGAGG - Intronic
1080186985 11:29501841-29501863 ATTGAGAATAAGGAATTAGGTGG - Intergenic
1080436597 11:32250366-32250388 ATGGAGAAGCAGGTTCAGGGAGG - Intergenic
1080449028 11:32363548-32363570 ATGAATAAGAAGGATTTGGGAGG + Intergenic
1081055682 11:38408071-38408093 ATGGACAATCAGGAGTTTGATGG + Intergenic
1088335820 11:108702533-108702555 TTGGAGAATCTGAATTTGAGTGG + Intronic
1088504491 11:110514959-110514981 ATGAGGAATCAGGCTTTGAGAGG - Intergenic
1088595680 11:111438690-111438712 ATTCAGAATAAGGACTTGGGAGG - Intronic
1088736590 11:112732682-112732704 AGGGTGAACCAGGATTGGGGAGG + Intergenic
1089129605 11:116201298-116201320 ATGGAGAAGCAGGATTGCTGCGG + Intergenic
1090231113 11:125104470-125104492 ATGGAGAGTCAGTGTTTGAGGGG - Intronic
1090823875 11:130369648-130369670 TAGGAGAATGAGGAATTGGGAGG - Intergenic
1091069266 11:132548041-132548063 AAGCAGAAACAGCATTTGGGAGG + Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092943013 12:13427968-13427990 TGGGAGAATCAGGATTGGCGGGG + Intergenic
1096837853 12:54362521-54362543 ATGGAGAGACTTGATTTGGGAGG + Exonic
1099876675 12:88416434-88416456 ATGGAGAATAGTGATCTGGGAGG - Intergenic
1101010428 12:100443900-100443922 GTGGAGAAAGAGGAATTGGGTGG - Intergenic
1101068663 12:101049929-101049951 CTGGAGAATAAGAATCTGGGTGG - Intronic
1102232179 12:111270270-111270292 ATGTTGAATCAGGACTTGTGTGG - Intronic
1102350120 12:112185627-112185649 ATGGAGAAACAGAGGTTGGGAGG + Intronic
1102449266 12:113028687-113028709 GTGGAGAAGCAGTTTTTGGGAGG - Intergenic
1103223106 12:119262888-119262910 GAGGAGAGTCAGGATTGGGGAGG + Intergenic
1103273763 12:119694884-119694906 ATGGAGAAACAGGTTGTGAGAGG - Intronic
1104416728 12:128601806-128601828 ACCTAGTATCAGGATTTGGGAGG + Intronic
1107732625 13:43364026-43364048 TTGGAGATTCAGTATTTGAGAGG + Intronic
1108361839 13:49674953-49674975 ATGGAGAATCAGTGTTTAGTGGG - Intronic
1110179063 13:72593576-72593598 ATGGAGAAACAAGTTTTGAGAGG + Intergenic
1110393240 13:75000563-75000585 ATGGAAAAACAGAATTTGAGAGG + Intergenic
1110817265 13:79875912-79875934 ATTGAGGATTAGGATTTTGGTGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113277710 13:108751157-108751179 ATGGGGAACCAAGATTTTGGAGG - Intronic
1115144409 14:30209852-30209874 TTGGAAAATAAGGTTTTGGGGGG + Intergenic
1115258307 14:31426422-31426444 TCAGAGAATGAGGATTTGGGAGG - Intronic
1117182260 14:53202791-53202813 AGGGAGGATCAGGAGGTGGGTGG - Intergenic
1117206932 14:53452728-53452750 ATGGAGAGTAAGGAATTAGGAGG + Intergenic
1118165077 14:63328222-63328244 TTGGAGGATCAGGATCAGGGCGG - Intergenic
1119158186 14:72430793-72430815 ATGGGTGATCAGCATTTGGGAGG - Intronic
1120841671 14:89091099-89091121 ATGGAGGAGCCTGATTTGGGAGG - Intergenic
1120868778 14:89318774-89318796 AGGGAGAACCCGGATTTGAGTGG - Intronic
1123506153 15:20942308-20942330 ATGGGGAACCGGCATTTGGGTGG + Intergenic
1123563380 15:21516015-21516037 ATGGGGAACCGGCATTTGGGTGG + Intergenic
1123599631 15:21953298-21953320 ATGGGGAACCGGCATTTGGGTGG + Intergenic
1125828804 15:42696853-42696875 AGGGAGAACCAGGTTTTGTGTGG + Intronic
1126470976 15:49010287-49010309 CTGGAGAATCAGGAGTGGTGTGG - Intronic
1127337365 15:58001746-58001768 ATGGAGTATCTGAATTTGGGTGG - Intronic
1130016493 15:80190704-80190726 ATGGAGTCTCAGTATTTAGGAGG + Intergenic
1130417410 15:83706611-83706633 AAAGAGAATCAGGATTTGGTTGG - Intronic
1131068682 15:89450384-89450406 AGGGAGAATCTGGATTTGTGTGG - Intergenic
1131968563 15:97870531-97870553 ATGAAGAATGAGTATCTGGGCGG + Intergenic
1132412831 15:101597556-101597578 AGGGAGGATCAGGAGGTGGGTGG + Intergenic
1202971737 15_KI270727v1_random:243149-243171 ATGGGGAACCGGCATTTGGGTGG + Intergenic
1134360072 16:13522947-13522969 ATGGAGTATCAGCTTTGGGGAGG + Intergenic
1135540314 16:23324895-23324917 ATGGACAAAGAGGACTTGGGGGG - Intronic
1136224708 16:28851294-28851316 TTGGAGAATCAGAACTGGGGAGG - Intronic
1139678655 16:68542640-68542662 TTGGTGAATCGGGAGTTGGGAGG + Intronic
1140256044 16:73337231-73337253 ACGTAGGATAAGGATTTGGGAGG - Intergenic
1142604111 17:1072319-1072341 ATGGGGGATCAGGATTGGAGAGG + Intronic
1142960584 17:3550074-3550096 ATGGATAATAAGTAATTGGGAGG + Intronic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1145726670 17:27133776-27133798 TTGGAGACTGAGGATTTGGGAGG + Intergenic
1146372194 17:32272164-32272186 ATTGAGAATCAGAATTTGCTTGG + Intronic
1146775377 17:35609783-35609805 ATGGAGAATTAGAATTTGGCTGG + Intronic
1149099738 17:52890006-52890028 CTGAAGAATCAGGCTTTGAGAGG - Intronic
1149276148 17:55040039-55040061 ATGGAGAAAGGGGGTTTGGGAGG - Intronic
1150015289 17:61550751-61550773 ATGGAGAATAAAGAATTGGGAGG + Intergenic
1151273498 17:73015081-73015103 ATGGAAACTCAGTATTTGGGAGG - Intronic
1151569537 17:74919406-74919428 ATGGAGGAGCAGGAGTTGGAAGG - Intronic
1152551881 17:81034420-81034442 TTGGAGAAGGAGGATTTCGGGGG - Intergenic
1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG + Intronic
1154405638 18:14087854-14087876 ATGGACAAAAAGGATCTGGGAGG + Intronic
1155085475 18:22453911-22453933 CTGGGGAGTCAGGATTTAGGGGG + Intergenic
1157130318 18:45001243-45001265 ATGGGGAAACAGGCTTTGAGTGG - Intronic
1157172991 18:45425204-45425226 ATGGAGGGTCAGCATTTGGATGG - Intronic
1159196192 18:65118911-65118933 ATGGAGATTTAGGATGTGGAGGG - Intergenic
1161907638 19:7169049-7169071 AGGGAGAGTCAGGTTTTGGCTGG - Intronic
1163837195 19:19582130-19582152 GTGCAGCAGCAGGATTTGGGGGG - Intronic
1165950583 19:39472193-39472215 ATGGAGAGTGAGCATTTTGGGGG + Intronic
925248076 2:2402481-2402503 AATGAGAATTAGGACTTGGGAGG - Intergenic
928986923 2:37191081-37191103 TTGCAGAGTCAGGATTTGGAGGG + Intronic
929351835 2:40965644-40965666 AAAGAGAATCAGGATTAGGGAGG - Intergenic
929790906 2:45022192-45022214 AAGGAGAATTAGGATAGGGGAGG + Intergenic
930018565 2:46987097-46987119 AAGGACCATCAGGAATTGGGAGG + Intronic
931752394 2:65341352-65341374 ATGGAGAAACATGATGGGGGAGG + Intronic
932759203 2:74428532-74428554 ATGAAAAATCAAGATTTGGGTGG - Intronic
932996820 2:76864990-76865012 AGTAAGAATCAAGATTTGGGAGG - Intronic
933227968 2:79772819-79772841 ATGGACAAACATGCTTTGGGAGG - Intronic
933509763 2:83225686-83225708 ATGGAGAATAAGGAAAAGGGTGG + Intergenic
934930575 2:98419270-98419292 ATTGAGGATCAGGATATGGGAGG - Intergenic
935368043 2:102315267-102315289 AGGGAGAGTGGGGATTTGGGAGG - Intronic
937735228 2:125279797-125279819 TTGGAGAATCTGAAATTGGGAGG + Intergenic
938881301 2:135592610-135592632 ATGGATAATAAGGATGTGAGAGG - Intronic
939181478 2:138808012-138808034 AGGGAGAAACAGGATTGTGGAGG - Intergenic
941399801 2:165016712-165016734 ATGGAGAAGCAGGATTTAATTGG - Intergenic
943014576 2:182495391-182495413 ATGTAGAATCTGGCTTTGGTTGG + Intronic
947830238 2:233134397-233134419 ATGGAGAAGGAGGAGCTGGGAGG + Intronic
948417261 2:237819401-237819423 GTGGAGAACCAGGAAGTGGGAGG + Intronic
1169323214 20:4652615-4652637 ATGGAGACTCAGAAGTGGGGAGG - Intergenic
1170438093 20:16350709-16350731 ATGGAGCATGAGGAGCTGGGTGG + Intronic
1170966061 20:21072572-21072594 AAGGAGAATCAGGAATTTGAAGG + Intergenic
1173180279 20:40801371-40801393 AAGGAGAAGGAGGATTTGGATGG + Intergenic
1174840660 20:53898530-53898552 ATGGAGAACCTCGATTTGGACGG + Intergenic
1175613439 20:60371756-60371778 AGAAAGAACCAGGATTTGGGGGG - Intergenic
1177845126 21:26279914-26279936 ATGGATAATAAGGATGTGGGGGG + Intergenic
1178322173 21:31613986-31614008 ATGGAGACTGAGGATTTGAGAGG + Intergenic
1178435879 21:32558118-32558140 ATGGAAAAAAAGGATTTGTGAGG - Intergenic
1178719170 21:34992868-34992890 ATGGAGAAACTGGACTTGGATGG - Intronic
1178781714 21:35609580-35609602 ATGTAGAATTAGGAGTTAGGAGG + Intronic
1178821227 21:35977064-35977086 ATGGGGAAGCAGGCTTGGGGAGG - Intronic
1179154835 21:38840702-38840724 ATGGAGAGTCAGCCTTTGAGAGG - Intergenic
1179606174 21:42516796-42516818 ATGGAGAAGCAGCACTTGAGAGG + Intronic
1180057170 21:45364985-45365007 GTGGAGAATGAGGCTGTGGGCGG + Intergenic
1181191924 22:21148039-21148061 AGGGAGGATTAGGATTTGTGTGG + Intergenic
1181207273 22:21262471-21262493 AGGGAGGATTAGGATTTGTGTGG - Intergenic
1181913549 22:26260002-26260024 ATGCCAAATCAGGATATGGGAGG - Intronic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1184569838 22:45315602-45315624 ATGGAGAAACAGGTTTAGAGAGG + Intronic
1184780352 22:46645974-46645996 ATGTAGAATTTGGATTTTGGGGG + Intronic
1203271180 22_KI270734v1_random:53882-53904 AGGGAGGATTAGGATTTGTGTGG - Intergenic
949690831 3:6636996-6637018 ATGGAGAATCTAAATTAGGGTGG - Intergenic
949844360 3:8354754-8354776 ATGGCATATCAGGATTTGGTTGG + Intergenic
953598598 3:44340747-44340769 CTGCAGAATCAGAATCTGGGTGG - Intronic
953663680 3:44909855-44909877 ATGGAGAAGCAGATTTTTGGAGG + Intronic
955457561 3:59140617-59140639 CTGGAGACTCAGGAGTGGGGAGG + Intergenic
955596680 3:60598169-60598191 ATTCAGAAACAAGATTTGGGGGG + Intronic
955755592 3:62222273-62222295 ATGGAACATCAGGACTTGGCTGG + Intronic
957133213 3:76249287-76249309 TTGGAGAGTCAGGACTTGAGCGG + Intronic
959717084 3:109444575-109444597 TTGGAGAAACAGGAGTGGGGAGG + Intergenic
960949197 3:122988096-122988118 AGGGAGAATCAGGATCTCTGTGG - Intronic
962414599 3:135170388-135170410 ATAGAGAATTTGGATTTGGGTGG + Intronic
963720324 3:148854631-148854653 ATGAATAATCAAGATTTGGGTGG - Intronic
965833592 3:172826548-172826570 ATGCAGAGGCAGGATTTGAGAGG + Intergenic
966426405 3:179784570-179784592 ATAGAAAATCAGCAGTTGGGTGG + Exonic
967013311 3:185459317-185459339 GTAGAGAAGCAAGATTTGGGGGG - Intronic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
974593305 4:63983724-63983746 ATGGAGAAGGAAGATTTTGGAGG - Intergenic
975754423 4:77558686-77558708 ATGAAGATTCAAGATATGGGGGG + Intronic
976017194 4:80571646-80571668 TTGGAGACTGAGGCTTTGGGAGG + Intronic
976104266 4:81600275-81600297 TTGGAGAATCATTGTTTGGGTGG + Intronic
976484254 4:85582970-85582992 ATTGAGAAACAGGAGTTGTGCGG + Intronic
978024586 4:103856780-103856802 TTGGATAATCAGAATTTTGGAGG + Intergenic
978213389 4:106165455-106165477 GTGGAGAGTAAGGATTAGGGAGG - Intronic
978884459 4:113750443-113750465 ATGCAGAAACAGGCTTGGGGAGG - Intronic
982506561 4:156226192-156226214 ATGGAGCATCATCATTTGGAAGG - Intergenic
983773855 4:171582645-171582667 ATGGAAAAAAAGGATTTGTGAGG - Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987955539 5:24735175-24735197 AGGGAGAATCCGGATGTGGTAGG + Intergenic
988276720 5:29090480-29090502 ATAAAGAATAGGGATTTGGGGGG - Intergenic
991030718 5:62079613-62079635 ATTGAGATACAGGATTTGAGAGG - Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
993955575 5:94228475-94228497 ATGGAGGAACAGGAGGTGGGAGG - Intronic
994148753 5:96423821-96423843 ATGGAGAATCAGGATTTGGGGGG - Intronic
994347251 5:98701120-98701142 AGGGAGAATCAGGTGGTGGGTGG - Intergenic
996284902 5:121778231-121778253 ATGGACTTTCAGGACTTGGGGGG - Intergenic
997838032 5:137212210-137212232 CTGGAGAATCAGGTGTTGGTGGG + Intronic
998427877 5:142045160-142045182 CTGGAGACCCAGGATTTTGGGGG - Intergenic
999115481 5:149159883-149159905 ATGGAGAAACAGCATTTGCAAGG - Intronic
1001966298 5:175912079-175912101 ATGGAAAATGAGGCTTGGGGAGG - Intergenic
1002250649 5:177927124-177927146 ATGGAAAATGAGGCTTGGGGAGG + Intergenic
1002575984 5:180173972-180173994 ATGGAGGCTCAGGGGTTGGGGGG + Intronic
1004397661 6:15260204-15260226 AGGGAGGGTCTGGATTTGGGAGG + Intronic
1004785589 6:18964118-18964140 AGAGAGAATCAGGATATGGTGGG - Intergenic
1004924684 6:20404520-20404542 TTGGAGAATCAAGATTTTGCGGG + Intronic
1005659170 6:27977052-27977074 ATTGAATGTCAGGATTTGGGGGG - Intergenic
1006146191 6:31961240-31961262 TTGGAGCCTCTGGATTTGGGTGG + Exonic
1006175112 6:32116824-32116846 GTGGGGAAACAGGATTTGAGGGG + Intronic
1006909111 6:37552528-37552550 ATGGAGAATGAGGATTGGAGGGG + Intergenic
1007329693 6:41095958-41095980 ATGGAGTATCAGCAAATGGGAGG - Intronic
1008404224 6:51100770-51100792 ATGCAGTATCAGGATCTGGGAGG + Intergenic
1008419322 6:51279045-51279067 ATGTAGAATCAGGGATTGGCAGG + Intergenic
1008654929 6:53602169-53602191 ATTGAGAAACAGCATTTGGGAGG + Intronic
1009908250 6:69894837-69894859 ATTGTGAAACAGGATTTGTGGGG - Intronic
1012098552 6:94998883-94998905 ATGGAAAATCATGAGTTGGAAGG + Intergenic
1012919151 6:105203398-105203420 ATGGAGAAACAGGCTTAGAGTGG - Intergenic
1013156109 6:107491578-107491600 ATGGAAAATAAGGAGGTGGGGGG - Intronic
1013931704 6:115542387-115542409 AAGGACAGTCAGTATTTGGGGGG + Intergenic
1014121255 6:117727781-117727803 GTGGACAATCAGTGTTTGGGTGG + Intergenic
1014736592 6:125101350-125101372 ATGGAGAAGTAGGAGTTAGGAGG - Intergenic
1014762563 6:125373266-125373288 ATGGAGAAGAAGAGTTTGGGAGG - Intergenic
1016955829 6:149625968-149625990 GTTGAGAATGAGAATTTGGGAGG + Intronic
1017281090 6:152626814-152626836 ATAGAAAATCAGGATATTGGTGG - Intronic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1023185300 7:37526911-37526933 ATTGAGAACCATGATTTGAGCGG + Intergenic
1024528156 7:50366981-50367003 ATGGAGAGTAAGGATTTGCTAGG + Intronic
1026582445 7:71629654-71629676 TTGGAGAATTGGGAGTTGGGAGG + Intronic
1028270657 7:88784687-88784709 AGGCAGAAGCAGGATTTGGTGGG - Intronic
1030955298 7:115844570-115844592 ATGGAGAAGCAGGTTTTGGAGGG + Intergenic
1033455304 7:141497680-141497702 ATGGAAAATCAGGGTTGAGGAGG - Intergenic
1036179550 8:6572268-6572290 AATGCGCATCAGGATTTGGGAGG - Intronic
1036825319 8:11971279-11971301 ATGCAAAATCAGGAACTGGGTGG + Intergenic
1037237360 8:16736580-16736602 ATAGAGAATTAGGATTTGGCAGG - Intergenic
1038231732 8:25706768-25706790 ATGGAAAAACAGGAATTTGGTGG - Intergenic
1039030149 8:33299803-33299825 AGGGAGAATCAGGAAGTGGTTGG - Intergenic
1039188744 8:34947800-34947822 AAGGAAAATCTGGAGTTGGGGGG + Intergenic
1039550100 8:38437134-38437156 ATTTAGAATCAAGAATTGGGAGG - Intronic
1039859345 8:41443479-41443501 ATGGAGAAAATGGATTTTGGAGG + Intergenic
1040618665 8:49064795-49064817 ATTGAGAATGGGGATTTGTGGGG + Intronic
1041030062 8:53727817-53727839 ATGGAGGAACAGGATTGGGGTGG - Intronic
1041683890 8:60624493-60624515 TTGGAGAATTATCATTTGGGCGG - Intergenic
1042975112 8:74460362-74460384 GAGGAGAATCAAGATTTGGAAGG - Intronic
1043409560 8:79979201-79979223 CTGGAGAATTAGGACTTTGGAGG + Intronic
1044425714 8:92047397-92047419 ATGGAAAATCAGGATAAGGAGGG - Intronic
1046230422 8:111348376-111348398 ATGGAGAAACAAGTTTTGGGAGG + Intergenic
1046424398 8:114027611-114027633 AGGGAGGAGCAGGATTTCGGAGG + Intergenic
1047289583 8:123517717-123517739 ATGAAGAATCAGGAGTTCAGAGG - Intronic
1047560282 8:125979963-125979985 CTGGAGACTCAGAATTTGGGAGG + Intergenic
1047682600 8:127269703-127269725 GTGCAGAAGCAGGATTTGGATGG - Intergenic
1047859222 8:128946360-128946382 ATAGAGAATCTGTATCTGGGCGG + Intergenic
1047988908 8:130265220-130265242 ATAAGCAATCAGGATTTGGGAGG + Intronic
1048026211 8:130589319-130589341 ATGGAGAATGAGGAGATGGAGGG - Intergenic
1048900399 8:139031949-139031971 TGGGAAAATCAGCATTTGGGTGG + Intergenic
1049367771 8:142249012-142249034 ATGGAGACTCAGGCTTTGAGAGG - Intronic
1052819086 9:33124784-33124806 TCAGAGAAGCAGGATTTGGGAGG - Intronic
1052850975 9:33378270-33378292 AGGGAGACTCAGTTTTTGGGCGG - Intergenic
1056910955 9:90700194-90700216 CTGGAGAATGATGATCTGGGAGG + Intergenic
1057871645 9:98722606-98722628 CTGGAAAATCAGGTTGTGGGAGG - Intergenic
1059759304 9:117323284-117323306 TTTGAGAATGAGGCTTTGGGGGG - Intronic
1060025773 9:120169920-120169942 ATGGGGAATGTGGTTTTGGGCGG - Intergenic
1060432976 9:123566336-123566358 ATGGAGAACCAGGATCTTTGAGG - Intronic
1061035208 9:128109739-128109761 ATGAAGAAGCAGATTTTGGGAGG - Intergenic
1061316480 9:129799489-129799511 TTGCAGCATCAGGAGTTGGGAGG - Intergenic
1061972291 9:134051265-134051287 AAGGGGGAGCAGGATTTGGGAGG + Intronic
1062194306 9:135264422-135264444 AAGGAGACTCAGGATTAGGAGGG + Intergenic
1186122544 X:6379589-6379611 CTGGAGACTCAGAAGTTGGGAGG - Intergenic
1187056015 X:15742051-15742073 TGGGAGAAACAGGTTTTGGGTGG - Intronic
1189563720 X:42217665-42217687 ATATAGTATCAGGGTTTGGGAGG - Intergenic
1190131114 X:47749709-47749731 CTGGAGATTCAGGATTTTGGAGG + Intergenic
1190718389 X:53124577-53124599 ATGGAGAAGCAGGAGTTAGAGGG - Intergenic
1192301535 X:69909128-69909150 ATGGAAAATAAACATTTGGGGGG - Intronic
1193969936 X:88038961-88038983 ATGGAGCTCCAGGATTGGGGAGG - Intergenic
1196389831 X:115195817-115195839 AATCAGATTCAGGATTTGGGTGG - Intronic
1196486001 X:116207832-116207854 CTGGATAATCAGAAGTTGGGAGG + Intergenic
1200352141 X:155508952-155508974 ATAGAGAATTAAGATATGGGAGG + Intronic
1201474833 Y:14369228-14369250 CTGGAGACTCAGAATCTGGGAGG + Intergenic
1201668806 Y:16491688-16491710 GAGGAGGATCAGGATTTGGCCGG + Intergenic
1202186937 Y:22195572-22195594 AAGGATAATCAGGAGTTGGAAGG + Intergenic
1202204423 Y:22390824-22390846 AAGGATAATCAGGAGTTGGAAGG - Intronic