ID: 994155474

View in Genome Browser
Species Human (GRCh38)
Location 5:96498787-96498809
Sequence GGATTAACACAATTTCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994155474_994155484 23 Left 994155474 5:96498787-96498809 CCCCTCTGAAATTGTGTTAATCC No data
Right 994155484 5:96498833-96498855 GGCTCACATTCAGTGACTGATGG No data
994155474_994155481 2 Left 994155474 5:96498787-96498809 CCCCTCTGAAATTGTGTTAATCC No data
Right 994155481 5:96498812-96498834 CCTCCAGGTCCAAGGCTACATGG No data
994155474_994155485 29 Left 994155474 5:96498787-96498809 CCCCTCTGAAATTGTGTTAATCC No data
Right 994155485 5:96498839-96498861 CATTCAGTGACTGATGGACATGG No data
994155474_994155478 -6 Left 994155474 5:96498787-96498809 CCCCTCTGAAATTGTGTTAATCC No data
Right 994155478 5:96498804-96498826 TAATCCAGCCTCCAGGTCCAAGG No data
994155474_994155486 30 Left 994155474 5:96498787-96498809 CCCCTCTGAAATTGTGTTAATCC No data
Right 994155486 5:96498840-96498862 ATTCAGTGACTGATGGACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994155474 Original CRISPR GGATTAACACAATTTCAGAG GGG (reversed) Intergenic
No off target data available for this crispr