ID: 994162288

View in Genome Browser
Species Human (GRCh38)
Location 5:96570201-96570223
Sequence CTGTGTGTATGCCATGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994162286_994162288 7 Left 994162286 5:96570171-96570193 CCTTAGGAAGAGGACTTGTCTTT 0: 1
1: 0
2: 1
3: 18
4: 179
Right 994162288 5:96570201-96570223 CTGTGTGTATGCCATGATGCTGG 0: 1
1: 0
2: 1
3: 10
4: 173
994162285_994162288 16 Left 994162285 5:96570162-96570184 CCTTAATATCCTTAGGAAGAGGA 0: 1
1: 0
2: 5
3: 14
4: 138
Right 994162288 5:96570201-96570223 CTGTGTGTATGCCATGATGCTGG 0: 1
1: 0
2: 1
3: 10
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994162288 Original CRISPR CTGTGTGTATGCCATGATGC TGG Intronic
901429955 1:9207866-9207888 CTGTGTCTTTGCTAAGATGCTGG + Intergenic
906033100 1:42735655-42735677 CTGTGTGTATGCCTGGGGGCTGG + Intronic
908712263 1:67029625-67029647 CTGTGTGTAGAAAATGATGCTGG - Intronic
910343299 1:86212010-86212032 CTATGTGCCTGCCATGATGCTGG - Intergenic
910890485 1:92013830-92013852 TTGTGTGTCTGGCATTATGCTGG + Intronic
912387881 1:109281559-109281581 CATGGTGTGTGCCATGATGCAGG - Intronic
912428552 1:109615648-109615670 CTGGGTGCATGCCACCATGCTGG - Exonic
918250929 1:182702472-182702494 CTGGGTATATTGCATGATGCTGG - Intergenic
918365357 1:183802292-183802314 CTGTGTGTCTGTCTTTATGCCGG + Intronic
919418364 1:197340191-197340213 GTTTGTGTATCCCATGATTCTGG - Intronic
920689757 1:208136900-208136922 CTATGTGTCAGACATGATGCTGG + Intronic
922356513 1:224781385-224781407 ATGTGTGCATGCCATTGTGCTGG - Intergenic
924587437 1:245372291-245372313 CTATTTGTCTGCCATGAAGCTGG + Intronic
924710903 1:246529317-246529339 CTCTCTGTATGCAATGCTGCAGG + Intergenic
1063097458 10:2920995-2921017 CTGTGTGGTTGCCATGAGACCGG - Intergenic
1064699629 10:18005829-18005851 CTGTCTTTCTGCCAGGATGCTGG - Intronic
1072834209 10:98694079-98694101 CTGTGTCTAGGCCATGATTGTGG - Intronic
1075569035 10:123525825-123525847 CTGTGTGTCTGTCATGAGCCAGG + Intergenic
1075687236 10:124372757-124372779 CTGTGTGGATGCCAGGTTGGGGG + Intergenic
1076450551 10:130554432-130554454 CTGCGTGTATGTCCTGATGAGGG - Intergenic
1077484898 11:2834128-2834150 CTGTGTGCATGGCATGGTGGTGG + Intronic
1078961452 11:16277323-16277345 ATGTGAGGATGCCAGGATGCAGG + Intronic
1079047740 11:17122622-17122644 GTGTGTGTATACCATGATTTGGG - Intronic
1079105541 11:17570061-17570083 CTGCGTGCCTGCCATGAAGCTGG - Intronic
1082260912 11:50075821-50075843 CTGAGAGTATGCCAGGAGGCAGG + Intergenic
1084908467 11:72367699-72367721 CTGGGTATATTGCATGATGCTGG - Intronic
1089665929 11:120019264-120019286 CTGAGTTAAAGCCATGATGCCGG + Intergenic
1089773632 11:120820788-120820810 CTGTGGGGATTCCAGGATGCAGG - Intronic
1089872053 11:121683933-121683955 CTGTGTTTATGGTATAATGCAGG - Intergenic
1090072662 11:123557936-123557958 CTGTGTCTATGCCTTAATGGAGG + Intronic
1090859581 11:130640868-130640890 CAGGGTGTAAGCCATGCTGCTGG - Intergenic
1091097198 11:132835153-132835175 CAGTGAATATGCCATCATGCTGG - Intronic
1092166409 12:6345424-6345446 GTGTGTGTGTGCCATGATGCGGG - Intergenic
1093499255 12:19793007-19793029 ATTTGTGTATGACATGATGTAGG - Intergenic
1094114547 12:26896293-26896315 CTTTGTATATGCTATGCTGCCGG + Intergenic
1094165963 12:27444121-27444143 CTGTTTTTATGCCAATATGCTGG - Intergenic
1094359963 12:29620136-29620158 CTGTGAGAATTTCATGATGCTGG + Intronic
1102190234 12:110982028-110982050 CTCTGTGTGTCCCAAGATGCCGG - Intergenic
1105357467 13:19672034-19672056 CTGTGTCTGTGCCAGTATGCCGG + Exonic
1106636872 13:31538366-31538388 CTGTGTGTATGATATGATCATGG + Intergenic
1106755064 13:32814258-32814280 TTGTGTATATTGCATGATGCTGG + Intergenic
1106841985 13:33693654-33693676 CTGTGTGCAAGCCCTGATGTAGG + Intergenic
1112343221 13:98569370-98569392 CTTGGTTTATGCCATGATGTTGG - Intronic
1112730842 13:102360153-102360175 TTGTGTGTATGCCAAGATAGTGG - Intronic
1113956411 13:114101913-114101935 CTGTCTTTATGCCATGGTCCAGG - Intronic
1115497445 14:34020461-34020483 CTGAGTGTCTGCCATGAGACTGG + Intronic
1118457776 14:65960317-65960339 CTGTGTGTCAGCCCTGATGATGG - Intronic
1119704504 14:76775509-76775531 CTGTGTGTGTGCCAAGGTGCGGG + Intronic
1124792512 15:32742660-32742682 CTGTGTGTTTGTCTTTATGCTGG - Exonic
1126249019 15:46544551-46544573 CTGATTGTATGGCACGATGCTGG + Intergenic
1126318110 15:47392477-47392499 ATGTGAGTATGCTATGCTGCTGG + Intronic
1129074584 15:72982237-72982259 CTGTGTGTGTGCCATTTTACAGG - Intergenic
1129767533 15:78179654-78179676 CTGTGTCTCTGCCATCATGGGGG + Exonic
1129878608 15:78993001-78993023 CTGTGTGTGTGCCATGTGGGTGG + Intronic
1130683670 15:86018485-86018507 CTGTGTGTATGTCAGCATCCAGG + Intergenic
1132344526 15:101100345-101100367 CTGTGTGGCAGCCATGGTGCTGG + Intergenic
1133301289 16:4784224-4784246 CTGTGTGTCTCTGATGATGCAGG - Intronic
1134230599 16:12426271-12426293 CTGTCTCTATGCCAGGATCCAGG + Intronic
1134388244 16:13794179-13794201 CTGTGTGTCTGCCAAGAGGCTGG - Intergenic
1134573000 16:15307581-15307603 GTGTGTGTATGCAATTATGGAGG - Intergenic
1134729383 16:16448401-16448423 GTGTGTGTATGCAATTATGGAGG + Intergenic
1134938051 16:18263449-18263471 GTGTGTGTATGCAATTATGGAGG - Intergenic
1138542494 16:57696763-57696785 CTGTTTGTATGCCCTGGTGCAGG + Intronic
1140298286 16:73729676-73729698 CTTTGTGTATGCCAAGATTGCGG - Intergenic
1141668977 16:85481577-85481599 CTGTGTGTGTGCCATGGTTTGGG + Intergenic
1155760987 18:29566681-29566703 TTTTGTGTATGCCATGAGGAAGG - Intergenic
1158186407 18:54776726-54776748 CTGTGTGACTGACATGGTGCTGG - Intronic
1158591389 18:58781796-58781818 GTGTGTGTATGCCTTGGTGGTGG + Intergenic
1160027269 18:75228840-75228862 CTGAGTGAATGCCTAGATGCTGG - Intronic
1160230503 18:77044998-77045020 CTGTGTGTATCCCGTTATGTAGG - Intronic
1160507081 18:79433173-79433195 CTGTGTGGCTGCCATGAGACAGG - Intronic
1160595894 18:79973984-79974006 GAGAGTGTATGCCATGATGCAGG + Intronic
1160802612 19:977271-977293 CTGTGTGAAGGCCCTGAGGCCGG - Intergenic
1161195381 19:2983531-2983553 CTGTGTGAAGGCCCTGAGGCAGG + Intronic
1162101069 19:8339145-8339167 CTGTTTGGATGACATGATGGAGG + Intronic
1163795874 19:19337774-19337796 CTGTGTGGATCCCAGGATGAGGG - Intronic
1163988331 19:20973210-20973232 ATGTGTCTATACCATCATGCAGG + Intergenic
1164492575 19:28728013-28728035 CTGTGTGTGTGCCAGCATCCTGG - Intergenic
1165815056 19:38636895-38636917 CTGGGAGGAGGCCATGATGCTGG - Exonic
1167074838 19:47241926-47241948 GTGTGTGTATGTCATGGTGATGG + Intergenic
1168253390 19:55154110-55154132 CTCTGCAGATGCCATGATGCAGG - Exonic
1168387361 19:55975532-55975554 CTGTGTCTGTGCCCTGATGACGG + Intronic
928859281 2:35836444-35836466 TTGTGGGTATACCATGATTCAGG + Intergenic
930281268 2:49372997-49373019 CTGGGTATATTGCATGATGCTGG + Intergenic
931208562 2:60170934-60170956 CTGACTTTATGCCATGATTCAGG - Intergenic
931531836 2:63223706-63223728 TTGTGTGTATGCTATTAGGCGGG + Intronic
932197683 2:69798334-69798356 CTCTCTGTATGCAATGCTGCAGG - Intronic
932969978 2:76528794-76528816 CTGTGTGTATGGGTGGATGCAGG - Intergenic
934545820 2:95215081-95215103 CAGTGTGAATGACCTGATGCTGG - Exonic
935275146 2:101469905-101469927 CTGTGTGGCTGCCTTGATCCTGG + Intronic
936445047 2:112588443-112588465 AAGTCTGTATGCCATGCTGCAGG - Intronic
941717706 2:168781040-168781062 CTGTGTGTCAGGCATAATGCTGG + Intergenic
942366671 2:175235579-175235601 AAGTGTGGAGGCCATGATGCTGG - Intergenic
942764464 2:179437836-179437858 ATATATGTATGGCATGATGCTGG - Intergenic
943138200 2:183942721-183942743 CTGTGTGTGTGCTTTTATGCTGG - Intergenic
945319758 2:208407346-208407368 CTTTGCGGATGCCAGGATGCTGG - Intronic
945746314 2:213723239-213723261 CTGTGTGGATGGCATGTGGCTGG + Intronic
945897516 2:215501182-215501204 TTATGTGTTTTCCATGATGCAGG + Intergenic
946049770 2:216852849-216852871 CTGTTTTTATGCTATGCTGCTGG + Intergenic
1173898445 20:46568843-46568865 CTGTGTGGCTGCGAGGATGCTGG - Intronic
1173937654 20:46881236-46881258 CTGAGTGTATGACATGACACGGG - Intergenic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1177462270 21:21428351-21428373 CTGGGTGTATGCAAAGATACTGG - Intronic
1179108665 21:38426109-38426131 CTGTGAGGATGCCATCAGGCAGG - Intronic
1180702718 22:17790463-17790485 CGGCGTGTATGGCATGACGCAGG - Exonic
1181429196 22:22867649-22867671 CAGTGTGTCTGCCATGACTCAGG + Intronic
1182075601 22:27493348-27493370 CTGTGTGGATGCCAAGCTGCCGG + Intergenic
1182750432 22:32637529-32637551 CTGGGCGTATTGCATGATGCTGG + Intronic
1182758015 22:32696627-32696649 CTCTGTGTCAGCCATCATGCTGG - Intronic
1184575425 22:45360931-45360953 TTGTGTGTCTGCCATGATGATGG - Intronic
1185008494 22:48299736-48299758 GTGTGTATCAGCCATGATGCAGG - Intergenic
1185392690 22:50571169-50571191 CTTTGTGCAGGCCATGATGGAGG - Exonic
950140083 3:10609309-10609331 CTGTGTCTCTGCCCTGCTGCTGG - Intronic
951590927 3:24263650-24263672 CTCTGTCTAGGCCATGGTGCTGG - Intronic
955991267 3:64630117-64630139 CTGAGTGTAAGCCATGCGGCTGG + Intronic
960378312 3:116929977-116929999 CTGTGTGTAAGCATTGAGGCTGG + Intronic
961244349 3:125438368-125438390 CAGAGTGTCGGCCATGATGCAGG - Intergenic
961687631 3:128645516-128645538 CTGTGTGTATTTCATCATTCAGG - Intronic
968505550 4:969561-969583 CTGTGAGCATGCCAGGATGGCGG + Intronic
969540682 4:7787214-7787236 CTGTGTGTATGCGGCGGTGCCGG + Intronic
970223966 4:13837969-13837991 GTTTGTGTATGGCATGAGGCAGG - Intergenic
972201144 4:36716030-36716052 CTGTGTGGATACCATGATGGTGG + Intergenic
977594296 4:98861638-98861660 CTGAGTGTCTGCCATGTTCCTGG - Intergenic
978931338 4:114316194-114316216 CTGGGTATATTGCATGATGCTGG - Intergenic
979429514 4:120611778-120611800 ATGTGGTTATGCCCTGATGCTGG - Intergenic
980238912 4:130147516-130147538 CTCTGTGAATGGCATTATGCTGG - Intergenic
980758264 4:137193411-137193433 GTCTGTCTATGCCATGATGGTGG + Intergenic
981145765 4:141322215-141322237 CTGTGTTTTAACCATGATGCTGG + Intergenic
981652882 4:147079062-147079084 CTGAGTGTATGTTATGAGGCAGG - Intergenic
981986059 4:150858089-150858111 CTGTGTGTATGCATTTCTGCTGG + Intronic
982629099 4:157808978-157809000 CTGTGTGTATGCCCAGGTGAAGG + Intergenic
983669286 4:170216856-170216878 CTTTGTGAATGACATTATGCTGG - Intergenic
984747464 4:183236340-183236362 CTGTGAGTCTGCCGTGATTCTGG - Intronic
987550113 5:19368702-19368724 CTGTGGGTATGCTAGGTTGCAGG + Intergenic
989012238 5:36885939-36885961 CTGTATGTCTGCCATGATCTTGG - Intronic
990923543 5:60994130-60994152 CTGGGTGTGTGCCATGATCAGGG - Intronic
991604806 5:68390451-68390473 ATATGTGCATGCCATTATGCAGG - Intergenic
991983545 5:72258720-72258742 CTGTGTGTATGCCTTGATTTTGG + Intronic
994162288 5:96570201-96570223 CTGTGTGTATGCCATGATGCTGG + Intronic
994725489 5:103430139-103430161 ATGTCTTTAGGCCATGATGCAGG - Intergenic
994768103 5:103946689-103946711 GTGTGTGTATCCAATGATACAGG - Intergenic
995418887 5:111940452-111940474 CTGTCTGTCTGCCATGTTCCAGG + Intronic
1001446098 5:171784805-171784827 ATATGTGTATGCCATAATGAAGG - Intergenic
1001950917 5:175815901-175815923 ATGTGTGTCAGGCATGATGCTGG - Intronic
1002197803 5:177510531-177510553 CTGTGTGTATACCTTTATTCTGG + Intronic
1003478855 6:6512614-6512636 CTGTGGGATTGCCATGATCCTGG - Intergenic
1014302555 6:119700672-119700694 CAGTGTCTATGACATGGTGCAGG - Intergenic
1018601407 6:165546935-165546957 CTGTATGTATGCAATTATACCGG - Intronic
1018831767 6:167448843-167448865 CTGTGTGTGTTCCATGCTGAAGG + Intergenic
1019038804 6:169085547-169085569 CTGTGCGTATGAAATGGTGCTGG - Intergenic
1020041365 7:5005157-5005179 CTGTGTGTTTCTCATCATGCCGG + Intronic
1020855522 7:13416727-13416749 CTCTGTGTATCACGTGATGCTGG + Intergenic
1022729184 7:33006700-33006722 ATGTGGTTATTCCATGATGCAGG - Exonic
1024455097 7:49596903-49596925 CTCTGAGAATGCCATGATGATGG + Intergenic
1025044470 7:55681280-55681302 ATGTGGTTATTCCATGATGCAGG + Intergenic
1029353661 7:100033768-100033790 CTGTGTGGATCCTCTGATGCAGG - Exonic
1031762289 7:125728768-125728790 GTGTGTATATTGCATGATGCTGG - Intergenic
1034851233 7:154495836-154495858 CTGTGTGTGTACCCAGATGCAGG + Intronic
1035482240 7:159196829-159196851 CAGTTTGCATGCCATGGTGCTGG + Intergenic
1039847222 8:41334174-41334196 CTCTGTGTATGCCGTCAGGCTGG - Intergenic
1040611149 8:48983399-48983421 ATAGGTGTATACCATGATGCAGG + Intergenic
1044201478 8:89443665-89443687 TTTTGTGTATGGCATGAGGCTGG - Intergenic
1044537913 8:93378682-93378704 CTGTGTGCATGCAATGCTGATGG - Intergenic
1047752315 8:127891081-127891103 CTGTGTGGTTGGCGTGATGCTGG + Intergenic
1048379521 8:133852852-133852874 TTATGTGTATGTCATGAGGCAGG - Intergenic
1048591607 8:135825764-135825786 CTGTGTGTATGACACTATGGAGG - Intergenic
1051533068 9:18127008-18127030 CTGTGTGTCCGTCAAGATGCTGG + Intergenic
1052157203 9:25207016-25207038 CTTTGTGTATGCCATTATTTAGG + Intergenic
1052957267 9:34262992-34263014 CTGTCAGTAAGACATGATGCTGG - Intronic
1057434055 9:95023128-95023150 CTGTCTGTGACCCATGATGCAGG - Intronic
1058755789 9:108081967-108081989 CTGTGTGTAGGGCATGATTGTGG + Intergenic
1059803361 9:117773157-117773179 CTGTGTTTATGACATGATATGGG - Intergenic
1185913313 X:4006511-4006533 CTGTGTGTATGTCAGGAGGCAGG + Intergenic
1186923169 X:14303912-14303934 CTGAGGGTATGCTATGAGGCTGG + Intergenic
1187587918 X:20684459-20684481 ATGTCTTTATGCCAAGATGCTGG - Intergenic
1188583343 X:31742603-31742625 CTGTATTTAAGACATGATGCTGG + Intronic
1189633131 X:42976026-42976048 CTGTCTGTTTGCAATGCTGCAGG - Intergenic
1190685476 X:52868905-52868927 ATGGGTGTCTGCCATGTTGCAGG + Intergenic
1190731802 X:53231492-53231514 CTGTGTGTCTGGCATGAGGTAGG + Intergenic
1191718532 X:64209824-64209846 CTGTGTGTAGTCCATCATTCTGG - Intergenic
1191841660 X:65517603-65517625 GTGTGTGTGTGCCTTGAGGCTGG - Intronic
1194311575 X:92315675-92315697 ACAGGTGTATGCCATGATGCTGG + Intronic
1194831988 X:98634411-98634433 CTGTGTGTCTGCTTTTATGCTGG - Intergenic
1195374695 X:104215431-104215453 CTGGGTATATTACATGATGCTGG - Intergenic
1200619850 Y:5429809-5429831 ACAGGTGTATGCCATGATGCTGG + Intronic