ID: 994163169

View in Genome Browser
Species Human (GRCh38)
Location 5:96579651-96579673
Sequence AAGAACAAGGAAAACTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 506}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994163169_994163175 26 Left 994163169 5:96579651-96579673 CCACACCAGTTTTCCTTGTTCTT 0: 1
1: 0
2: 6
3: 51
4: 506
Right 994163175 5:96579700-96579722 CATCTCTTGAGTAATTTCAAGGG No data
994163169_994163174 25 Left 994163169 5:96579651-96579673 CCACACCAGTTTTCCTTGTTCTT 0: 1
1: 0
2: 6
3: 51
4: 506
Right 994163174 5:96579699-96579721 CCATCTCTTGAGTAATTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994163169 Original CRISPR AAGAACAAGGAAAACTGGTG TGG (reversed) Intronic
901115838 1:6842942-6842964 AAGCAAAAGGAAATCTGGAGGGG + Intronic
901496354 1:9624564-9624586 AGGAAAAAGGAAAAGCGGTGAGG - Intergenic
901811624 1:11770123-11770145 AAAAAAAAGGGAAAATGGTGTGG + Intronic
902439172 1:16418071-16418093 AAGGACAAGGAAAGCCGGGGAGG - Intronic
902648043 1:17817677-17817699 AAGAAAAAAGAAAAGTGGTTGGG - Intronic
903571107 1:24306131-24306153 AAGAACAGGCAAAACTATTGTGG - Intergenic
903865095 1:26392100-26392122 AAGAGCAAGGAAAGTTGGTGGGG + Intergenic
904819086 1:33228947-33228969 AAGAGCAAGGAAGGCTGGGGTGG - Intergenic
905543542 1:38779507-38779529 ATCACCAAGGAAAACTAGTGGGG + Intergenic
905719973 1:40190012-40190034 AATAGGAAGGAAAACAGGTGAGG - Intronic
905976011 1:42174123-42174145 AAGAACTAGAAAAACTGGCCGGG - Intergenic
906092945 1:43198159-43198181 AAGAACAAAGAAAACAGTAGGGG - Intronic
906351234 1:45061730-45061752 AAAAAAAAAAAAAACTGGTGAGG - Intronic
906749168 1:48243167-48243189 AATAATAAAGAAAAGTGGTGGGG - Intronic
907775072 1:57506328-57506350 AAGAATAAGCAAAACTGATCAGG - Intronic
907802293 1:57781723-57781745 AAAAAAAAGCAAAACTGTTGTGG + Intronic
908278341 1:62500874-62500896 AAGAACTTGGAAAACTGGCTGGG + Intronic
908821836 1:68094866-68094888 AAAAACAAGCAAAACTGGCCAGG - Intergenic
909427942 1:75549418-75549440 AAGAAGAAGGAAGAGTGGGGCGG - Intronic
909809033 1:79907556-79907578 AAGACAAAGAAAAACTGGTTAGG + Intergenic
910891257 1:92022783-92022805 AATAAGAAGGAAAACTGGGGTGG + Intergenic
910932420 1:92455690-92455712 TAGAACAAGGAAAAATGGGGAGG + Intergenic
911467644 1:98275299-98275321 AAGAACATGGAAATGTGGAGGGG + Intergenic
911880623 1:103234467-103234489 AAGAACAAGAAAAGTTGATGTGG + Intergenic
913177780 1:116290884-116290906 AATAAAAAGGAAAACTGAAGAGG + Intergenic
913496604 1:119433519-119433541 AAGAACAAGGAAACCTGACCTGG + Intergenic
913567067 1:120082983-120083005 GAGAACAAAGAAAAATGTTGTGG + Intergenic
913631064 1:120710566-120710588 GAGAACAAAGAAAAATGTTGTGG - Intergenic
914287819 1:146243689-146243711 GAGAACAAAGAAAAATGTTGTGG + Intergenic
914404217 1:147354790-147354812 AAGACAAAGGAATACTTGTGTGG + Intergenic
914548853 1:148694435-148694457 GAGAACAAAGAAAAATGTTGTGG + Intergenic
914617828 1:149377283-149377305 GAGAACAAAGAAAAATGTTGTGG - Intergenic
914855086 1:151344881-151344903 AAGAACCAGGACAACTGTTAGGG - Intronic
914949561 1:152100629-152100651 AAGAAGATGGAAAACTGGCCGGG - Intergenic
915973498 1:160370418-160370440 AAGAACAGCAGAAACTGGTGGGG - Intronic
916015324 1:160744298-160744320 AAGCAGAAGCAAAACTGGTTAGG + Intronic
916485312 1:165253648-165253670 AAGGGCAAGGAGGACTGGTGTGG - Intronic
916824138 1:168428214-168428236 CAGAAAAAGGAAAAGTGGAGAGG + Intergenic
917424841 1:174902788-174902810 GAGAACAAAGAAAAGTAGTGTGG - Intronic
918968955 1:191387930-191387952 AAGTACAAAGAGAAGTGGTGTGG + Intergenic
919020546 1:192099739-192099761 AAGATGAAGGAATACTGGAGTGG + Intergenic
919491021 1:198204925-198204947 AAGAAGAAGGAAAATTGGGAGGG - Intronic
919546803 1:198932906-198932928 GAAAACAAGGGAAACTGGTTTGG - Intergenic
920824655 1:209413999-209414021 AAAGAGAAGGAAAACGGGTGGGG + Intergenic
921144808 1:212343886-212343908 GAGCAAAAAGAAAACTGGTGGGG + Intronic
921365727 1:214371877-214371899 AGGAACAAAGAAAATTGGGGAGG - Intronic
921483816 1:215693274-215693296 AAGAAAATGGTAAACTGGTTGGG - Intronic
921488147 1:215740532-215740554 AAACAGAAGGAAAACTGGAGAGG + Intronic
921692495 1:218165824-218165846 AAGAGAAAGAAAAAATGGTGGGG - Intergenic
922294959 1:224241874-224241896 AAGAAAAAGAAAAACAGGTGTGG + Intronic
923129837 1:231065635-231065657 AAGAACAAAGAAAACAGCTGGGG + Intergenic
923537503 1:234864322-234864344 AAGAAATAGGAACACTGGAGTGG - Intergenic
1062910274 10:1207876-1207898 AAGAATGAGGAAAACTGCAGAGG - Intronic
1063505055 10:6590274-6590296 AAGAACAAGCAGGAGTGGTGAGG + Intergenic
1063631375 10:7736667-7736689 AATAAGAAGTAAAACTGGAGTGG + Intronic
1064859049 10:19805306-19805328 CATAACAATGAAACCTGGTGAGG + Intergenic
1065587431 10:27233432-27233454 AAAAAAAAAAAAAACTGGTGTGG + Intronic
1066084932 10:31967059-31967081 AAGAAGAAGGAATACTGGCTGGG - Intergenic
1067927183 10:50521602-50521624 AAGACAAAGGAAAGCTGGTGTGG - Intronic
1068231906 10:54178612-54178634 AAGAACAATGAAAAGAAGTGGGG + Intronic
1069111199 10:64449057-64449079 AAAAAAAAGGAAAACTTTTGTGG - Intergenic
1069362973 10:67664611-67664633 AAGAAGAAAGAAAACAAGTGTGG - Intronic
1070072236 10:73101077-73101099 AATAATAAGGAAACCAGGTGTGG + Intergenic
1070088238 10:73257367-73257389 AAGAATAATATAAACTGGTGGGG - Intronic
1070247321 10:74744551-74744573 AAGAATGAGGAGAAGTGGTGCGG - Intergenic
1071016425 10:81002284-81002306 ACAAACAAAGAAAACTAGTGGGG - Intergenic
1071227029 10:83542619-83542641 AAGACAAAGCAAAAATGGTGGGG + Intergenic
1071413499 10:85420003-85420025 GAGAACAAGCAATTCTGGTGGGG - Intergenic
1071421993 10:85510143-85510165 AAGAGAAAGGCATACTGGTGAGG + Intergenic
1071678341 10:87678774-87678796 AAAAAAAAGTAATACTGGTGAGG + Intronic
1072881569 10:99233994-99234016 AAAAAGAAAGAAAGCTGGTGGGG + Intronic
1072896190 10:99368904-99368926 ATGCACATGGAAAAATGGTGGGG + Intronic
1072925984 10:99617527-99617549 AAGAAGAAGGATAGCTGCTGGGG + Intronic
1072975465 10:100053629-100053651 AAGAAAAAGAAAAAAAGGTGGGG + Intronic
1073897390 10:108178810-108178832 AGGATCTAGGAAAACTTGTGTGG + Intergenic
1073926529 10:108522378-108522400 AGGAAAAAGAAAAACTGGTTTGG - Intergenic
1075508086 10:123043748-123043770 AAGAATGAGGAAAACAGTTGGGG - Intronic
1075849604 10:125576091-125576113 AAGAACTGGGAACACTGGTGTGG - Intergenic
1076382109 10:130030882-130030904 AAGAAAAAAGAAAACTGGAGTGG - Intergenic
1076428978 10:130388445-130388467 AGGAACAGGGAAGACAGGTGAGG - Intergenic
1077116276 11:886162-886184 AAAAAAAAGGAAAAATGGCGGGG + Intronic
1077786403 11:5389198-5389220 AATACAGAGGAAAACTGGTGAGG + Intronic
1078343566 11:10522017-10522039 TAGAAAGAGGAAAACTGGTTAGG + Intronic
1078788205 11:14517297-14517319 AAGCACAAAGAAAACAAGTGTGG + Intronic
1079089015 11:17467773-17467795 TAGAACAGGGAAAAGTGGAGGGG - Intronic
1079720379 11:23804478-23804500 CAGAAGAAGGAAAACTCTTGAGG - Intergenic
1079727886 11:23898958-23898980 AAAAACAAGGAAAGCTGGCAGGG + Intergenic
1081352293 11:42069006-42069028 AAGAAGAAGGAAAAGAAGTGAGG + Intergenic
1082079296 11:47999778-47999800 AAGGAGAAGGAAAACTAGGGGGG + Intronic
1082661300 11:55914574-55914596 AAGAACAAGGAAGAATGGACTGG - Exonic
1083594870 11:63914411-63914433 AAGGACAAAGAAGACAGGTGGGG - Exonic
1084306866 11:68291386-68291408 AATAATAAGGAAACCGGGTGTGG + Intergenic
1085095786 11:73760193-73760215 AAGAGCAAGGAATAAGGGTGGGG + Intronic
1085132491 11:74053287-74053309 AAAAACAAGAAAAACTGATACGG + Intronic
1085847412 11:80082086-80082108 TGGAACAAGGAAAACTGGGCTGG + Intergenic
1085948571 11:81302068-81302090 AAGAAGGAGTCAAACTGGTGAGG + Intergenic
1086615119 11:88807458-88807480 AAGAAAAAGAGAAACTGGTTAGG + Intronic
1086762498 11:90650266-90650288 AAAAACAACAGAAACTGGTGAGG + Intergenic
1087379439 11:97385998-97386020 AAGAACAATGTCAACTGGAGTGG + Intergenic
1087390868 11:97532067-97532089 ATGAAAAAGATAAACTGGTGAGG - Intergenic
1088047599 11:105472714-105472736 AAAAAGAAAGAAAAGTGGTGGGG + Intergenic
1088184210 11:107146214-107146236 AACAACAAGAAAACCTGGGGAGG - Intergenic
1088310452 11:108454748-108454770 AAAAACAAGAAAATCAGGTGTGG - Intronic
1089644562 11:119870103-119870125 ATGACTAAGAAAAACTGGTGAGG - Intergenic
1089769533 11:120793414-120793436 AAGAAGAAGGAGGCCTGGTGAGG + Intronic
1089812994 11:121147061-121147083 AAGAATAGGAAAAACTTGTGGGG + Intronic
1089877403 11:121738220-121738242 AAGAAAAAGGAAGACTGGGCCGG - Intergenic
1090820077 11:130334133-130334155 AACAACAATGAACACTGGTGAGG - Intergenic
1090861842 11:130660992-130661014 AATAACAGGGGAAACTGGTAGGG - Intergenic
1091572787 12:1704007-1704029 AAAAAAAAAAAAAACTGGTGGGG - Intronic
1092020766 12:5200627-5200649 AAGAACAAGGTAAATTGTTCTGG - Intergenic
1092245952 12:6864273-6864295 AAGACCAAAGACAACAGGTGTGG + Intronic
1092733118 12:11553114-11553136 CACAACAAGGAAACTTGGTGGGG + Intergenic
1093237951 12:16635134-16635156 GAGAACAAGAAACACTTGTGAGG + Intergenic
1093898287 12:24601108-24601130 AAGAACAGGAAACACTGTTGAGG + Intergenic
1095325959 12:40892940-40892962 AAGAAAAATGAAAACTGGGGGGG + Intronic
1095341918 12:41100176-41100198 AAGAAAGAGGAGAACTGGTTTGG + Intergenic
1095508026 12:42919193-42919215 AAGAATAAGGCAAATTTGTGTGG - Intergenic
1095538746 12:43283309-43283331 AAGAATATGAAACACTGGTGGGG - Intergenic
1095682040 12:44988639-44988661 AAAAGCAAGTAAAAATGGTGTGG - Intergenic
1096231502 12:49899302-49899324 AAGATCATGGAAACCTAGTGGGG - Intronic
1096592142 12:52667316-52667338 AAGATCAAGGAAGACGGCTGAGG - Intergenic
1096737870 12:53669976-53669998 AAGGTCAAGGAAGACTGGAGAGG + Intronic
1097205316 12:57316204-57316226 AAGAACAGGGAAGTCTGGGGAGG - Intronic
1097484722 12:60181659-60181681 AATAAAAAAGAAAACTGGTTGGG - Intergenic
1098030055 12:66244160-66244182 AAGCACAAGGAAAGCTGTTTTGG + Intronic
1098818518 12:75200003-75200025 AATAACATGTAAAACTAGTGGGG + Intronic
1098925030 12:76339999-76340021 AGCAACAAGGAAAAGAGGTGGGG - Intergenic
1099020668 12:77400382-77400404 AATAAAAAGGAAAAATGGTCAGG - Intergenic
1099226690 12:79978774-79978796 AAGAACAAAAAAAATGGGTGGGG - Intergenic
1099324549 12:81197801-81197823 AAATACAAGGAAAAATAGTGAGG - Intronic
1099484161 12:83207661-83207683 TAAAAAAAGGAAAATTGGTGAGG + Intergenic
1100317010 12:93453840-93453862 AAGAAAAAAGAAAACTTGGGAGG - Intergenic
1101450380 12:104771982-104772004 CAGAACAAGGAATACAGCTGGGG - Intergenic
1101524948 12:105520091-105520113 GAGATCCAGGAAAACTAGTGGGG + Intergenic
1101871647 12:108570726-108570748 AATCACAAAGAAAAGTGGTGGGG - Intergenic
1102057353 12:109906624-109906646 AAGAAGAAAAAAAACAGGTGTGG + Exonic
1102238075 12:111307172-111307194 AAGAGCAAAGAAAGATGGTGAGG - Intronic
1102286806 12:111664333-111664355 AAAAAAAAGTAAAACTGGAGTGG + Intronic
1103858360 12:123990902-123990924 AGGAACAAGGAACACCGATGAGG - Intronic
1103982091 12:124743091-124743113 ATGAAGAAGGAAAGCTGGGGAGG - Intergenic
1103988626 12:124783809-124783831 AAAAACAAAAAAAACTGGTAAGG + Intronic
1105753616 13:23444687-23444709 AAAAACAAGGAGAACTGGTGTGG + Intergenic
1106279074 13:28247069-28247091 AAAAATAATGAATACTGGTGAGG - Intronic
1106347602 13:28894261-28894283 AAGAAGAAGGAGAGTTGGTGGGG + Intronic
1106749437 13:32745188-32745210 AAGAAGAATGAAAGCAGGTGTGG - Intronic
1107135663 13:36941240-36941262 AAGAAGAAGGCAAACTGGCTAGG - Intergenic
1107417379 13:40213125-40213147 AAGAAGAAAGAAAAATGGTCTGG + Intergenic
1107904698 13:45051278-45051300 AAGGAGAAGGGAGACTGGTGAGG - Intergenic
1107999397 13:45892491-45892513 AAGACCCAGGAACACTGGGGTGG + Intergenic
1108119252 13:47165324-47165346 AATAGCAAGAAAAACTGTTGGGG + Intergenic
1108871627 13:54993834-54993856 AAGAAAAAGAGAAAGTGGTGAGG + Intergenic
1109366065 13:61357520-61357542 TAAAACAAGGAAAATTGCTGAGG - Intergenic
1109876695 13:68414950-68414972 AAGAACAAAAAAAAATGATGGGG - Intergenic
1110117288 13:71835067-71835089 AAGAACAATGAATTTTGGTGGGG - Intronic
1110345740 13:74445850-74445872 ACGAACAAGGAAGAATTGTGTGG + Intergenic
1110408920 13:75183074-75183096 AAGAAGAAGGCAAACTTGTTTGG + Intergenic
1110509510 13:76332922-76332944 AATAATAAGGGAAACTGGGGTGG - Intergenic
1110536956 13:76661656-76661678 ATGAACAAAGAAAAGTGGTAAGG + Intergenic
1110664187 13:78096567-78096589 GAGAACCAGGAAAGCTGGTGGGG - Intergenic
1112249096 13:97762531-97762553 GAGAGCCAGAAAAACTGGTGGGG + Intergenic
1112595214 13:100801721-100801743 AAGAACAAGGGAAAAAGGGGAGG + Intergenic
1112802658 13:103129712-103129734 GAGAACCAGGGAAAATGGTGTGG - Intergenic
1113394005 13:109927147-109927169 CAGAACAAGGAAAATTACTGAGG + Intergenic
1114906308 14:27131632-27131654 GAGAGCAAGAAAAACTGATGTGG - Intergenic
1115031538 14:28801523-28801545 ATGGACAAGGCAAACAGGTGAGG - Intronic
1115906134 14:38205290-38205312 AAGAAAAAGGAAAACTGATATGG - Intergenic
1116664086 14:47752593-47752615 AATATTAAGGAAAAGTGGTGAGG - Intergenic
1117106769 14:52405429-52405451 AAGAACAAAGAAGAAGGGTGGGG + Intergenic
1117375544 14:55115385-55115407 AAGAACAAAAAAACGTGGTGAGG + Intergenic
1120604648 14:86559401-86559423 AAGAACCAGGAAAGCCAGTGAGG + Intergenic
1120836031 14:89039161-89039183 AAGAAAAAGGCACAATGGTGTGG + Intergenic
1120886255 14:89454011-89454033 AAGAAGAAGAAGGACTGGTGTGG + Intronic
1121305761 14:92906074-92906096 AAGACCCCAGAAAACTGGTGGGG + Intergenic
1122737644 14:103852606-103852628 AAAAACAAGGAAAGCTGGCGAGG - Intergenic
1123138986 14:106056793-106056815 AAGAACAAGAGAAAATGTTGAGG - Intergenic
1123197738 14:106632453-106632475 AAGAACAAGAGAAAATGTTGAGG - Intergenic
1124607293 15:31179301-31179323 AAGATGAAGGCAAACTGGTTGGG + Intergenic
1125003162 15:34792588-34792610 AAGAACAAGGTAAATTCCTGAGG + Intronic
1125296255 15:38206726-38206748 AATAAGAAGCAAAACTAGTGAGG - Intergenic
1125385988 15:39137040-39137062 GAGAAAAGGGAAAACTGGTTTGG - Intergenic
1125538492 15:40456505-40456527 AAGGACACGGAAAACTGGAAAGG - Intronic
1126224370 15:46253251-46253273 AAGAACAAGGAAACATTTTGAGG + Intergenic
1127035929 15:54917705-54917727 AAGTACAAGGAAGCCTGGTGTGG - Intergenic
1127622479 15:60747249-60747271 AGAAACAAGGCAAGCTGGTGAGG + Intronic
1128010267 15:64287919-64287941 AAGGACAAAGAGAACAGGTGAGG + Intronic
1128030241 15:64473594-64473616 AAGAAAAAGGCTAACTAGTGAGG - Intronic
1128247127 15:66140723-66140745 AAGAAAAAGGAATAGGGGTGGGG + Intronic
1129557836 15:76531986-76532008 GAGAGCAAGGATACCTGGTGGGG - Intronic
1129783749 15:78293579-78293601 AAAAACAAGTAAAACCAGTGGGG + Intronic
1130223633 15:82042788-82042810 AAGAAAATGGAAAACTTGTGGGG + Exonic
1130976165 15:88776853-88776875 AAGAACAAGGAAGCTTTGTGAGG + Intergenic
1132023194 15:98382503-98382525 AAGGACAAGGAGATCTGATGAGG + Intergenic
1132077784 15:98837226-98837248 ACAAACAAACAAAACTGGTGGGG - Intronic
1133616871 16:7485369-7485391 AAGTACAAGGTAAACTGCAGAGG - Intronic
1135898438 16:26431966-26431988 AAGAATGATAAAAACTGGTGTGG + Intergenic
1135947790 16:26880347-26880369 AAGAATAAGGAAAACTGAGGAGG - Intergenic
1136452174 16:30359615-30359637 AAGAACAAGGAGGAGGGGTGGGG + Intronic
1137523600 16:49214223-49214245 AACAGCAATGAAAACTGGTGTGG + Intergenic
1137637008 16:49995714-49995736 AAGAAGAAGGCAAACTGGTCTGG + Intergenic
1137793309 16:51193711-51193733 AAGATGGAGGAAAACTTGTGGGG + Intergenic
1139218923 16:65158805-65158827 AACAATAAGGATAAATGGTGAGG + Intergenic
1139427925 16:66894663-66894685 AAAAGCAAGGAAAGTTGGTGAGG + Intronic
1140102851 16:71933358-71933380 TTGAACAAGGAAAATTGGGGGGG - Intronic
1140643952 16:77009736-77009758 AAGGACAAAGCAAACAGGTGGGG - Intergenic
1141034256 16:80614205-80614227 AAGAAGAGGGAAAACAGGTTTGG - Intronic
1142967995 17:3592755-3592777 CAGAACAAGGAAAACGGCCGGGG + Intronic
1143850040 17:9804096-9804118 AAGGACAAGGAGAATTGGAGAGG + Intronic
1144284160 17:13756505-13756527 AAGACCAAGGAAAATAGGTTAGG + Intergenic
1144768269 17:17744806-17744828 AAAAAAAAGGAAAACTGTAGAGG + Intronic
1144776455 17:17787375-17787397 AAGAAAAGGGAAAAAGGGTGGGG - Intronic
1145114014 17:20191370-20191392 AAGAACACCAAATACTGGTGAGG - Intronic
1145286557 17:21510527-21510549 AATAACAAAAAAAACTGGGGTGG - Intergenic
1149403282 17:56321113-56321135 AAGAAAAAAGAAAAGGGGTGGGG - Intronic
1149496795 17:57123580-57123602 TAAAACAAGGAAAACTGGCCAGG + Intergenic
1149596145 17:57865803-57865825 AAGAAAAAGAAAAACTGAGGTGG - Intronic
1150590505 17:66558353-66558375 AAAAACAAGGAGTACTGGTAAGG + Intronic
1150937666 17:69654810-69654832 ATGAAAAAGAGAAACTGGTGGGG - Intergenic
1151263042 17:72931609-72931631 AAGAATAAGGACACCTGGGGAGG - Intronic
1151530414 17:74700762-74700784 AACAACAAAAAAAACTGTTGTGG + Intronic
1151976880 17:77488305-77488327 ATCAACAACGAGAACTGGTGAGG + Exonic
1153162776 18:2227618-2227640 AAGAACAAAGAAAAAAGGTGAGG + Intergenic
1153571413 18:6476957-6476979 AAGAGCAGGGAAAGGTGGTGTGG + Intergenic
1153703580 18:7721916-7721938 AGAACAAAGGAAAACTGGTGGGG - Intronic
1155325285 18:24658437-24658459 AAGAGCAAGGACAGTTGGTGGGG + Intergenic
1155709702 18:28860993-28861015 AACAACAAGGAAATCTGAAGAGG - Intergenic
1156181756 18:34612755-34612777 AAGAACAAGGCACATTGGTGGGG - Intronic
1156199774 18:34817675-34817697 CAGAGAATGGAAAACTGGTGTGG - Intronic
1156368915 18:36455059-36455081 AAGAACAAAGAAAGCTGGAGAGG + Intronic
1157209158 18:45726805-45726827 AAGGCCAAGGGAAACTGCTGTGG + Exonic
1157775342 18:50390609-50390631 AAGACAAAGGAGAACTGATGGGG - Intronic
1158141266 18:54259007-54259029 AACAACAGGGGAAACTGGTAAGG - Intergenic
1158568926 18:58580172-58580194 AGGAACAAGGCACACTGGAGAGG - Exonic
1159269248 18:66127832-66127854 ACCAACAAGGACAAATGGTGTGG - Intergenic
1160203491 18:76814393-76814415 AAGAAGCAGGGAAACTGGTGGGG + Intronic
1161812162 19:6477114-6477136 ACGAAGCAGGAAAGCTGGTGGGG + Exonic
1162234555 19:9297719-9297741 AAGAACAAGGAAAATGCGAGAGG + Intronic
1162732191 19:12725072-12725094 AAGAAATAGGAAAACTGGGCCGG - Intergenic
1163145043 19:15374153-15374175 ACGGAGAAGGAAAACGGGTGTGG + Intronic
1163914897 19:20232502-20232524 TAGAACAAAGAAAAGTGATGGGG + Intergenic
1164743065 19:30590948-30590970 AAGACCAAGGACTTCTGGTGTGG + Intronic
1165182650 19:33985914-33985936 GAGAAAAAGGAAAACTTGGGAGG - Intergenic
1166239422 19:41479898-41479920 GAGAACAAAGAAAACAGGGGTGG + Intergenic
1168051152 19:53830922-53830944 TAGAAGCAGGAAAGCTGGTGTGG + Intergenic
925192895 2:1899578-1899600 AAGAACAGGGAAAGCTGCGGGGG - Intronic
927033162 2:19143464-19143486 AAGAATAGGGAAAAATAGTGTGG + Intergenic
927251557 2:20999302-20999324 AAGAACAAGGGATCCTTGTGGGG - Intergenic
927299099 2:21490237-21490259 AAAAAGAAGGAATACAGGTGTGG - Intergenic
927647115 2:24884977-24884999 AAGAAGAAGGAAAATTGGAAAGG - Intronic
928252027 2:29689458-29689480 AAGAACATGGCAAACTTTTGGGG + Intronic
928322043 2:30291636-30291658 AATAATAAGGGAAACTAGTGGGG + Intronic
928665841 2:33549943-33549965 AAAAACAGGGAAGGCTGGTGAGG + Intronic
928674221 2:33634818-33634840 AAGAAAAAAGAAAAGAGGTGGGG - Intergenic
929225889 2:39511326-39511348 AAGTCCAAGGAAACCAGGTGAGG - Intergenic
929284488 2:40119864-40119886 AATAAGAAGGAAGACTGTTGAGG + Intronic
929613624 2:43290895-43290917 AAGGACATGTAAAACAGGTGGGG + Intronic
930204268 2:48572619-48572641 AGCTACAAGGAAAACTGATGAGG + Intronic
931263773 2:60642403-60642425 AAATAAAAGGAAAACTGGTTGGG - Intergenic
932153515 2:69394341-69394363 AAGAACAAGGAGGAAAGGTGTGG - Intergenic
932744465 2:74321380-74321402 AAGAAGAAGGAAAAGTGAAGAGG - Intronic
933015645 2:77123017-77123039 AAGAACAAAGAAAAATGATTAGG + Intronic
933223628 2:79719545-79719567 AAAAACAACAGAAACTGGTGAGG - Intronic
933634901 2:84698210-84698232 AAAAACAAGGAAAAAAGCTGGGG - Intronic
934118036 2:88814097-88814119 AAGAGAGAGGAAAACTGGGGTGG + Intergenic
934882677 2:97996844-97996866 AAGAAAAAGAAAAATTGGCGTGG - Intergenic
935263223 2:101372660-101372682 AAGAAGCAGGAAAACTGCTGAGG - Intronic
935474208 2:103498170-103498192 AAGAAAAAGTAAGACTGGTGAGG + Intergenic
937353027 2:121179222-121179244 AAGAACAATAAAAACTGGGAAGG + Intergenic
939371176 2:141302363-141302385 AAGAACAAGGAATACTGTTTGGG - Intronic
939659180 2:144867154-144867176 AAGAACAATGCATACTAGTGAGG + Intergenic
939830094 2:147061392-147061414 AAGAAGCAGGAAAGCTGGGGAGG - Intergenic
940041047 2:149361168-149361190 TAGAACAAAGAAAGCTGTTGGGG + Intronic
942553268 2:177143851-177143873 AAAAAAAAGGAAGACTGGAGAGG + Intergenic
942562481 2:177235279-177235301 AACAACAACAACAACTGGTGTGG + Intronic
942799128 2:179856546-179856568 AAGCAGTAGGAAAACAGGTGGGG + Intronic
942807444 2:179948748-179948770 AAGAACAAGGAAAGCCCGAGAGG + Intronic
942886225 2:180927232-180927254 AAGAAAAAGGAAAACTCCTTTGG - Intergenic
942887997 2:180952239-180952261 GAGAACAAATAAAACTGGTATGG - Intergenic
943168972 2:184371300-184371322 AAGAACAAGGAAGTCTTCTGTGG - Intergenic
943593500 2:189827851-189827873 GAGAAGGAGGAAAACTGGAGGGG + Intronic
943621750 2:190156032-190156054 TGTAAAAAGGAAAACTGGTGAGG + Intronic
944069051 2:195649810-195649832 AAGATGAAGAAAAACAGGTGTGG - Intronic
944255556 2:197619929-197619951 AAAAACAAGGTAAAATAGTGTGG + Intronic
944833297 2:203554498-203554520 AAAAACAAGGAACACTTGTTTGG + Intergenic
945546209 2:211155299-211155321 AAGACCAAGGAAAAATGGGATGG - Intergenic
945633663 2:212318944-212318966 GAGAACACTGAAAAATGGTGAGG - Intronic
945924766 2:215791917-215791939 AAGAAAAAAGAAAAGTGCTGGGG - Intergenic
946093719 2:217253418-217253440 AAGATAAAGGAAGAGTGGTGGGG - Intergenic
946231547 2:218294488-218294510 AAAAAAAAGGAAGGCTGGTGGGG - Intronic
946509033 2:220334678-220334700 AAGTAAAGGGAAAAATGGTGAGG - Intergenic
946884428 2:224208973-224208995 TAAAACAAGGAAAACAGCTGTGG - Intergenic
947450811 2:230206939-230206961 AAGTACCAGGAAAACTGGAGTGG + Intronic
947718713 2:232354651-232354673 AAAAACAAACAAAGCTGGTGGGG + Intergenic
948266900 2:236641603-236641625 AAGATTAAGGAACACTGATGTGG - Intergenic
948293854 2:236846793-236846815 AAGAAGAAGGCAAAGGGGTGAGG + Intergenic
948798943 2:240421469-240421491 AAGCACAAGCAACACTGATGCGG + Intergenic
1169586980 20:7096342-7096364 AAGAAAAAGGAAACGTGGGGAGG + Intergenic
1169677651 20:8172704-8172726 AAGAACAAAGAAAAATGTTCAGG - Intronic
1170117136 20:12872618-12872640 GAGAACAGGGAAAAATAGTGAGG - Intergenic
1170950104 20:20928761-20928783 AAAAACAAGCAAAACTGGCCAGG - Intergenic
1171472650 20:25384309-25384331 AAAAACAAAAAAAACTGGTTTGG + Intronic
1171943726 20:31356025-31356047 AAAAAGAAAGAAAACTGGAGTGG + Intergenic
1172815676 20:37684010-37684032 AAGAAAAAGAAAAGCTGGTCAGG - Intergenic
1173257459 20:41405054-41405076 AAGCACAACGAAAAGTGGTACGG - Exonic
1174527118 20:51181557-51181579 AACAGCAAGGACAACAGGTGTGG + Intergenic
1174698455 20:52583689-52583711 AAGGACAGGGAAAGCTGGAGTGG + Intergenic
1174930917 20:54813771-54813793 AAGAAAAAGGAAAACTAGCCAGG - Intergenic
1175031407 20:55958273-55958295 TAGAAGAAGGAAGCCTGGTGAGG + Intergenic
1175527816 20:59647617-59647639 AAGAACACAGGAAACTAGTGGGG - Intronic
1176202432 20:63867931-63867953 AAAAAAAAGAAAAACTGGTCGGG - Intronic
1177062172 21:16389415-16389437 AAGAAAATGGATAACTTGTGTGG - Intergenic
1177506303 21:22022757-22022779 AATAACATGGAAAACAGATGAGG - Intergenic
1178124188 21:29499571-29499593 AAAAACAGGAAACACTGGTGTGG + Intronic
1178806755 21:35845799-35845821 AAGAAGGAGGAAAACTAGAGAGG - Intronic
1179966563 21:44810247-44810269 AAGGACAAAGAAAACGGGAGTGG + Intronic
1180130098 21:45821599-45821621 AAGAACCAGGGAGACAGGTGAGG - Intronic
1180179892 21:46113330-46113352 AAGAGCAAGGGGCACTGGTGAGG - Intronic
1182575231 22:31268424-31268446 ACGGACAAGGCAAACTGGAGAGG + Intronic
1182833021 22:33319102-33319124 AAGGACAAGGATATCTGGGGTGG - Intronic
1184624508 22:45713709-45713731 AAGAACTAGGTAAACGGCTGGGG - Intronic
949781252 3:7691387-7691409 AAGAAAAAGAAAAACTGGACTGG + Intronic
950399035 3:12756500-12756522 AGGGACAAGGAAAACTAGAGGGG + Intronic
950834433 3:15905692-15905714 TAGTACAAGGAAAACTGGGGTGG - Intergenic
951179457 3:19641933-19641955 AAGAACAAAGAGAAGAGGTGGGG + Intergenic
951585756 3:24213130-24213152 AAGAACAGAGAAAACTGATTAGG + Intronic
951811705 3:26707768-26707790 AAGAAAAAAAAAAACAGGTGTGG - Intronic
951966088 3:28386914-28386936 AAGGAGAAGGAGAATTGGTGGGG + Intronic
952039306 3:29242137-29242159 AAAGGCTAGGAAAACTGGTGTGG + Intergenic
952147107 3:30545315-30545337 CAGAACAAAGAAAAGTGTTGGGG + Intergenic
952624552 3:35388640-35388662 AATAAAAAGGAAAAATGGTGGGG + Intergenic
953230407 3:41059594-41059616 AAAAACAATGAATACTGGCGAGG - Intergenic
953300115 3:41765562-41765584 TAAAAAAAGGAAAACTGTTGTGG + Intronic
953498332 3:43408013-43408035 CAGCAAAAGGAAAACTGGAGTGG + Intronic
954204013 3:49044161-49044183 AGGAACAAGCAGAACTAGTGGGG - Intronic
954426681 3:50447113-50447135 AAGAAGAAGGAAGGCTGGTGAGG + Intronic
954834126 3:53450143-53450165 AAGAGCAAGGAAAACAGATAAGG - Intergenic
955655533 3:61241108-61241130 TAGAACAACAAAAAATGGTGGGG - Intronic
956578174 3:70779310-70779332 AAGAAGAAAGAAGACTGGTGAGG - Intergenic
956928285 3:74013268-74013290 AAGAACAAGAAAGTCTGGTTTGG + Intergenic
957347827 3:78984644-78984666 AAGAACAAGGAAAACCTTTCTGG - Intronic
958439085 3:94133955-94133977 AAGAGCAAGGGACACTGGTAAGG + Intergenic
959031570 3:101305553-101305575 AATAACAGGGAAAAGTGGTGGGG + Intronic
959287383 3:104433430-104433452 AGAAACAACGAACACTGGTGAGG + Intergenic
959804426 3:110533769-110533791 AGGAACAAGAAAAAGTGGGGAGG - Intergenic
959804618 3:110536221-110536243 AAGAAAAACAAATACTGGTGAGG + Intergenic
962793181 3:138829792-138829814 AAGAAGAAAGAAAACTGCTAGGG + Intronic
963017854 3:140842635-140842657 AAGCACCAGGGAAGCTGGTGGGG - Intergenic
963193510 3:142500594-142500616 AAGAGCAAGGAAAACTTTTGAGG - Intronic
963749775 3:149164587-149164609 AAGACCAAAGAAAACAGATGTGG - Intronic
964193983 3:154040249-154040271 AAGAAAAAAGAAATCTGTTGAGG + Intergenic
964466570 3:156999416-156999438 AAGAGAAAGGAAAACGGGAGGGG - Intronic
964622371 3:158730745-158730767 AAGAAAAAGGCAACCTGCTGGGG - Intronic
964952005 3:162307350-162307372 AAGAAGAATGAAAAATAGTGAGG - Intergenic
965024038 3:163275322-163275344 AGGAACAAGGAAAAAAGGAGAGG + Intergenic
965565376 3:170110809-170110831 AAGAACATGGAAATCTGCTTAGG - Intronic
966672177 3:182539642-182539664 AAGTACAAGGATTACAGGTGTGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967052016 3:185793659-185793681 GAAAACAAGGAAAACTTGAGAGG + Intronic
967113825 3:186318861-186318883 AAAACCAAGGGAAACTGGTATGG - Intronic
967754148 3:193149580-193149602 AAGAGCCAGGAAAGCTGCTGTGG - Intergenic
967755303 3:193161882-193161904 AAGAAGAAAGAAACCTGGTTAGG - Intergenic
967782314 3:193453590-193453612 AAAAACAAGGAAAACTTCTGAGG - Intronic
968402073 4:306555-306577 AAGAACAAGGAAGTCTTCTGTGG + Intergenic
970694572 4:18662368-18662390 AATAACAACAAACACTGGTGAGG + Intergenic
971007504 4:22391563-22391585 AAGAACAAGGAATTCTGCTGAGG - Intronic
971301067 4:25442822-25442844 CTGAACAAGGGAAGCTGGTGAGG + Intergenic
971491390 4:27215751-27215773 AAGAACAAGTAAGTCTGCTGGGG - Intergenic
973189194 4:47367870-47367892 AAGGACAAGGGCAACTTGTGGGG - Intronic
973645668 4:52949086-52949108 GAGAACATGGAGCACTGGTGAGG - Intronic
974382354 4:61157326-61157348 AAGAACATGGAATAATGGGGAGG + Intergenic
974846771 4:67360960-67360982 TAGAACAAAGAAAATGGGTGGGG - Intergenic
975130915 4:70831902-70831924 AAAAAAAAAAAAAACTGGTGGGG - Intronic
975388354 4:73785790-73785812 AAGAAAAAAAAATACTGGTGAGG + Intergenic
978358581 4:107904337-107904359 AAGAACAAGGAGGACAGGGGAGG - Intronic
978447701 4:108796205-108796227 AGGAACAAGGCATAGTGGTGGGG + Intergenic
978553865 4:109957827-109957849 AAGGCCAAGGAAAACTATTGGGG - Intronic
978672912 4:111272720-111272742 AACAACAAGCAAAATTGGTGAGG - Intergenic
981009138 4:139906544-139906566 AAGAACAAGGAATGATGGTTAGG + Intronic
981637342 4:146895799-146895821 AAGCACAAGGGAAAATGATGGGG - Intronic
982235776 4:153249730-153249752 TTAAACAAGGTAAACTGGTGAGG + Intronic
982432090 4:155335109-155335131 AGGAACAAAGAAAATTGGAGAGG - Intergenic
982796412 4:159650561-159650583 AAGCACAAGGAAAATTTGAGAGG - Intergenic
983769291 4:171528602-171528624 AAGGACAATGAAAACTCTTGTGG - Intergenic
985326688 4:188778519-188778541 AAGAACAGTGAGAAATGGTGCGG + Intergenic
986455921 5:7918182-7918204 CAGAACAAGTATACCTGGTGAGG - Intergenic
986936295 5:12891481-12891503 GAGAACAATGAAAAGTGATGAGG - Intergenic
987256112 5:16153322-16153344 GAAAACAAGGACAACTGGTTTGG + Intronic
988789450 5:34593916-34593938 GAGAACCAGGAAAGTTGGTGGGG + Intergenic
988861359 5:35283597-35283619 AAAAACAAGGAAAAGTGGCTAGG + Intergenic
989427867 5:41316778-41316800 AAGGACAGGGAAGACTGGTAAGG + Intronic
992381159 5:76239206-76239228 AAGAACAAAGAAAACTGGAGAGG - Intronic
992526903 5:77620478-77620500 AAGTCCAGGGGAAACTGGTGAGG - Intronic
992562147 5:77963475-77963497 AAGAAAGAGGTAAACTGGGGTGG - Intergenic
993114402 5:83702733-83702755 AAAAAAAAGGAAAACTGTTGGGG - Intronic
993213717 5:84991430-84991452 ATGAACAAGGATAAATCGTGGGG - Intergenic
993966128 5:94363161-94363183 AAAAAAAAAGAAAACTGGTTTGG - Intronic
994103825 5:95923290-95923312 AAGAACAAGGAAAAATGGTAGGG - Intronic
994163169 5:96579651-96579673 AAGAACAAGGAAAACTGGTGTGG - Intronic
994572853 5:101536054-101536076 AAGAACAAGGAAGCCTTCTGGGG + Intergenic
995283939 5:110365423-110365445 TAGCACAGGGAAGACTGGTGAGG + Intronic
995673675 5:114636824-114636846 AATAACAAAGAAAGGTGGTGGGG + Intergenic
995959041 5:117816947-117816969 AAGAATAATGAAAAGAGGTGAGG - Intergenic
997364620 5:133318010-133318032 AAGCACAAGAAAAAGTGGTTGGG - Intronic
997447989 5:133955890-133955912 AAAAACAAAGAAAACAAGTGTGG + Exonic
997777887 5:136627804-136627826 CAGAACCAGGAAAACAGGTGGGG - Intergenic
998030642 5:138864642-138864664 ATGAACAAAGACAACTTGTGAGG + Intronic
998606651 5:143642233-143642255 AAGAATAAGGCAAATGGGTGTGG + Intergenic
999044212 5:148449879-148449901 AAGGGCAAAGAAAACTTGTGAGG + Intergenic
1000100675 5:158013356-158013378 AAGAACAAGGCTAGCTGTTGTGG - Intergenic
1000108912 5:158088412-158088434 TAGAACAATGATAGCTGGTGCGG + Intergenic
1000752070 5:165108952-165108974 AAGAAAAAGGAAGCCAGGTGTGG - Intergenic
1000762996 5:165250015-165250037 AAGAAAAAGGAAGATTGGTGTGG + Intergenic
1001543164 5:172553295-172553317 AAGAACCAGGAAGGCTGCTGTGG + Intergenic
1001869909 5:175143502-175143524 CAGAACAAGGAAAACTATTAGGG + Intergenic
1002490556 5:179573483-179573505 AAACACAAGGTAAACTGGAGTGG - Intronic
1002597076 5:180330940-180330962 AAGAACAGGGAAAACCGGGAAGG + Intronic
1003222713 6:4175801-4175823 AAAAAAAAGGAAAACTGGCCAGG + Intergenic
1003321199 6:5053469-5053491 AAAGAGAAAGAAAACTGGTGAGG + Intergenic
1003846932 6:10183390-10183412 AAGAACAAGGAAAAGTAATCAGG + Intronic
1004323219 6:14649348-14649370 CAGAAAAATGAATACTGGTGGGG + Intergenic
1004778615 6:18878875-18878897 AAGAACCTGAAAAACTGGAGGGG - Intergenic
1005066611 6:21824306-21824328 AAGAACAAAAGAAACTTGTGAGG - Intergenic
1005535284 6:26749290-26749312 AATAACCAGGAAAATGGGTGGGG - Intergenic
1005708091 6:28476831-28476853 AACATCAAGTAAAACTGGGGGGG + Intergenic
1005852232 6:29830224-29830246 AAAAACAAGGAAAGCAGATGTGG - Intronic
1005875849 6:30008991-30009013 AAAAACAAGGAAAGCAGATGTGG - Intergenic
1006174306 6:32112711-32112733 AAGAGGATGGAGAACTGGTGTGG + Intronic
1006570091 6:34995534-34995556 AAGAACATGGAAAAATTTTGGGG - Intronic
1006972412 6:38060371-38060393 AAGAAAAAGAAAAACGGGAGGGG - Intronic
1007278109 6:40690415-40690437 ATGAACCAGGACAACTGCTGTGG + Intergenic
1007360604 6:41352755-41352777 AAACACCAGGAAAGCTGGTGTGG - Intergenic
1007732554 6:43956439-43956461 AAGAACAAGGAAAAATGAACAGG + Intergenic
1007954138 6:45901190-45901212 TTTAACAAGGAGAACTGGTGAGG - Exonic
1008429603 6:51400064-51400086 AAGAAAAAGAAAAACTAGCGAGG - Intergenic
1008875268 6:56319145-56319167 AAGAACCAGCAAAACAGGTTAGG - Intronic
1009006323 6:57792923-57792945 AATAACCAGGAAAATGGGTGGGG - Intergenic
1009358822 6:62788941-62788963 AACAACAAGGAAGACTTCTGGGG + Intergenic
1009449547 6:63785321-63785343 AGAAACAAGTAAAACTGGTTAGG - Intronic
1009752873 6:67895061-67895083 AAGAACCAGGATAACTGATTTGG + Intergenic
1009831206 6:68938150-68938172 AAGAACAAGAAAAATCAGTGAGG + Intronic
1010149515 6:72714103-72714125 AAGAACAATTACAACTGCTGTGG + Intronic
1010691110 6:78911462-78911484 AAAATCCAGAAAAACTGGTGAGG - Intronic
1010749639 6:79603791-79603813 AAGAAAAAAGAAAAGTGGTCTGG - Intergenic
1010836839 6:80598911-80598933 AAGAACAACAAATGCTGGTGAGG + Intergenic
1011059265 6:83245070-83245092 AAGAACAGGGAGAGCAGGTGTGG + Intronic
1011985575 6:93439882-93439904 AAGAAAAAGAAAAAATGGTGTGG - Intergenic
1012969296 6:105710255-105710277 AAGAACAATGGAAAATGGTTTGG - Intergenic
1013412572 6:109894573-109894595 CAGAACAAGGAACAATGGTAAGG + Intergenic
1013458414 6:110353422-110353444 AAGAAAGAGGAAAAATGGTATGG - Intronic
1014108514 6:117593880-117593902 CAGAACAAGAGAAACTGGAGAGG - Intronic
1015112337 6:129607478-129607500 AAGCACAAGGAGAAGTGGTAGGG - Intronic
1016510353 6:144835887-144835909 AAGAACGTGGAGAACTGGAGAGG + Exonic
1016563334 6:145423100-145423122 AAGAAAAAGGAAAGGTGTTGAGG - Intergenic
1017338688 6:153293188-153293210 AAGAAGAACGAAAAATTGTGAGG + Intergenic
1017398114 6:154027701-154027723 AAGAAAAAGGAAAAGTGGGAAGG - Intronic
1017943367 6:159073252-159073274 AAGAACATAGAAAAGGGGTGAGG - Intergenic
1018533641 6:164795221-164795243 AATAACAAAGAAATATGGTGTGG - Intergenic
1019207444 6:170374386-170374408 AAGAACAGGGTGAACTGGTGTGG + Intronic
1019651949 7:2164578-2164600 AAGAAGCAGGAAAAATGGGGGGG + Intronic
1019756977 7:2777910-2777932 AAGATCAACTAAAACTTGTGAGG + Intronic
1020668697 7:11078357-11078379 ACTAACTAGGAAAAATGGTGGGG + Intronic
1021264328 7:18500601-18500623 AAGAACAACCCAAAATGGTGAGG - Intronic
1021513330 7:21457223-21457245 AAGAAAAAGGAAATCTGGCAGGG - Intronic
1021862911 7:24924789-24924811 AAGAATAAGGGAAACTTGTTGGG - Intronic
1021968763 7:25948012-25948034 AAGAACAAGGAACGCTGGGGAGG - Intergenic
1022099916 7:27163351-27163373 AAGAAAAAGGAAAAGTTGAGGGG - Exonic
1022224938 7:28353463-28353485 AAGAACAAGGAAGACTAGCCGGG + Intronic
1024195699 7:47056842-47056864 AAGAAGAAGGCAAACTGGTCTGG - Intergenic
1026002660 7:66573956-66573978 AAGAACAACGCAATCTGCTGGGG + Intergenic
1026020153 7:66699695-66699717 AAAAAAAAACAAAACTGGTGTGG + Intronic
1026632192 7:72047076-72047098 AATAAAAATGAAAACTAGTGGGG + Intronic
1027968772 7:85049178-85049200 AAGAACAACAAAAACTTTTGTGG + Intronic
1028565139 7:92221529-92221551 AAGAAAGAGAAACACTGGTGTGG - Intronic
1029914697 7:104196933-104196955 TTGAATAAGGAAAATTGGTGAGG - Intronic
1033602224 7:142896688-142896710 AAGAACAAGGAAAGGTGGCAGGG + Intergenic
1034375758 7:150642526-150642548 GAGGACAAGGAAGTCTGGTGTGG - Intergenic
1036783113 8:11663825-11663847 AAGAATAAGAAAAACTGGGCTGG + Intergenic
1038260094 8:25985305-25985327 ATGTACAAGGAAATCTGCTGTGG - Intronic
1038971977 8:32646696-32646718 AAAAAGGAGGAAAACGGGTGGGG + Intronic
1039193030 8:34998626-34998648 AACAAAGAGGAAAAGTGGTGAGG + Intergenic
1040051494 8:43019422-43019444 AAGAACAAGTAAAACAAATGGGG - Exonic
1041667472 8:60459693-60459715 AAGCACAAGGTAAACTGGGAAGG + Intergenic
1041735402 8:61105893-61105915 GAGAACAACTAAAACTGGAGCGG - Intronic
1042576897 8:70230629-70230651 AAGAATAAGGAAAACTCATTTGG - Intronic
1042646917 8:70997331-70997353 AAGAAACAGGTAAACTTGTGCGG - Intergenic
1043321292 8:78989646-78989668 AAAAACAAGAAAAACTGATGGGG + Intergenic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043374431 8:79632459-79632481 AAGAGAAAGGAAAAGTGGAGAGG + Intronic
1043426651 8:80154558-80154580 AAGAAAAGGGAAAGCTGCTGTGG + Intronic
1043812951 8:84765294-84765316 AAGAACAAGGAGAGGTAGTGGGG + Intronic
1043815966 8:84801756-84801778 AATGACATGGAAAACTGGTGAGG + Intronic
1044309379 8:90676099-90676121 AAAAAGCAGGAAAACTGGTTAGG + Intronic
1044745574 8:95367442-95367464 AAAAAAAAAAAAAACTGGTGAGG - Intergenic
1044867211 8:96583608-96583630 AAGAAGAAAGATAACTGGTTAGG - Intronic
1045231842 8:100313382-100313404 AAGAAGAAGGCAAACTAGTTAGG + Intronic
1045313226 8:101021628-101021650 AAGAACAAAGAAAACTGGAGGGG + Intergenic
1045599472 8:103696135-103696157 AAGAAAAAGAAAAATAGGTGGGG - Intronic
1045606116 8:103778898-103778920 AAGGATAAGGGATACTGGTGAGG - Intronic
1046705953 8:117451941-117451963 AAAAATAAGGAATAGTGGTGAGG + Intergenic
1047092707 8:121591296-121591318 ACGAAAAAGTAAAACTGGGGAGG + Intergenic
1047828696 8:128608199-128608221 GAGAACCAGGAAAACTGATGGGG - Intergenic
1048584077 8:135756495-135756517 AAACACTGGGAAAACTGGTGAGG + Intergenic
1048680485 8:136836014-136836036 AAGAACAGGGAAAAATGAAGGGG - Intergenic
1049022557 8:139967740-139967762 AAGACAAAGGAAAAATGCTGGGG - Intronic
1051053685 9:12958604-12958626 AAGAACAAGGAAGTCTTCTGTGG + Intergenic
1051502392 9:17792164-17792186 GAAAACAACGAAAACAGGTGTGG - Intronic
1051511620 9:17884955-17884977 AAGAAAATGGAAAACTTGTTTGG - Intergenic
1051706837 9:19889583-19889605 AGGAACGAGGAAAAATGGTTTGG - Intergenic
1051777011 9:20645840-20645862 AAAAAAAAGGAAAATTGGTGAGG - Intergenic
1052458187 9:28728015-28728037 AAGAACCAAGGAAACTGCTGAGG + Intergenic
1052595768 9:30556648-30556670 AAGAACAAGGAAAATGAGTGAGG + Intergenic
1052641006 9:31165861-31165883 TAGATCAAGGAAGACTGGGGTGG - Intergenic
1053592706 9:39530661-39530683 AAAAAAAAAGAAATCTGGTGTGG - Intergenic
1053614246 9:39746817-39746839 TAGAAAAAGTAAAACTCGTGAGG - Intergenic
1053872274 9:42504758-42504780 TAGAAAAAGTAAAACTCGTGAGG - Intergenic
1054239270 9:62595575-62595597 TAGAAAAAGTAAAACTCGTGAGG + Intergenic
1054553401 9:66630097-66630119 TAGAAAAAGTAAAACTCGTGAGG + Intergenic
1054573596 9:66834615-66834637 AAAAAAAAAGAAATCTGGTGTGG + Intergenic
1054992889 9:71350854-71350876 AAGATCAATGGTAACTGGTGTGG + Intronic
1055500702 9:76899933-76899955 AAGAACAATGGAAAGTGATGAGG + Intronic
1057300917 9:93881357-93881379 AAGAACTAGCTAATCTGGTGGGG + Intergenic
1057695459 9:97319992-97320014 AAGAACAAAGGGAACTGCTGGGG - Intronic
1059974497 9:119701120-119701142 ATGAACAGGGAAAAGGGGTGAGG + Intergenic
1060834309 9:126743490-126743512 GAGAACAAGGAAGACAGGTTGGG + Intergenic
1060854461 9:126904017-126904039 AAGAAGATGGAAAGCTTGTGAGG - Intergenic
1061206533 9:129167123-129167145 CACAACTAGGAAAACTGGTTGGG + Intergenic
1186074007 X:5856326-5856348 AAGAAGAAGGAAAACAAGAGTGG + Intronic
1187679126 X:21749053-21749075 AAGAACAATGACAACTAGTGGGG + Intronic
1187785116 X:22875914-22875936 AATAACGAGGAAAACTGTTGAGG + Intergenic
1187804402 X:23102992-23103014 AAGAAGCAGGAAAACTAGTAAGG - Intergenic
1188275392 X:28194135-28194157 AATAGCAGGGAAAACTGTTGAGG + Intergenic
1188458382 X:30393763-30393785 AAATACAAGGAAAACTAGAGAGG + Intergenic
1189048308 X:37617102-37617124 AGGAACAAGGAAAAGTGGGTGGG + Intronic
1189055977 X:37700105-37700127 AACAACCAGGAAAACAGGTGTGG - Intronic
1189250173 X:39594591-39594613 AAGAACAAAGAAAAAGAGTGAGG - Intergenic
1190571315 X:51784954-51784976 AAGAAGAAGGCAAACTAGTAAGG - Intergenic
1190784126 X:53627335-53627357 AGGAAGAATGAAAACTGGGGTGG + Intronic
1192118526 X:68433610-68433632 AGGTACAAGGAAAACAGTTGAGG - Exonic
1192355451 X:70398614-70398636 GAGAACAAGGAAGATTAGTGAGG - Intronic
1192775994 X:74245598-74245620 AACAATAGGGAAAACTGGTCGGG + Intergenic
1192930331 X:75799744-75799766 AAGAAGAAGGAAGAGTAGTGTGG - Intergenic
1192944503 X:75950334-75950356 AAGAGCAAGGAAAACCAGGGTGG - Intergenic
1193118421 X:77798038-77798060 AATAATAATAAAAACTGGTGGGG - Intergenic
1193282317 X:79668089-79668111 AAAAACAAGGGATACTGGTGAGG + Intergenic
1193357523 X:80538705-80538727 AAGAAAAAGGAATGCTGTTGGGG + Intergenic
1194077529 X:89415518-89415540 AAAAACAATGAATTCTGGTGAGG - Intergenic
1194081311 X:89468162-89468184 AAGAAGAAGGAAAACTGGTAAGG - Intergenic
1194939324 X:99990287-99990309 GAGAAGAAGGAATAATGGTGGGG + Intergenic
1195778184 X:108431256-108431278 AAGTATAAGGAGAACTAGTGAGG + Intronic
1197489454 X:127100271-127100293 AAGAGCAAGGAAAACTAGGTTGG + Intergenic
1198100729 X:133419503-133419525 AAGAAAAAGAAAAAAAGGTGGGG - Intergenic
1198728423 X:139701219-139701241 GAGATCTAGAAAAACTGGTGGGG - Intronic
1199001502 X:142643391-142643413 AAGAATAAGTCAAACTGTTGTGG - Intergenic
1199162942 X:144635654-144635676 AAGAACAATGAAAACAGTAGGGG - Intergenic
1199411872 X:147533764-147533786 TAGAAGAAGGAACACTGGTTCGG + Intergenic
1199923698 X:152439038-152439060 AATAATAAGGGAAACTGGGGTGG + Intronic
1200430176 Y:3071055-3071077 AAAAACAATGAATTCTGGTGAGG - Intergenic
1200433983 Y:3124359-3124381 AAGAAGAAGGAAAACTGGTAAGG - Intergenic
1200978558 Y:9239824-9239846 GAGAAAAAAGAAAACTGCTGAGG + Intergenic
1201622607 Y:15977169-15977191 GAGAACAAGGAAAACAGATTAGG + Intergenic
1201743853 Y:17350301-17350323 TTCAATAAGGAAAACTGGTGGGG + Intergenic
1202262754 Y:22986748-22986770 TAGAACAAGGGAAATAGGTGAGG + Intronic
1202415744 Y:24620489-24620511 TAGAACAAGGGAAATAGGTGAGG + Intronic
1202455043 Y:25049597-25049619 TAGAACAAGGGAAATAGGTGAGG - Intronic