ID: 994164243

View in Genome Browser
Species Human (GRCh38)
Location 5:96592221-96592243
Sequence TATTTCTAGCAGAGACAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 768
Summary {0: 1, 1: 1, 2: 32, 3: 172, 4: 562}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994164243_994164254 15 Left 994164243 5:96592221-96592243 CCACCCTGTCTCTGCTAGAAATA 0: 1
1: 1
2: 32
3: 172
4: 562
Right 994164254 5:96592259-96592281 GGTGTGGTGATGTGCGCCTTTGG 0: 1
1: 6
2: 105
3: 813
4: 2596
994164243_994164251 -6 Left 994164243 5:96592221-96592243 CCACCCTGTCTCTGCTAGAAATA 0: 1
1: 1
2: 32
3: 172
4: 562
Right 994164251 5:96592238-96592260 GAAATACAGGGGGATTGGCCAGG 0: 1
1: 0
2: 0
3: 26
4: 188
994164243_994164256 30 Left 994164243 5:96592221-96592243 CCACCCTGTCTCTGCTAGAAATA 0: 1
1: 1
2: 32
3: 172
4: 562
Right 994164256 5:96592274-96592296 GCCTTTGGTCCTAGCTGCTTGGG 0: 1
1: 28
2: 687
3: 9169
4: 65313
994164243_994164252 -1 Left 994164243 5:96592221-96592243 CCACCCTGTCTCTGCTAGAAATA 0: 1
1: 1
2: 32
3: 172
4: 562
Right 994164252 5:96592243-96592265 ACAGGGGGATTGGCCAGGTGTGG No data
994164243_994164255 29 Left 994164243 5:96592221-96592243 CCACCCTGTCTCTGCTAGAAATA 0: 1
1: 1
2: 32
3: 172
4: 562
Right 994164255 5:96592273-96592295 CGCCTTTGGTCCTAGCTGCTTGG 0: 1
1: 4
2: 344
3: 6306
4: 67561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994164243 Original CRISPR TATTTCTAGCAGAGACAGGG TGG (reversed) Intronic
900255167 1:1694112-1694134 TATTTTTAGTAGAGATGGGGGGG - Intronic
900322350 1:2091205-2091227 TATTTTTAGTAGAGACGGGTTGG + Intronic
900783921 1:4635801-4635823 TATTTTTAGTAGAGACATGTTGG + Intergenic
901263660 1:7892652-7892674 TATTTTTAGTAGAGGCGGGGAGG + Intergenic
901520091 1:9777042-9777064 TATTTTTAGTAAAGACAGGAGGG - Intronic
902086167 1:13864378-13864400 TATTTTTAGTAGAGATGGGGTGG + Intergenic
902139501 1:14341061-14341083 TATTTTTAGTAGAGATTGGGGGG + Intergenic
902156403 1:14490666-14490688 TATTTTTAGCAGAGACGGGGTGG + Intergenic
902857361 1:19218239-19218261 AATTTGTAGCAGAGACACAGTGG + Exonic
903041305 1:20532803-20532825 TATTTTTAGTAGAGATGGGGGGG - Intergenic
903297411 1:22352859-22352881 TATTTTCAGCAAAGACAGGCAGG - Intergenic
903579521 1:24360271-24360293 TATTTTTAGCAGAGACAGACAGG - Intronic
903635324 1:24810329-24810351 TATTTTTACCAGACACAGGTGGG - Intronic
903815317 1:26060449-26060471 TCTTTCTAGCAGAGAGGGGAGGG - Intronic
904214550 1:28908974-28908996 TATTTTTAGTAGAGACATGTGGG - Intronic
904722963 1:32524472-32524494 TATTTTTAGTAGAGACAGGTTGG + Intronic
904775260 1:32902116-32902138 TATTTTTAGTAGAGACGGGGCGG - Intergenic
905190271 1:36228391-36228413 TATTTTTAGTAGAGACAGACAGG + Intronic
905295176 1:36949751-36949773 TATATTTATTAGAGACAGGGGGG + Intronic
905447747 1:38038297-38038319 TTTTTTTAGTAGAGACGGGGAGG - Intergenic
905481994 1:38268046-38268068 TATTTGAAGGAGAGAGAGGGAGG - Intergenic
906423429 1:45689078-45689100 TATTTTTAGTAGAGACGGGGGGG + Intronic
907130751 1:52095086-52095108 TATTTTTAGTAGAGACGGGGGGG + Intergenic
907302148 1:53494594-53494616 TATTTTCAGTAGAGACGGGGGGG - Intergenic
908157319 1:61367248-61367270 GATTTCTAGCTGAGACACAGGGG + Intronic
908352067 1:63295914-63295936 TATTTTTAGTAGAGACAGTATGG - Intergenic
908552548 1:65223819-65223841 TATTTTTAGTAGAGACAGTGTGG - Intronic
910003976 1:82372232-82372254 CTTTTCAAGCAGAGACAGGTTGG + Intergenic
910035725 1:82785189-82785211 GATTTGTTGCAGAGACAGGAAGG + Intergenic
910150050 1:84131926-84131948 TAGTTCTTGCAGAGAGAGGGAGG + Intronic
910171087 1:84377874-84377896 TACTTTTAGCAGAGCCAGGGAGG - Intronic
910212677 1:84809649-84809671 TATTTTTAGTAGAGACAGGGTGG + Intergenic
910478350 1:87632887-87632909 TATTTTTAGTAGAGACGGGCTGG - Intergenic
910629343 1:89340071-89340093 TTTTTTTAATAGAGACAGGGAGG + Intergenic
910631746 1:89362723-89362745 TATTTCTAGTAGAGAGAGACAGG + Intergenic
910689512 1:89951405-89951427 TATTTTTAGTAGAGATGGGGGGG - Intergenic
911350134 1:96743980-96744002 TATTTTTAGTAGAGCCAGGCTGG - Intronic
911554748 1:99329888-99329910 TATTTTTAGTAGAGATGGGGTGG - Intergenic
911651438 1:100393765-100393787 TATTTTTAGTAGAGACATGTTGG - Intronic
912105195 1:106264757-106264779 CATTTGTAGCAGTGTCAGGGGGG + Intergenic
912828984 1:112933274-112933296 TATTTTTAGTAGAGACAGCCAGG - Intronic
912836832 1:113004022-113004044 TATTTTTAGTAGAGACGGGGGGG + Intergenic
912838973 1:113022205-113022227 TATTTTTAGTAGAGACACGGTGG - Intergenic
912904189 1:113686645-113686667 TATTTTTAGTAGAGACAGACAGG - Intergenic
913665547 1:121045041-121045063 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914016945 1:143828311-143828333 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
914160840 1:145132687-145132709 CATTTTTAGTAGAGGCAGGGTGG - Intergenic
914655554 1:149736853-149736875 CATTTTTAGTAGAGGCAGGGTGG + Intergenic
915167554 1:153956925-153956947 TGATTCTAGCAGAGGCATGGTGG - Intronic
915779912 1:158536273-158536295 AATTGATAGCAGAGACAGGGCGG + Intergenic
915796077 1:158734984-158735006 TACCTCTAGCAGAGACAATGAGG + Intergenic
915840612 1:159209770-159209792 TATTTTTAGTAGAGACGGGGGGG + Intergenic
915969728 1:160345759-160345781 TATTTTTAGTAGAGATGGGGGGG - Intronic
915982811 1:160432107-160432129 TATTTATAGTAGAGACAGCGGGG - Intergenic
916292102 1:163178131-163178153 TATTTTTAGAAGAGACGGCGGGG - Intronic
916687378 1:167159459-167159481 TATTTTTAGTAGAGACATGTTGG + Intergenic
917099997 1:171435462-171435484 TATTTTTTGTAGAGACAGGACGG - Intergenic
917853431 1:179083566-179083588 TATTTTTAGTAGAGGCGGGGGGG + Intronic
917877157 1:179296138-179296160 TATTTTTAGTAGAGACAGGGAGG + Intronic
918491017 1:185081567-185081589 TATTTTTAGTAGAGACGGGTGGG + Intronic
918583956 1:186164414-186164436 TATTTTTAGTAGAGACAGACGGG + Intronic
918609897 1:186477137-186477159 TATTTCCAGCAGAGAAGGAGAGG + Intergenic
918882233 1:190139274-190139296 TATTTTTAGTAGAGACAGAGGGG - Intronic
920146935 1:203869479-203869501 TATTTTTAGTAGAGATAGGGTGG + Intronic
920169133 1:204059264-204059286 TATTTTTAGTAGAGACAGATGGG - Intergenic
921256001 1:213340067-213340089 TATTTTTAGTAGAGACAGGTTGG + Intergenic
921800908 1:219400668-219400690 TATTATTAGTACAGACAGGGTGG + Intergenic
922230397 1:223680621-223680643 TATTTTTAGTAGAGATTGGGGGG + Intergenic
922519377 1:226235144-226235166 TATTTTTAGTAGAGACATGTTGG - Intronic
922921209 1:229306377-229306399 TATTTTTTGTAGAGACAGGGAGG + Intergenic
923112335 1:230902204-230902226 TATTTTTAGTAGAGAGGGGGGGG - Intergenic
923348892 1:233084284-233084306 TATTTCTTGCTGAGAAAGGCAGG + Intronic
923483185 1:234403857-234403879 TATTTTTAGTAGAGACAGACAGG + Intronic
923767396 1:236904967-236904989 TTTTCCTAAAAGAGACAGGGAGG + Intergenic
924121597 1:240805201-240805223 TTTTTTTTGTAGAGACAGGGTGG - Intronic
924669909 1:246113675-246113697 TGTTTCTCCCACAGACAGGGAGG + Intronic
924752131 1:246903659-246903681 TATATTTAGCAGAGACGGAGGGG - Intronic
924764737 1:247021738-247021760 TATTTTTAGTAGAGACAGGCTGG + Intergenic
1063196959 10:3752653-3752675 TATTTTTAGTACAGACAGGCTGG + Intergenic
1063250289 10:4266008-4266030 TGTTTCAGGCAGAGACACGGTGG + Intergenic
1063354437 10:5385036-5385058 TATTTTTAGTAGAGACGGAGGGG + Intergenic
1063466664 10:6250390-6250412 TATTTTTAGTAGAGACAGGGAGG - Intergenic
1063579054 10:7288858-7288880 TATTTCTAGTGGAGATGGGGGGG - Intronic
1063632589 10:7748031-7748053 TATTTTTAGTAGAGATGGGGGGG - Intronic
1064750078 10:18519545-18519567 TACTTCTAGCAGAGAGGGGATGG - Intronic
1064831853 10:19477653-19477675 TCTTTCTTGCAGAGAGAGAGGGG + Intronic
1065441539 10:25757166-25757188 TATTTTTAGTAGAGACGGGACGG - Intergenic
1065742707 10:28811659-28811681 TATTTGTAGTAGAGACGGGGGGG + Intergenic
1067548645 10:47216504-47216526 TATTTTTAGTAGAGACAGGTTGG + Intergenic
1069389720 10:67920705-67920727 TATTTTTAGTAGAGAGAGAGAGG + Intergenic
1069463749 10:68619403-68619425 TATTTTTTGTAGAGACAGAGGGG + Intronic
1070126216 10:73624373-73624395 TTTTTTTAGTAGAGACGGGGGGG + Intronic
1070563354 10:77584528-77584550 TATTTTTAGTAGAGACAGGGAGG + Intronic
1071064126 10:81610795-81610817 TATTTTTAGTGGAGACAGGCTGG - Intergenic
1071604552 10:86976089-86976111 TTTTTTTTGTAGAGACAGGGAGG + Intronic
1073163668 10:101424056-101424078 TATTTTTGGTAGAGACAGGCAGG - Intronic
1074589449 10:114798969-114798991 TATTTTTAGTAGAGATGGGGTGG + Intergenic
1074603020 10:114934520-114934542 TATTTTTAGTAGAGACAGATGGG - Intergenic
1075330594 10:121571166-121571188 TTTTTTTAGTAGAGACGGGGTGG + Intronic
1075339009 10:121630503-121630525 TATTTGTAACAGAGACTGTGTGG - Intergenic
1075373244 10:121955617-121955639 TATTTTTAGTAGAGACAGGCTGG + Intergenic
1076505940 10:130972628-130972650 TATTTTTAGTAGAGACGGGGTGG + Intergenic
1076598242 10:131638954-131638976 TATTTCTTGCAGATCCAGTGTGG - Intergenic
1077288108 11:1776469-1776491 TATTTCTAGGAGAACCAGAGGGG - Intergenic
1078214221 11:9297887-9297909 AATTTTTTGTAGAGACAGGGTGG - Intronic
1078653496 11:13216999-13217021 TTTTTCTACCACAGACAGGAAGG - Intergenic
1078949775 11:16117175-16117197 TACTTCTAGTAGAGACAGACAGG - Intronic
1079207408 11:18428344-18428366 TATTTTTAGTAGAGACATGTTGG + Intronic
1080319006 11:30984768-30984790 TACTTCTATGAGAGACAGGCTGG - Intronic
1080892152 11:36418366-36418388 GATTTGGAGGAGAGACAGGGTGG + Intronic
1081915746 11:46729150-46729172 TATTTTTAGTAGAGACTGGTGGG + Intronic
1083129772 11:60614277-60614299 TATTTTTAGTAGAGCCAGGATGG + Intergenic
1083776607 11:64897191-64897213 TATTTTTAGTAGAGACGGGGGGG + Intronic
1083828250 11:65215222-65215244 TATTTTTAGTAGAGATCGGGGGG + Intergenic
1083830547 11:65229800-65229822 TATTTTTAGTAGAGACAGGATGG + Intergenic
1083924826 11:65799633-65799655 TATTTTTAGTAGAGACAGAGTGG + Intergenic
1084863179 11:72035581-72035603 TATTTTTAGTAGAGACGGGGGGG + Intronic
1084964164 11:72735417-72735439 TATTTTTAGTAGAGACAGTCGGG - Intronic
1085981528 11:81732368-81732390 TAGTTCTTGCAGACACATGGAGG + Intergenic
1086395242 11:86408913-86408935 TATTTCAAGCAAAGACAGAATGG + Intronic
1088135919 11:106555044-106555066 TATTTCTTGCTGAGACAGCAAGG + Intergenic
1088464863 11:110124266-110124288 TATTTCTCCCTGTGACAGGGTGG - Intronic
1088932750 11:114368496-114368518 TATTTTTAGTAGAGACGGTGGGG - Intergenic
1089404283 11:118184608-118184630 TATTTTTAGTAGAGATGGGGGGG + Intergenic
1089951509 11:122532152-122532174 TATTTTTAGAAGAGACAGACAGG - Intergenic
1090874869 11:130779877-130779899 TCTTTTTAGCAGAGATATGGAGG - Intergenic
1091651533 12:2313878-2313900 TATTTCCTGCTCAGACAGGGAGG - Intronic
1091882139 12:3988730-3988752 GATTGCTGGAAGAGACAGGGAGG - Intergenic
1093047740 12:14469182-14469204 TATTTTTAGTAGAGACATGTTGG - Intronic
1093069619 12:14695422-14695444 TATTTTTAGTAGAGAGGGGGTGG - Intronic
1093366237 12:18302681-18302703 TGTTTCAGGCATAGACAGGGTGG + Intronic
1093907480 12:24710225-24710247 TATTTTTAGTAGAGATGGGGTGG + Intergenic
1094109391 12:26845420-26845442 TATTTTTAGTAGAGACAGACAGG + Intergenic
1094393688 12:29981282-29981304 TATTTTTAGTAGAGATGGGGGGG + Intergenic
1094675264 12:32613578-32613600 AATTTTTTGTAGAGACAGGGAGG - Intronic
1094682349 12:32677875-32677897 TATTTTTAGTAGAGACGGGTGGG - Intergenic
1094772142 12:33675487-33675509 TATTTTTAGTAGAGACAGGTTGG - Intergenic
1095086935 12:38066995-38067017 TATTTTTAGTAGAGACGGGTGGG - Intergenic
1095303864 12:40618127-40618149 TATTTTTAGTAGAGACGGGGCGG + Intergenic
1095306702 12:40647011-40647033 TATTGCTTGCAGAGCCAAGGAGG + Intergenic
1095693176 12:45113958-45113980 TATTTTTAGTAGAGACTGGGGGG - Intergenic
1096640758 12:52992501-52992523 TATTTTTAGTAGAGACAGACAGG - Intergenic
1096854488 12:54469997-54470019 TATTTTTAGTAGAGACCGGCCGG - Intronic
1097385687 12:58947828-58947850 TATTTTTAGTAGAGACAGGCGGG + Intergenic
1097810762 12:64016309-64016331 TATTTTTTGTAGAGACAGGGTGG - Intronic
1098256875 12:68625744-68625766 TATTTTTAGTAGAGACGGGGAGG - Intronic
1098896633 12:76070296-76070318 TATTTTTAGTAGAGACAGGCTGG + Intronic
1099724086 12:86402247-86402269 TATTTTTAGTAGAGACGGAGTGG - Intronic
1099853050 12:88128146-88128168 TAGTTATAGCAGAGACCAGGTGG + Intronic
1100500048 12:95165508-95165530 TATTTTTAGTAGAGACAGGTTGG + Intronic
1100724752 12:97396707-97396729 TATTTTTAGTAGAGACGAGGAGG + Intergenic
1100921918 12:99497864-99497886 GATTTCCTGGAGAGACAGGGTGG - Intronic
1101892068 12:108726010-108726032 TATTTTTAGCAGAGACAGGTTGG + Intronic
1102021320 12:109685324-109685346 TATGAAAAGCAGAGACAGGGCGG - Intergenic
1102385479 12:112505497-112505519 TATTTTTAGTAGAGACGGGTTGG - Intronic
1102393170 12:112566128-112566150 TATTTTCAGCAGAGACAGCCCGG + Intergenic
1102476167 12:113190154-113190176 TATTTTTAGTAGAGACGGGGGGG - Intronic
1102714016 12:114954116-114954138 TATTTTTAGTAGAGACAGCCAGG + Intergenic
1102850600 12:116240711-116240733 TATTTTTAGTAGAGACGGGGGGG + Intronic
1103161964 12:118736858-118736880 TAGTTCTAGCTCAGACGGGGGGG - Intergenic
1103349585 12:120274804-120274826 TATTTTTTGCAGACACAGAGAGG + Intergenic
1103511705 12:121479288-121479310 TATTTTTAGTAGAGACGGCGGGG - Intronic
1103814003 12:123638342-123638364 TATTTTTAGTAGAGATGGGGTGG + Intronic
1103824309 12:123724265-123724287 TATTCTTAGTAGAGACAGGGAGG + Intronic
1103866205 12:124053997-124054019 CTGTTCTAGCAGAGAGAGGGGGG - Intronic
1104009887 12:124922712-124922734 TATTTTTAGTAGAGATGGGGGGG + Intergenic
1104105245 12:125652770-125652792 TACTTTTCTCAGAGACAGGGTGG - Intronic
1104867476 12:131966590-131966612 AATTTTTAGTAGAGACAGGGTGG - Intronic
1105309174 13:19191060-19191082 TAGTTTTAGTAGAGACAGGCGGG - Intergenic
1105471570 13:20700010-20700032 AATTTTTAGTAGAGACAGGGAGG - Intergenic
1105528427 13:21197066-21197088 TAGTTTTAGTAGAGACAGGCAGG + Intergenic
1105788664 13:23774969-23774991 TATTTTTAGTAGAGACAGGGGGG + Intronic
1106511068 13:30413060-30413082 TATTTTTAGTAGAGATTGGGCGG + Intergenic
1107250984 13:38362574-38362596 TATTTTTAGCAGAGACAGGGAGG + Intronic
1107692004 13:42962596-42962618 TATTTTTTGTAGAGACAGGGAGG - Intronic
1107991011 13:45819305-45819327 TACTTCTAACAGATACAGGATGG + Intronic
1108035963 13:46290959-46290981 GATTTCATGCAGAGGCAGGGAGG + Intergenic
1108089540 13:46833536-46833558 TTTTTTTTGTAGAGACAGGGAGG + Exonic
1108822026 13:54363525-54363547 TATTACTAGCAAAAAGAGGGAGG + Intergenic
1108822799 13:54374575-54374597 TACTTCCAGTAGAGACAAGGTGG + Intergenic
1110581463 13:77134356-77134378 TATTTTTAGTAGAGACGGGCAGG - Intronic
1110882162 13:80585583-80585605 TATTTCTCAGAGAAACAGGGAGG - Intergenic
1111290149 13:86155920-86155942 TGTTTTTAGTAGAGACTGGGTGG - Intergenic
1111294628 13:86262995-86263017 TATTTTTAGTAGAGACCGGGGGG - Intergenic
1111843553 13:93479611-93479633 TATTTTTAGTAGAGATGGGGGGG - Intronic
1111987316 13:95078234-95078256 TATTTTTAGTAGAGACATTGTGG - Intronic
1112521322 13:100097846-100097868 TATTTTTTGTAGAGACTGGGCGG - Intronic
1113194930 13:107791782-107791804 TATTTTTAGTAGAGACGGGGGGG - Intronic
1114004725 14:18300195-18300217 TATTCCTAGCAGAGATAAGATGG + Intergenic
1114041546 14:18683463-18683485 TATTTTTAGTAGAGACGGAGGGG + Intergenic
1114441571 14:22752403-22752425 TATTTTTAGTAGAGACAGGCTGG - Intergenic
1115314914 14:32015368-32015390 TATTTCTGGCAGTGACAATGGGG - Intronic
1115645992 14:35368848-35368870 TCTTTCTGGCAGAGTCTGGGAGG - Intergenic
1115819058 14:37194538-37194560 TATTTTTAGTAGAGACGGTGGGG + Intergenic
1116463153 14:45201228-45201250 TATTTTTAGTAGAGACGGGATGG - Intergenic
1117145755 14:52835652-52835674 TCTTTTAAGCACAGACAGGGCGG + Intergenic
1117324528 14:54656802-54656824 TATTTTTAGTGGAGACAGGATGG + Intronic
1117769423 14:59118137-59118159 AATGTGAAGCAGAGACAGGGAGG - Intergenic
1117773292 14:59156367-59156389 TGTTTCAAGGACAGACAGGGAGG + Intergenic
1117989419 14:61419082-61419104 TATTTCTATTAAACACAGGGAGG - Intronic
1118208763 14:63747596-63747618 TATTTTTAGGAGAGACGGGGGGG + Intergenic
1118407628 14:65442356-65442378 TATTTTTAGTAGAGACATGTCGG + Intronic
1118569909 14:67184018-67184040 TATATTTTGCAGAGACAGGCTGG + Intergenic
1118620857 14:67612763-67612785 TATTTTTAGTAGAGATGGGGAGG - Intergenic
1118993942 14:70820755-70820777 AATTTTTTGTAGAGACAGGGAGG - Intergenic
1119078275 14:71666794-71666816 AATGTCTAGCATAGGCAGGGAGG + Intronic
1119317953 14:73711266-73711288 TATTTTTAGTAGAGACGGCGAGG + Intergenic
1119351469 14:73969242-73969264 TATTAGCAGCAGAGACAGGCAGG + Intronic
1119355885 14:74006161-74006183 TATTTTTAGTAGAGACAAAGCGG + Intronic
1119356600 14:74012277-74012299 TATTTTTAGTAGAGAGGGGGGGG + Intronic
1119392661 14:74301722-74301744 TATTTTTAGCAAAGATGGGGGGG - Intronic
1119853026 14:77879532-77879554 TGTTTCTAGCAGAGGGAGGAGGG + Intronic
1120981062 14:90289547-90289569 CATTTCTAGCAGAAACAGGAGGG + Intronic
1121198353 14:92095765-92095787 TATTTTTAGTAGAGATAGTGGGG - Intronic
1121247302 14:92471262-92471284 TACTCCTAGCAGGGACAAGGAGG + Intronic
1122618562 14:103038700-103038722 TATTTTTTGTAGAGACGGGGGGG + Intronic
1122624679 14:103078343-103078365 TATATGTAGCAGAGACATGCAGG + Intergenic
1122642273 14:103166967-103166989 CATTTATAATAGAGACAGGGAGG + Intergenic
1122733538 14:103820668-103820690 TTTTTTTTGTAGAGACAGGGTGG + Intronic
1123389187 15:19852441-19852463 TATTCCTAGCAGAGATAAGATGG + Intergenic
1123913595 15:24997102-24997124 TAGTTTTAGTAGAGACGGGGGGG - Intergenic
1124614210 15:31229902-31229924 TATATTTAGTAGAGACAGGCAGG + Intergenic
1125531092 15:40414028-40414050 TATTTTTAGTAGAGACAGATGGG + Intronic
1125665943 15:41430368-41430390 TATTTTTAGTAGAGACAGGGTGG + Intronic
1126792733 15:52235759-52235781 AATTTCTAGCAGAGGGAAGGGGG + Exonic
1127083860 15:55407050-55407072 TATTTTTAGTAGAGACGGCGGGG - Intronic
1127233594 15:57022942-57022964 TATTTCTAGCTTACACAGGTGGG + Intronic
1127386458 15:58471313-58471335 TATTTTTAGTAGAGATGGGGGGG + Intronic
1127780901 15:62314577-62314599 TATTTTTAGTAGACACAGGCTGG - Intergenic
1127793688 15:62420568-62420590 TATTTTTAGTAGAGACTGTGTGG + Intronic
1127883190 15:63176017-63176039 TATTTTTAATAGAGACAGGTTGG + Intergenic
1128559331 15:68654391-68654413 CATTCCTTGCAGAGCCAGGGAGG + Intronic
1129181083 15:73875959-73875981 GATTTCTAGCATAGGCAGGTAGG + Intronic
1129283092 15:74501484-74501506 CATCTCTAGCAGTGAAAGGGTGG - Intergenic
1129768308 15:78184353-78184375 TTTTTTTTGTAGAGACAGGGGGG + Intronic
1129860948 15:78860926-78860948 TATTTTTAGTAGAGACGGGGTGG - Intronic
1130071395 15:80649318-80649340 TATTTTTAGTAGAGATCGGGGGG - Intergenic
1130230018 15:82089583-82089605 TATTTTTAGTAGAGACAGCCAGG - Intergenic
1130372407 15:83296201-83296223 TATTTTTAGTAGAGACGTGGGGG + Intergenic
1130416187 15:83696742-83696764 TGTTTGTAGCAGTGACAAGGAGG + Intronic
1131034529 15:89212902-89212924 TATTTTTAGTAGAGACAGACAGG + Intronic
1131400835 15:92124412-92124434 ATTTCCTAGCAGAGACAGTGGGG - Intronic
1131500571 15:92960888-92960910 TATTTTTCGTAGAGACAGTGGGG + Intronic
1131514274 15:93066697-93066719 TATTTTTGGTAGAGACAGGTTGG + Intronic
1131705374 15:94989834-94989856 GATTTATACCAGAGACAGGAAGG + Intergenic
1132094587 15:98972692-98972714 TATTTTTAGTAGAGATGGGGGGG - Intronic
1132329008 15:100998004-100998026 TATTTTTAGTAGAGACGGGGGGG - Intronic
1132651835 16:1024715-1024737 TATTTTCAGTAGAGACAGGGAGG - Intergenic
1132770057 16:1556984-1557006 TATTTTTAGTAGAGATGGGGGGG + Intronic
1133340453 16:5032501-5032523 TATTTTTAGTAGAGACGGGATGG - Intronic
1133807992 16:9139691-9139713 TATCTTTAGTAGAGACGGGGTGG + Intergenic
1133809183 16:9148076-9148098 TATTTTTAGTAGAGACAGGGTGG - Intergenic
1134248099 16:12554994-12555016 TCTTTCTTGCAGAGGCAGGCAGG + Intronic
1134267256 16:12702834-12702856 TATTTTTAGTAGAGACAGTTTGG - Intronic
1134383181 16:13747364-13747386 TATTTTTAGTGGAGACGGGGTGG - Intergenic
1134442694 16:14308649-14308671 TATTTTTTGCAGAGACTTGGGGG + Intergenic
1134511355 16:14850244-14850266 TATTTTTAGTAGGGACAGGGAGG + Intronic
1134532756 16:14997362-14997384 TATTTTTAGTAGAGACGGGGGGG - Intronic
1134638972 16:15813966-15813988 TATTTTTAGTAGAGACGGGTTGG - Intronic
1134698999 16:16248741-16248763 TATTTTTAGTAGGGACAGGGAGG + Intronic
1134972838 16:18545932-18545954 TATTTTTAGTAGGGACAGGGAGG - Intronic
1135012068 16:18890472-18890494 TATTTTTAGTAGAGACAAGGCGG - Intronic
1135124118 16:19792745-19792767 TATTTTTAGTAGAGACGGAGGGG + Intronic
1135145106 16:19954724-19954746 TATTTTTAGTAGAGACAACGGGG - Intergenic
1135379959 16:21987598-21987620 TATTTCAAGAAGAGAGTGGGTGG + Intronic
1136348732 16:29693760-29693782 TATTTTTAGTAGAGACAGGAGGG + Intronic
1136847831 16:33590756-33590778 TATTTTTAGTAGAGACATGTTGG - Intergenic
1136853180 16:33630496-33630518 TATTTTTAGTAGAGACAGGCTGG - Intergenic
1137739951 16:50759063-50759085 TATTTTTAGTAGAGACGGGGGGG - Intronic
1138140544 16:54564702-54564724 CATTTAAATCAGAGACAGGGAGG + Intergenic
1138425560 16:56929910-56929932 TATTTTTAGTAGAGACAGATGGG - Intergenic
1138434016 16:56986997-56987019 TATTTTTAGTAGAGATGGGGGGG - Intergenic
1138685386 16:58720752-58720774 TATTTTTAGTAGAGACGGGGGGG + Intronic
1139766365 16:69233798-69233820 TGTTTTTTGCAGAGACAGTGGGG - Intronic
1140244970 16:73239763-73239785 TATTTCTAGCACTGCCAGGGAGG - Intergenic
1140334767 16:74094945-74094967 TATTTTTAGTAGAGATGGGGGGG - Intergenic
1140374349 16:74432900-74432922 TACTTTTAGCAGAGCCAGGCTGG + Intergenic
1141180259 16:81748048-81748070 TATTTTTAGTAGAAACAGGGTGG + Intronic
1141534954 16:84672859-84672881 TATTTTTAGTAGAGACGTGGAGG + Intergenic
1141881007 16:86859280-86859302 TGTTTTTAGTAGAGACAGAGAGG + Intergenic
1142116463 16:88358568-88358590 TATTTCCATCAGTGACATGGAGG + Intergenic
1142413854 16:89930592-89930614 TATTTTTAGTAGAGACAGGCTGG + Intronic
1203109539 16_KI270728v1_random:1439405-1439427 TATTTTTAGTAGAGACATGTTGG - Intergenic
1142587220 17:980804-980826 TATTTTTAGTAGAGGCGGGGGGG - Intergenic
1142820642 17:2463952-2463974 TATTTCTAGTAGAGACAAGGGGG - Intronic
1143219334 17:5248450-5248472 TATTTTTAGTAGAGACAGGGAGG + Intergenic
1143306777 17:5953712-5953734 TATTTTTAGTAGAGACAGGGTGG - Intronic
1143325898 17:6098128-6098150 TATTTTTTGCAGAGACAGGGGGG + Intronic
1143549400 17:7620490-7620512 TATTTTTAGTAGAGACGGGTGGG + Intronic
1144314685 17:14048650-14048672 TATTTTTAGTAGAGACATGTTGG + Intergenic
1144962169 17:19050871-19050893 TATTTCAAGTAGACACAGGGAGG - Intergenic
1144972992 17:19123650-19123672 TATTTCAAGTAGACACAGGGAGG + Intergenic
1145883768 17:28369214-28369236 TATTGCTCCCAGGGACAGGGTGG - Intronic
1145944386 17:28762037-28762059 TTTTTTTAGCAGAGGCAAGGGGG + Intronic
1146033608 17:29387786-29387808 TATTTTTAGTAGAGACGGGGGGG - Intergenic
1146295879 17:31649879-31649901 TATTTTTAGTAGAGATCGGGGGG - Intergenic
1146759260 17:35461933-35461955 TATTTTTAGTAGAGATGGGGGGG + Intergenic
1146817117 17:35951540-35951562 TATTTCTAGTAGAGACGATGGGG - Intergenic
1146988324 17:37243494-37243516 CAATTCTAGGAGAGGCAGGGAGG + Exonic
1147699089 17:42380558-42380580 TATTTTTAGTAGAGACGGGGGGG + Intronic
1148010642 17:44477983-44478005 TATTTTTAGTAGAGATGGGGTGG + Intronic
1148055040 17:44789113-44789135 TATTTTTAGTAGAGACAGCAGGG + Intergenic
1148181964 17:45612698-45612720 TATTTTTAGTAGAGACAGGGTGG + Intergenic
1148266893 17:46233002-46233024 TATTTTTAGTAGAGACAGGGTGG - Intergenic
1148909733 17:50935021-50935043 TATGTCTAGCAGAGTCTGGGTGG + Intergenic
1149545530 17:57500775-57500797 TTTTTTTGGTAGAGACAGGGTGG - Intronic
1149765222 17:59270367-59270389 TGTTTTTAGTAGAGACGGGGGGG + Intronic
1149822892 17:59797160-59797182 TATTTTTAGTAGAGACGGGGGGG - Intronic
1150232930 17:63568194-63568216 TATTTTTAGTAGAGCCAGGCTGG + Intronic
1150876181 17:68972918-68972940 TATTTTTAGTGGAGACAGGGTGG + Intergenic
1151646445 17:75435673-75435695 TATTTTTAGTAGAGATGGGGGGG + Intergenic
1151722014 17:75862493-75862515 TATTTTTAGTAGAGACGGGGGGG + Intergenic
1152013936 17:77737230-77737252 TATTTTTAGTAGAGATAGGGTGG - Intergenic
1152039523 17:77893979-77894001 TATTTGTAGTGGAGAGAGGGAGG + Intergenic
1152087600 17:78230217-78230239 TTTTTTTTTCAGAGACAGGGAGG - Intergenic
1152149809 17:78591912-78591934 TATTTTTTGTAGAGACGGGGGGG + Intergenic
1152803629 17:82344161-82344183 TATTTTTAGTGGAGACAGGGAGG + Intergenic
1152971202 18:162971-162993 TATTTTTATTAGAGACAGGCTGG + Intronic
1153239854 18:3021189-3021211 TATTTTTAGTAGAGACAGGCGGG - Intergenic
1154532701 18:15363673-15363695 TATTCCTAGCAGAGATAAGATGG - Intergenic
1155236749 18:23827510-23827532 TATTTTTAGCAGATACAGATGGG - Intronic
1155518608 18:26647335-26647357 TATTTTTAGTAGAGATGGGGGGG - Intronic
1155625841 18:27833707-27833729 TTTTTCTAGAAGACAGAGGGTGG - Intergenic
1156758376 18:40556647-40556669 AATTTGTAACAGAGGCAGGGCGG - Intergenic
1157367891 18:47083061-47083083 TATTTCTAACAGAGAAAGTTTGG - Intronic
1157525592 18:48377974-48377996 TATTTTTAGTAGAGACAGGCTGG - Intronic
1157880721 18:51318762-51318784 TATTTTTAGTAGAGACTGGGGGG + Intergenic
1158625573 18:59068652-59068674 TATTTGTGGCAGAAAGAGGGAGG + Intergenic
1158637694 18:59175956-59175978 TATTTTTAGTAGAGACAACGGGG - Intergenic
1158638865 18:59185113-59185135 TATTTTTAGTAGAGACGGGCGGG - Intergenic
1158991142 18:62870066-62870088 TATTTTTAGTAGAGACGGAGGGG + Intronic
1159324017 18:66892539-66892561 TATTTTTAGTAGAGACGGGGTGG + Intergenic
1159386603 18:67734129-67734151 TATTTCTAGCAATGGCAGTGGGG - Intergenic
1159582064 18:70244621-70244643 AATTTTTAGTAGAGACAGGCTGG - Intergenic
1159959346 18:74543315-74543337 TATTTTTTGTAGAAACAGGGGGG - Intronic
1160712840 19:560711-560733 TATTTTTAGTAGAGATGGGGGGG + Intergenic
1160918541 19:1509070-1509092 TATTTTTGGTAGAGACGGGGGGG - Intronic
1161045845 19:2134240-2134262 TATTTTTTGTAGAGGCAGGGAGG - Intronic
1161149126 19:2697794-2697816 TATTTTTAGTAGAGACGGGCGGG - Intronic
1161206797 19:3045654-3045676 TATTTTTAGTAGAGACGGGGTGG - Intronic
1161521197 19:4724340-4724362 TATTTTTAGTAGAGATGGGGTGG + Intronic
1161632201 19:5363561-5363583 TATTTTTAGTAGAGATGGGGGGG + Intergenic
1161664836 19:5568986-5569008 TATTTTTGGTAGAGACGGGGGGG - Intergenic
1161708826 19:5835595-5835617 TATTTTTAGTAGAGACATGTTGG - Intronic
1161809140 19:6461579-6461601 TATTTTTATTAGAGACGGGGGGG + Intronic
1161868112 19:6849465-6849487 TATTTTTAGTAGAGACAGTGGGG + Intronic
1161869703 19:6860882-6860904 TATTTTTAGTAGAGACACAGGGG + Intergenic
1162256040 19:9490569-9490591 TATTTGTAACAGAGACTGTGTGG - Intronic
1162412605 19:10515434-10515456 TGTTTTTAGCAGAGACGGAGGGG - Intronic
1162427906 19:10608045-10608067 TATTTTTAGTAGAAACGGGGTGG - Intronic
1162714299 19:12620098-12620120 TATTTTTAGTAGAGCCAGGATGG + Intronic
1162902588 19:13804157-13804179 TATTTTTAGAAGAGACAGCCCGG - Intronic
1163176953 19:15571051-15571073 TATTTTTAGTAGAGACAGGGGGG + Intergenic
1163279424 19:16306535-16306557 TATTTTTAGTAGAGGCGGGGCGG - Intergenic
1163656264 19:18546970-18546992 TATTTTTAGTAGAGATGGGGGGG + Intergenic
1163974036 19:20831152-20831174 TATTTTTAGTAGAGACCAGGCGG - Intronic
1164629971 19:29755638-29755660 TATTTTTAGTAGAGATGGGGGGG - Intergenic
1164964404 19:32469323-32469345 TATTTTTAGTAGAGACAGACGGG - Intronic
1165165710 19:33854050-33854072 TATTTTTAGTAGAGATGGGGGGG - Intergenic
1165200397 19:34139014-34139036 TATTTTTAGTAGAGACGGGGTGG + Intergenic
1165801418 19:38553157-38553179 TATTTTTAGTAGAGATGGGGAGG - Intronic
1165926894 19:39332152-39332174 TATTTTTAGTAGAGACATGTTGG - Intronic
1166501198 19:43342803-43342825 TATTTTTAGTAGAGATAGAGAGG - Intergenic
1166552513 19:43675703-43675725 AATTTCAGGCAGAGACAGAGAGG + Intergenic
1167098242 19:47387270-47387292 TATTTTTTGTAGAGACAGGCAGG + Intergenic
1167210576 19:48131632-48131654 TATTTTTAGTAGAGCCAGGCTGG + Intronic
1167330328 19:48851766-48851788 TATTTTTAGTAGAGACATGTTGG - Intronic
1167406478 19:49312050-49312072 TATTTTTAGTAGAGCCAGGTTGG + Intronic
1168715106 19:58522456-58522478 TATTTTTAGTAGGGACAGGCCGG - Intronic
925940194 2:8809760-8809782 TATTTCTGACAGAAATAGGGAGG - Intronic
926091845 2:10056262-10056284 TATTTTTAGTAGAGACGGGAGGG - Intergenic
926186701 2:10696395-10696417 TATTTTTAGTAGAGACGGCGGGG + Intergenic
927067160 2:19484785-19484807 TATTTATGGCAGAGAAAGAGAGG + Intergenic
927079387 2:19612689-19612711 TATTTTTAGTAGAGATGGGGTGG + Intergenic
927271734 2:21217638-21217660 GAAATCTAGGAGAGACAGGGAGG - Intergenic
927307661 2:21592055-21592077 TATTTATAGCAGAGCAAGGAAGG - Intergenic
927602405 2:24455492-24455514 TATTTTTAGTAGAGATGGGGGGG + Intergenic
927700021 2:25262012-25262034 TATTTTTAGTAGAGACGGGGTGG - Intronic
927892768 2:26762789-26762811 TATTTCTAGTAGAGATGGGGGGG - Intergenic
928003575 2:27542899-27542921 TATTTTCAGTAGAGACAGGGTGG - Intronic
928193565 2:29195969-29195991 AGTTTGTATCAGAGACAGGGAGG + Intronic
929059522 2:37909040-37909062 TATTTTGAGTAGAGACAGGGTGG + Intergenic
929233904 2:39586645-39586667 TATTTTTAGTAGAGACAGGCTGG + Intergenic
930374666 2:50550571-50550593 TATCTCTGGCAGAGATAGGCTGG + Intronic
930688919 2:54338977-54338999 TATTTTTAGTAGAGATGGGGGGG - Intronic
931101714 2:59009628-59009650 TATTTCTGGAAGACACAAGGAGG - Intergenic
931381936 2:61761866-61761888 TATTTTTAGTAGAGATGGGGGGG + Intergenic
931440996 2:62290372-62290394 TATTTTTAGTAGAGATGGGGGGG - Intergenic
931453268 2:62386395-62386417 TATTTTTAGTAGAGACATGTTGG + Intergenic
931928632 2:67104037-67104059 TATTTCTAGCAGATAAAGATGGG - Intergenic
931983068 2:67714692-67714714 TATTTTTAGTAGAGACGGGGTGG + Intergenic
932247485 2:70207728-70207750 TATTTTTAGTAGAGATGGGGGGG + Intronic
932721818 2:74144179-74144201 TATTTTTAGTAGAGACGGGGGGG + Intronic
932997813 2:76878696-76878718 TATTTTTAGTAGAGACAGGGTGG - Intronic
933110083 2:78386925-78386947 TATTTTTATTAGAGACGGGGTGG - Intergenic
934038884 2:88111251-88111273 TATTTCTAGAACACACAGAGAGG + Exonic
935671000 2:105557146-105557168 TGGTTCCTGCAGAGACAGGGAGG + Intergenic
936078419 2:109416420-109416442 TATTTTTAGTAGAAACGGGGGGG - Intronic
936282898 2:111158281-111158303 TAGTTCTAACAGAATCAGGGGGG + Intronic
936449728 2:112625219-112625241 TATTTTTAGTAGGGACAGGGCGG + Intergenic
937035409 2:118777633-118777655 TATTTTTAGTAGAGACAGCAGGG + Intergenic
937136448 2:119557825-119557847 TATTTTTAGTAGAGACAGATGGG - Intronic
937962819 2:127474681-127474703 TATTTTTAGTAGAGATGGGGGGG - Intronic
938268662 2:129949069-129949091 TATTTTTAGTAGAGACGGCGGGG - Intergenic
938531798 2:132194900-132194922 TATTCCTAGCAGAGATAAGATGG - Intronic
940517213 2:154697797-154697819 TCTTTCTGGCAGGGACAGCGCGG + Intergenic
940658409 2:156517151-156517173 TATTTTTTGTAGAGACAGGCTGG + Intronic
940823359 2:158382735-158382757 TATTTTTAGTAGAGACAGGGTGG - Intronic
942083596 2:172424863-172424885 TATTTTTAGTAGAGACGGGGTGG + Intergenic
944551250 2:200846536-200846558 TATTTTTAGTAGAGACTGGCTGG + Intergenic
944592936 2:201234629-201234651 TATTTTTAGTAGAGATGGGGGGG + Intronic
945297825 2:208188621-208188643 TACTTTTAGTAGAGACCGGGTGG + Intronic
945317656 2:208388137-208388159 TATTTTTAGTAGAGACGGGGGGG - Intronic
946686825 2:222279124-222279146 TATTTTTAGTAGAGACGGGGCGG + Intronic
946846115 2:223860444-223860466 TATTTTTAGTAGAGGCGGGGCGG - Intronic
946914883 2:224508783-224508805 TATTTTTATTAAAGACAGGGGGG - Intronic
947009469 2:225549807-225549829 TATTTTTAGTACAAACAGGGGGG - Intronic
947979667 2:234398311-234398333 TATTTTTAGTAGAGATGGGGTGG + Intergenic
948285435 2:236780950-236780972 TATTTTTAGTAGAGATGGGGGGG - Intergenic
1168751810 20:287731-287753 TATTTTTAGTAGAGACAGGCTGG - Intronic
1169276718 20:4238074-4238096 TATTTTTAGTAGAGACGGGGGGG - Intronic
1169837351 20:9895308-9895330 TATTTTTAGTAGAGACATGTTGG + Intergenic
1170158897 20:13293020-13293042 TATTTTTAGTAGAGACGGGGGGG - Intronic
1170364313 20:15583018-15583040 GATTTCTTGAAGAGAGAGGGAGG + Intronic
1170962899 20:21041186-21041208 TATTTTTAGTAGAGACAGCCAGG - Intergenic
1171024984 20:21622146-21622168 TCATTCTAGTGGAGACAGGGTGG + Intergenic
1171445163 20:25197447-25197469 TCTTTAAAGGAGAGACAGGGTGG - Intronic
1171996858 20:31738223-31738245 TATTTTTAGTAGAGATGGGGGGG + Intergenic
1172178777 20:32988076-32988098 TATTATTAGCAGAGCCATGGTGG + Intronic
1172493908 20:35364175-35364197 AATTTCTGTCAGAGAAAGGGTGG - Intronic
1173216594 20:41090676-41090698 TATTTTTAGTAGAGACGGGGGGG + Intronic
1173239244 20:41278948-41278970 TATTTCTAGTAGAGACAGACAGG + Intronic
1173674468 20:44821838-44821860 TATTTTTAGTAGAGACAGGATGG + Intergenic
1173684545 20:44913594-44913616 TATGTTTAGTGGAGACAGGGTGG + Intronic
1174025356 20:47569506-47569528 TATTTTTAATAGAGACAGGCAGG - Intronic
1174184565 20:48697556-48697578 TATTTTTAGTAGAGATGGGGGGG + Intronic
1174333116 20:49836632-49836654 TATTTCAAACAGTCACAGGGTGG - Intronic
1174425431 20:50428896-50428918 TATTTTTAGTAGAGACGGGGGGG + Intergenic
1174507438 20:51025607-51025629 TATTTTTTGCAGAGACAGGCGGG + Intergenic
1174681354 20:52411860-52411882 TATTTGTAACAGAGACTGTGTGG + Intergenic
1175506097 20:59485430-59485452 TATTTTTAGTAGAGACAGGTTGG + Intergenic
1176337678 21:5614003-5614025 TATTTTTAGTAGAGATGGGGTGG - Intergenic
1176471340 21:7109229-7109251 TATTTTTAGTAGAGATGGGGTGG - Intergenic
1176494901 21:7491007-7491029 TATTTTTAGTAGAGATGGGGTGG - Intergenic
1176505741 21:7647376-7647398 TATTTTTAGTAGAGATGGGGTGG + Intergenic
1176764660 21:13004538-13004560 TATTCCTAGCAGAGATAAGATGG + Intergenic
1176785578 21:13252332-13252354 TATTTTTAGTAGAGACAGGGGGG + Intergenic
1178130985 21:29572465-29572487 GATTTCTATCAGAGAGAGGGAGG - Intronic
1180429239 22:15230985-15231007 TATTCCTAGCAGAGATAAGATGG + Intergenic
1180577429 22:16792115-16792137 TATTTTTAGTAGAGACAGACAGG + Intronic
1182331719 22:29555709-29555731 TACTTCTAGCAGGGGGAGGGAGG + Exonic
1182351153 22:29700750-29700772 CATCTCCAGCAGAGAGAGGGAGG + Intergenic
1182507699 22:30796679-30796701 TATTTTTAGTAGAGACAGGGGGG + Intronic
1182553338 22:31114334-31114356 TATTTTTAGTAGAGACGGGGGGG - Intronic
1182602354 22:31476049-31476071 TTTTTCTAGTAGAAACAGGAAGG + Intronic
1182713659 22:32338487-32338509 TATTTTTAGTGGAGACAGGGTGG - Intergenic
1182786539 22:32912541-32912563 TATTTTTAGTAGAGATGGGGGGG - Intronic
1183101987 22:35589759-35589781 TATTTTTAGTAGAGATGGGGTGG - Intergenic
1184400941 22:44274068-44274090 TATTTTTAGTGGAGACAGGGTGG - Intronic
1185027120 22:48421130-48421152 TATTTTTAGTAGAGACTGGATGG - Intergenic
1185067772 22:48640601-48640623 CATTTCTTGCAGAGGCTGGGCGG + Intronic
949193921 3:1283147-1283169 TATTTTTAGTAGAGACAGGGTGG + Intronic
949832937 3:8235968-8235990 TATTTTTAGTAGAGGCGGGGTGG - Intergenic
950640364 3:14344619-14344641 TTTTTCCAGCTGAGACAGGTTGG - Intergenic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
951217498 3:20039776-20039798 TCTCTCTGTCAGAGACAGGGTGG + Intergenic
951910310 3:27743392-27743414 TATTTTTAGTAGCGAGAGGGTGG + Intergenic
951963114 3:28350658-28350680 TAATTGAAGCAGATACAGGGTGG - Intronic
952378294 3:32784933-32784955 TATTTTTAGTACAGACGGGGTGG + Intergenic
952798026 3:37260457-37260479 TATTTTTAGTAGAGACAGCGGGG - Intronic
952926454 3:38323746-38323768 TGTTTTTAGCAGAGACGGGGGGG + Intergenic
953648920 3:44782224-44782246 TATATTTAGTAGAGACGGGGTGG + Intronic
953716851 3:45322978-45323000 AATTTCTTGCAGAGAATGGGGGG - Intergenic
953961319 3:47268257-47268279 AATTTTTTGTAGAGACAGGGTGG + Intronic
955054882 3:55446332-55446354 TATTTTTAGTAGGGACGGGGGGG + Intergenic
957261894 3:77912440-77912462 TATTTCTAAAAGTGACAAGGAGG - Intergenic
957474172 3:80702746-80702768 TATTTTTAGTAGAGACGGGGGGG + Intergenic
957746685 3:84352677-84352699 TATTTCTAGAATGAACAGGGAGG - Intergenic
958271642 3:91507423-91507445 TATTTTTAGTAGAGACAGGCTGG + Intergenic
958535889 3:95402539-95402561 TATTTTTAGTAGAGACAGATGGG + Intergenic
962517470 3:136166210-136166232 TATTTTTAGTAGAGACAGCCTGG - Intronic
962578395 3:136775321-136775343 TATTTTTAGTAGAGATGGGGGGG + Intergenic
962817346 3:139013819-139013841 TATTTTTAGTAGAGACATGTTGG + Intronic
963125911 3:141816105-141816127 AATTTCTAGCATAGAGATGGAGG + Intronic
963196728 3:142540112-142540134 CATTTATAGAAAAGACAGGGAGG + Intronic
963766700 3:149343578-149343600 TATCTCAAGCAGAGAAAGGAAGG + Intergenic
964218387 3:154315621-154315643 TATTTGTAGCTCAGAAAGGGTGG - Intronic
964234183 3:154506048-154506070 TATTTTTAGTAGAGACGGGGTGG + Intergenic
964268591 3:154930077-154930099 TATTTTTAGTAGAGATGGGGTGG + Intergenic
964373360 3:156025012-156025034 TATGTTTGGAAGAGACAGGGTGG - Intergenic
965266284 3:166547696-166547718 TATTTTTAGTAGAGACAGGCTGG + Intergenic
965583825 3:170297625-170297647 TATTTTTAGTAGAGATGGGGGGG + Intronic
966401612 3:179553138-179553160 TATTTTTAGTAGAGACAGGCAGG - Intergenic
966510468 3:180757089-180757111 TATTTTTAGTAGAGACGGGTAGG - Intronic
966661150 3:182416346-182416368 TATTCCCAGCTGAGCCAGGGAGG - Intergenic
966769442 3:183491283-183491305 TATTTTTAGTAGAGACGGGGCGG + Exonic
966861176 3:184231507-184231529 TATTTGTGGGAGAGTCAGGGAGG - Intronic
967152864 3:186665672-186665694 GATTTCCAGCTGAGACAGGCAGG + Intronic
967921088 3:194615063-194615085 TATTTTTAGTAGAGACAGATGGG - Intronic
968160325 3:196421598-196421620 TATTTTTACTAGAGACTGGGGGG - Intronic
969029491 4:4200296-4200318 TATTTTTAGTAGAGCCAGGATGG - Intronic
969418958 4:7079063-7079085 TATTTTTAGTAGAGATGGGGTGG + Intergenic
969567836 4:7990371-7990393 TATTTTTAGTAGAGACAGGGAGG + Intronic
971079250 4:23190553-23190575 TATTTTTAGTAGAGACAGGTTGG - Intergenic
971110828 4:23583837-23583859 TATTGGGAACAGAGACAGGGAGG - Intergenic
972470677 4:39401021-39401043 TATTTTTAGTAGAGATGGGGGGG + Intergenic
972833994 4:42846558-42846580 TATCTCCAGCAGAGACATAGAGG - Intergenic
972874725 4:43344168-43344190 TATTTTTAGTAGAGACGGGGGGG + Intergenic
973135939 4:46707134-46707156 TATTTTTAGTAGAGACAGACGGG - Intergenic
973148368 4:46858267-46858289 TATTTTTAGTAGAGATGGGGGGG + Intronic
973735942 4:53871878-53871900 TAATTGTAACACAGACAGGGAGG + Intronic
975394242 4:73856357-73856379 TATTTTTAGTAGAGACAGGTTGG + Intergenic
975569535 4:75800121-75800143 TATTTTTAGTAGAGACATGTTGG + Intronic
975839098 4:78455224-78455246 TATTTTTAGTAGAGCCGGGGAGG - Intronic
977064201 4:92293030-92293052 TATTTTTAGTAGAGACAGGATGG - Intergenic
977113469 4:92990483-92990505 TATTTTTAGTAGAGACGGTGCGG + Intronic
977247312 4:94648493-94648515 TATTTTTAGTAGAGACAGTCTGG + Intronic
978779636 4:112537021-112537043 TACTTTTAGTAGAGACGGGGGGG - Intergenic
980048824 4:128018455-128018477 TTTTTTTTGTAGAGACAGGGTGG - Intronic
980112996 4:128652583-128652605 TATTTTTAGTTGAGACGGGGTGG + Intergenic
980903241 4:138924820-138924842 TATTTTTATCAGAGAAATGGAGG + Intergenic
981720770 4:147799208-147799230 TATTTTTAGTAGAGACGGGATGG + Intronic
981776012 4:148368444-148368466 TAACAATAGCAGAGACAGGGTGG - Intronic
981830146 4:148990226-148990248 AAGTTATAGCAGAGACAAGGTGG - Intergenic
982021683 4:151211012-151211034 TATTTGTAGTAGAGACAGTCAGG - Intronic
982916544 4:161217184-161217206 TATTTTTAGTAGAGACAGGCTGG - Intergenic
983201117 4:164861390-164861412 GAATTCTACCAGAGACAAGGAGG + Intergenic
983564418 4:169134134-169134156 TATTTCTAGAAGAGGCTGGGAGG - Intronic
983920480 4:173338742-173338764 TATTTTTAGTAGAGACAGGTTGG + Intergenic
983937340 4:173511141-173511163 TATATTTAGTAGAGACGGGGTGG + Intergenic
984185821 4:176542424-176542446 GATTGCTTACAGAGACAGGGTGG - Intergenic
984396967 4:179214305-179214327 TATTAATACCATAGACAGGGTGG + Intergenic
984795384 4:183655456-183655478 TATTTTTAGTAGAGACAGTGGGG + Intronic
985243754 4:187958647-187958669 TATAATTAGCAGAGACAGTGGGG + Intergenic
985752575 5:1689461-1689483 TATTTCTACCAGTATCAGGGTGG + Intergenic
986884463 5:12216416-12216438 TATTTTTAGTAGAGACGGGGTGG - Intergenic
987054209 5:14176133-14176155 TGTTTTTAACAGAGACAGGGTGG - Intronic
987210429 5:15676571-15676593 TATTTCTTACAGAGACAGAAAGG + Intronic
987767039 5:22245499-22245521 TAAATATAGCAGAGATAGGGTGG + Intronic
987855288 5:23412842-23412864 TATTTCTTACAGAGACAGCAGGG + Intergenic
988027478 5:25715862-25715884 TATTTTTAGTAGAGATGGGGGGG + Intergenic
989073833 5:37541348-37541370 TGTTTTTGGCAGAGACAGGGAGG + Intronic
989578399 5:43010063-43010085 CAGTTCCAGCAGACACAGGGAGG + Intergenic
989593059 5:43129828-43129850 TATTTTTAGTAGAGACGGCGGGG + Intronic
989772959 5:45166687-45166709 TATTTTTAGTAGAGATGGGGGGG - Intergenic
990251338 5:53918361-53918383 TATTTTTAGTAGAGATGGGGGGG + Intronic
990533521 5:56697411-56697433 TATTTTTAGTAGAGATGGGGGGG - Intergenic
990754370 5:59052177-59052199 TAGTTCGAGCAGGGAGAGGGAGG + Intronic
991337531 5:65565628-65565650 TATTTTTAGTAGAGACTGGCGGG - Intronic
991771473 5:70044975-70044997 TATTTTTAGTAGAGATGGGGTGG + Intergenic
991850764 5:70920393-70920415 TATTTTTAGTAGAGATGGGGTGG + Intergenic
992913047 5:81417035-81417057 TATTTTTAGTAGAGATGGGGGGG + Exonic
993656522 5:90584768-90584790 TACTTCTAGCAAAGACAGGCTGG - Intronic
994164243 5:96592221-96592243 TATTTCTAGCAGAGACAGGGTGG - Intronic
994701783 5:103142595-103142617 TATTTTTAGTAGAGACTGAGAGG - Intronic
995135497 5:108675670-108675692 TATTTTTAGTAGAGAGGGGGTGG + Intergenic
995173650 5:109147656-109147678 TATTTCTAGCTGAAAAAGGCAGG + Intronic
995201271 5:109427395-109427417 TATTTTTTGTAGAGACAGGGTGG - Intergenic
995283864 5:110364634-110364656 TATTTTTAGTAGAGACGGGGAGG - Intronic
995288164 5:110415508-110415530 TATTCCAAGCAGAGACATTGTGG - Intronic
995520615 5:113000949-113000971 TATTTCTAGAAATGACAGGCTGG - Intronic
996152890 5:120061717-120061739 TATTTTTTGTAGAGACAGGGCGG - Intergenic
996433916 5:123413093-123413115 TATTTTTAGTAGAGACAGACGGG - Intronic
996885402 5:128347952-128347974 TATTTTTAGTAGAGACGGGGAGG + Intronic
997046114 5:130320008-130320030 TATTTCTACCAGATAAAGTGTGG - Intergenic
997493837 5:134303672-134303694 TATTTTTAGTAGAGACGGGGGGG - Intronic
997549271 5:134738174-134738196 TATTTTTAGTAGAGACGGGTGGG + Intergenic
998584867 5:143416688-143416710 TCCTTCTGGAAGAGACAGGGAGG + Intronic
999392857 5:151206805-151206827 TATTTTTAGTAGAGATGGGGTGG + Intronic
1000052102 5:157572261-157572283 TATTTTTACTAGAGACTGGGAGG + Intronic
1000094614 5:157960361-157960383 CATTTTTAGCAGAGATAGTGGGG - Intergenic
1000190973 5:158910221-158910243 TGTTCCTATCAGAAACAGGGTGG + Intronic
1000826797 5:166054897-166054919 TATTTTTAGTAGAGGCAGGCTGG + Intergenic
1000855748 5:166396084-166396106 TATTTTTAGTACAGACGGGGTGG - Intergenic
1001604443 5:172949894-172949916 TATTTTTAGTAGAGACAGGGTGG - Intronic
1001852164 5:174978252-174978274 TATTTTTTGTAGAGACAGGGGGG + Intergenic
1002006206 5:176237115-176237137 TATTTTTAGTAGAGACGAGGTGG + Intergenic
1002220169 5:177673522-177673544 TATTTTTAGTAGAGACGAGGTGG - Intergenic
1002258409 5:177977216-177977238 TATTTTTAGTAGAGACGGGTTGG - Intergenic
1002498114 5:179629469-179629491 TATTTTTAGTAGAGATAGGTTGG + Intronic
1002545785 5:179944142-179944164 TATTTTTAGTAGAGACGGGGGGG + Intronic
1003059212 6:2849648-2849670 TATTTTTAGTAGAGACGGGGTGG - Intergenic
1003090976 6:3102775-3102797 TATTTTTAGTAGAGATGGGGTGG + Intronic
1003342111 6:5231551-5231573 TTTTTTTAGTAGACACAGGGAGG - Intronic
1003477177 6:6494408-6494430 TATTTTTAGTAGAGACAGGGTGG + Intergenic
1004623936 6:17357269-17357291 TATTTTTAGTAGAGACAGGGTGG + Intergenic
1005010235 6:21328877-21328899 TATTTTTAGTAGAGACACGGGGG - Intergenic
1005580336 6:27228199-27228221 TATTTTTAGTAGAGATGGGGGGG - Intergenic
1005605620 6:27474034-27474056 TATTTTTAGTAGAGACGAGGGGG + Intergenic
1006540146 6:34733302-34733324 TATTTTTAGTAGAGACGGGGGGG - Intergenic
1006590699 6:35153752-35153774 TATTTTTAGTAAAGACGGGGGGG + Intergenic
1006684665 6:35822682-35822704 TATTTTTAGGAGGGACAGGATGG + Intronic
1006846043 6:37062240-37062262 TATTTTTAGTAGAGATGGGGGGG + Intergenic
1007449781 6:41933945-41933967 TATTTTTAGTAGAGACGGGGTGG + Intergenic
1007587998 6:43003909-43003931 TATTTTTAGTAGAGACGGGGTGG + Intronic
1007612616 6:43160290-43160312 TATTTTTAGTAGAGATGGGGGGG + Intronic
1008780340 6:55095554-55095576 TATTTTTAGTAGAGACGGGGTGG + Intergenic
1008983473 6:57513696-57513718 TATTTTTAGTAGAGACAGGCTGG - Intronic
1009171529 6:60406564-60406586 TATTTTTAGTAGAGACAGGCTGG - Intergenic
1009552734 6:65119970-65119992 TATTTTTAGTAGAGACGGGGAGG - Intronic
1009864493 6:69379768-69379790 TATTTCTGGCAGTGCCAAGGTGG + Intronic
1009940935 6:70287144-70287166 TATTATAAGCAGAGACACGGAGG + Intronic
1010190070 6:73186051-73186073 TATTTTTTGCAGAGATAGGGGGG - Intronic
1010414274 6:75596088-75596110 TATTTTTAGTAGAGACAGGCTGG - Intergenic
1010959867 6:82133585-82133607 TATTTTTAGTAGAGACATGTTGG - Intergenic
1011465557 6:87652449-87652471 TATTTATAGCACAGGCAGAGTGG - Intronic
1011939383 6:92824066-92824088 TATTTTTAGTAGAGATGGGGGGG + Intergenic
1013331549 6:109106755-109106777 TATTTTTAGTAGAGACAGGGGGG - Intronic
1014161249 6:118171210-118171232 TATTTTTTGTAGAGACAGTGGGG + Intronic
1015027147 6:128548738-128548760 TATTTTTAATAGAGACAGGATGG - Intergenic
1015146791 6:129996017-129996039 TATTTTTAGTAGAGATGGGGGGG + Intergenic
1015411439 6:132898032-132898054 TATTTCTAGTAGAGACAAGCTGG - Intergenic
1015551722 6:134419103-134419125 TATTTTTAGTAGAGAGATGGGGG + Intergenic
1015773875 6:136793966-136793988 TATTTTTAGTAGAGACGGGAGGG + Intergenic
1015909762 6:138159008-138159030 TATTTTTAGTAGAGGCAGGGGGG + Intergenic
1017139959 6:151181504-151181526 TATTTTTAGTAGAGACGGGCTGG + Intergenic
1018056884 6:160059754-160059776 TGTTTATATCAGAAACAGGGAGG - Intronic
1018139531 6:160816370-160816392 TATTTTTAGTAGAGACGGGACGG - Intergenic
1018307272 6:162470926-162470948 TATTTTTAGTAGAGATGGGGTGG + Intronic
1019807601 7:3139782-3139804 TATTTTTAGTAGAGACGGGGTGG + Intergenic
1019827077 7:3293265-3293287 TATTTTTAGTAGAGACGGGGGGG + Intergenic
1019891716 7:3952405-3952427 TATTTTTAGTAGAGACGGGCGGG - Intronic
1020102138 7:5399864-5399886 TATTTATAGTAGAGACGGGGCGG - Intronic
1020174452 7:5871176-5871198 TATTTTTTGTAGAGACGGGGGGG - Intergenic
1020285389 7:6675511-6675533 TATTTTTAGTAGAGACAGGCTGG + Intergenic
1022440592 7:30429841-30429863 TATTTTTAATAGAGACAGGTTGG - Intronic
1023409606 7:39876575-39876597 TATTTTTATTAGAGACAGGATGG + Intergenic
1023809476 7:43901060-43901082 TATTTCTAGTATAGAGAGGAGGG - Intronic
1023821061 7:43980711-43980733 TATTTTTAGTAGAGATTGGGCGG - Intergenic
1024184802 7:46939252-46939274 TATTTCTAGCAGAATCTGAGAGG - Intergenic
1024627002 7:51216355-51216377 TACTTTTAGTAGAGACAGGTTGG + Intronic
1024925208 7:54605246-54605268 TATTTTTAGTAGAGACGGGGGGG - Intergenic
1026038742 7:66848005-66848027 TATTTTTGGTAGAGACGGGGTGG + Intergenic
1026261975 7:68763301-68763323 TATTTTTAGTAGAGACAAGTTGG - Intergenic
1026687609 7:72524784-72524806 TATTTTTAGTAGAGACATGTTGG + Intergenic
1026927330 7:74203650-74203672 TTTTTTTTGCAGAGATAGGGAGG - Intronic
1027328235 7:77064863-77064885 TATTTTTAGTAGAGATTGGGCGG + Intergenic
1029084299 7:97999177-97999199 TATTTTTTGTAGAGACGGGGAGG + Intergenic
1029089619 7:98038079-98038101 TATTTTTAATAGAGACGGGGTGG - Intergenic
1029228441 7:99046553-99046575 TATTTTTAGTAGAGATGGGGGGG - Intronic
1029358807 7:100073071-100073093 TCATTCTAGCAGAGAGATGGTGG + Intronic
1029406895 7:100380791-100380813 TATTTTTAGTAGAGACAGGGAGG - Intronic
1029749335 7:102534150-102534172 TATTTTTAGAAGAGATTGGGCGG - Intergenic
1029767278 7:102633254-102633276 TATTTTTAGAAGAGATTGGGCGG - Intronic
1029818499 7:103122110-103122132 TTTTTTTTGTAGAGACAGGGTGG + Intronic
1030051895 7:105545699-105545721 TATTTTTAGTAGAGACGGGAAGG + Intronic
1030229300 7:107189423-107189445 TATTTTTAACATAGAAAGGGTGG - Exonic
1030346508 7:108439657-108439679 TATTTTTAGTAGAGATAGGCTGG - Intronic
1030845107 7:114400030-114400052 TATTTTTAGTAGAGACGGGGGGG + Intronic
1030883442 7:114910565-114910587 TATTTTTAGTAGAGACGGGAAGG - Intergenic
1031228133 7:119067921-119067943 TATTTTTGGTAGAGACAGGGAGG + Intergenic
1031413517 7:121468085-121468107 TATTTTTAGTAGAGACAGGGTGG - Intergenic
1031996045 7:128231838-128231860 TATTTTTGGTAGAGACAGGGGGG - Intergenic
1032351377 7:131166859-131166881 TATTTTTAGTAGAGACAGGATGG + Intronic
1032718038 7:134527668-134527690 TATTGTTAGTAGAGACAGGCTGG - Exonic
1032722658 7:134563370-134563392 TATTTTTAGTAGAGACAGACTGG - Intronic
1033355075 7:140592773-140592795 TATTTTTTGTAGAGATAGGGGGG + Intronic
1033593290 7:142833178-142833200 AATGACAAGCAGAGACAGGGTGG + Intergenic
1033802410 7:144916695-144916717 TATTTTTAGTAGAGACATGTTGG + Intergenic
1034191323 7:149215618-149215640 TAGTTCTAGAAGAGCCAGTGTGG + Intronic
1034606230 7:152318446-152318468 TATTTTTAGTAGAGATGGGGAGG - Intronic
1034711981 7:153200890-153200912 TATTTTTAGTAGAGACGGGCTGG - Intergenic
1036419933 8:8586060-8586082 TATTGGTGGCTGAGACAGGGTGG - Intergenic
1037121054 8:15287528-15287550 CATTTCTATCAGACACAGAGCGG - Intergenic
1037339070 8:17823161-17823183 TATTTTCAGTAGAGACTGGGGGG - Intergenic
1037593722 8:20336038-20336060 TATTTTTAGTAGAGACGGGACGG - Intergenic
1037682320 8:21107766-21107788 TATTTTTAGTAGAGACAGATGGG - Intergenic
1037986254 8:23292429-23292451 TATTTTTAGTAGAGACAGGCAGG - Intronic
1038016993 8:23523798-23523820 CATTTTTAGCAGAGACAGCAGGG + Intergenic
1038196074 8:25369433-25369455 TGTTTCCAGCACAGACAGGGAGG - Intronic
1038727498 8:30094898-30094920 TGTTTTTTGTAGAGACAGGGCGG - Intergenic
1038739373 8:30203382-30203404 TATTTTTAGTAGAGACAGGCTGG - Intergenic
1038797833 8:30725386-30725408 TATTTTTAGTAGAGCCAGGCTGG - Intronic
1039583985 8:38690063-38690085 TTTTTCTGGTAGAGACAGTGGGG + Intergenic
1041067524 8:54096562-54096584 TATTTTTAGTAGAGACGGGGGGG - Intronic
1041081551 8:54219491-54219513 TATTTTTAGTAGAGATGGGGGGG - Intergenic
1041508143 8:58624215-58624237 TATTTTTAGTAGAGACAGGGCGG + Intronic
1041932585 8:63303503-63303525 TATTTTTAGTACAGACAGTGGGG + Intergenic
1042007400 8:64196785-64196807 CATTTCTAGCAGAGACAATGTGG + Intergenic
1042907176 8:73783935-73783957 TATTTTTAGTAGAGACAAGTTGG + Intronic
1043500973 8:80855467-80855489 TGTTTCTTGCAGTGACATGGGGG + Intronic
1044658339 8:94571408-94571430 TATTTTTAGTAGAGACGGGATGG - Intergenic
1044780947 8:95742889-95742911 TATTTTTAGTAGAGACAGACAGG - Intergenic
1044983940 8:97741731-97741753 TATTTTTAGTAGAGACGGGGGGG - Intergenic
1045100866 8:98842826-98842848 TATTTTTGACAGAGACAGGGAGG - Intronic
1045695815 8:104807595-104807617 AATTTAAAGCAGAGGCAGGGAGG - Intronic
1045875588 8:106977255-106977277 TCTTTCTTGCAGAGGCAGAGAGG + Intergenic
1046269777 8:111879765-111879787 TATTTTTAGTAGAGACAGGGAGG + Intergenic
1046444499 8:114299205-114299227 TATTTTTAATAGAGACAGGGTGG + Intergenic
1047105743 8:121728517-121728539 TATTTTTAGTGGAGACGGGGGGG - Intergenic
1047256108 8:123214659-123214681 TATTTTTAGTAGAGACGGAGTGG - Intergenic
1047459398 8:125047743-125047765 TGTTTTTAGTAGAGACAGGCTGG + Intronic
1048128851 8:131669179-131669201 TATTTCTACCAGTGTCAGGCTGG - Intergenic
1048816616 8:138340217-138340239 TCTCTCTAGCAGTGACAGTGGGG - Intronic
1049081180 8:140444687-140444709 TATTTTTAGTAGAGATGGGGGGG - Intronic
1049946666 9:603782-603804 TATTTTTAGTAGAGACGGGGTGG - Intronic
1050542174 9:6680217-6680239 TATTTTTAGTAGAGACGGTGGGG - Intergenic
1050577379 9:7011436-7011458 TATTTCTGGTAGGGATAGGGAGG + Intronic
1050596164 9:7206458-7206480 TATTTTTAGTAGAGATGGGGTGG + Intergenic
1051138360 9:13950259-13950281 TATTTCCCTCAGAAACAGGGTGG + Intergenic
1052634779 9:31088103-31088125 TATTTCTACCAGCTCCAGGGAGG + Intergenic
1053253350 9:36593866-36593888 TATTTTTAGTAGAGACGGGTTGG + Intronic
1053431615 9:38045435-38045457 TATTTTTAGTAGAGACTTGGGGG - Intronic
1053578417 9:39377066-39377088 TATTTTTAGTAGAGACAGACAGG - Intergenic
1053578752 9:39381081-39381103 TATTTTTAGTAGAGACATGTTGG - Intergenic
1053589643 9:39498949-39498971 TATTTTTAGTAGAGATGGGGGGG + Intergenic
1053710410 9:40801392-40801414 TATTCCTAGCAGAGATAAGATGG - Intergenic
1053843270 9:42209160-42209182 TATTTTTAGTAGAGACATGTTGG - Intergenic
1054100335 9:60939885-60939907 TATTTTTAGTAGAGACATGTTGG - Intergenic
1054121400 9:61211500-61211522 TATTTTTAGTAGAGACAGACAGG - Intergenic
1054121732 9:61215511-61215533 TATTTTTAGTAGAGACATGTTGG - Intergenic
1054420318 9:64922181-64922203 TATTCCTAGCAGAGATAAGATGG - Intergenic
1054576654 9:66866359-66866381 TATTTTTAGTAGAGATGGGGGGG - Intronic
1054586010 9:66966997-66967019 TATTTTTAGTAGAGACATGTTGG + Intergenic
1054787421 9:69222350-69222372 TATTTTCAGTAGAGACAGGTTGG + Intronic
1055092584 9:72377942-72377964 TATTTTTAGTAGAGACGGGGGGG - Intergenic
1055592680 9:77833799-77833821 TATTTCTACGAAAGAAAGGGTGG - Intronic
1055950838 9:81728321-81728343 TATTTTTAGTAGAGACGGGGGGG + Intergenic
1056190537 9:84180232-84180254 TATTTTTAGTAGAGACGGGGTGG + Intergenic
1056257901 9:84819113-84819135 CATTTCTAAAAGAGAGAGGGAGG - Intronic
1056387427 9:86110652-86110674 TATTTTTAGGAGAGACGGGTTGG + Intergenic
1057021190 9:91698894-91698916 TGTTTTTAGTAGAGACGGGGTGG + Intronic
1057603438 9:96479997-96480019 TATTTTTTGTAGAGACTGGGTGG - Intronic
1057688258 9:97257327-97257349 TATTTTTAGTAGAGACGGGCAGG + Intergenic
1058452874 9:105113411-105113433 TATTTTTAGTAGAGACAGATGGG - Intergenic
1058641205 9:107087337-107087359 TATTTCTGGCGGAGACAGTTGGG - Intergenic
1058656274 9:107223961-107223983 TATTTTTAGTAGAGACAGAATGG + Intergenic
1058713537 9:107702272-107702294 TGTTTCTAGCAGGGTCAGGAGGG - Intergenic
1058891081 9:109361363-109361385 TATTTTTAGCAGAGACGACGGGG + Intergenic
1059135924 9:111806440-111806462 TTCTATTAGCAGAGACAGGGAGG - Intergenic
1059406511 9:114101386-114101408 TATTTTTAGTAAAGACAGGGAGG + Intergenic
1060186200 9:121565613-121565635 TATTTTTAGTAGAGATATGGGGG + Intergenic
1061107581 9:128543509-128543531 TATTTTTAGTAGAGATGGGGGGG - Intergenic
1061297170 9:129682930-129682952 TATTTTTAGTAGAGATGGGGGGG - Intronic
1061431457 9:130533860-130533882 TATTTTTAGTAGAAACAGGGTGG + Intergenic
1061814540 9:133186522-133186544 TATTTTTAGTAGAGACAGGGGGG - Intergenic
1061829638 9:133283050-133283072 GATTTTTAGTAGAGACAGGGGGG + Intergenic
1062149941 9:135012918-135012940 TATTTTTAGTAGAGACAGGGTGG + Intergenic
1062411516 9:136427781-136427803 TATTTTTAGTAGAGATGGGGGGG + Intergenic
1203423986 Un_GL000195v1:20931-20953 TATTTTTAGTAGAGATGGGGTGG + Intergenic
1185477580 X:424660-424682 TATTTTTAGCAGAGGCGGGGGGG - Intergenic
1185977742 X:4740323-4740345 TATTCATAGCAGTGAAAGGGTGG + Intergenic
1186157664 X:6742414-6742436 TATTTATGGCAGAGACTGTGTGG + Intergenic
1187335255 X:18376107-18376129 TCTGTCTAGTGGAGACAGGGTGG - Intergenic
1187339357 X:18407528-18407550 TATTTTTAGTAGAGATGGGGGGG - Intergenic
1187346820 X:18473129-18473151 TATTTTTAGTAGAGAGAGGGGGG + Intronic
1187864541 X:23712227-23712249 TATTTTTAGTAGAGATGGGGGGG - Intronic
1188026108 X:25210782-25210804 TTTTTCTATCAGAGTCAGGCTGG - Intergenic
1188273819 X:28177260-28177282 TTTCTCCTGCAGAGACAGGGAGG + Intergenic
1188345386 X:29058199-29058221 TATTTTTGGTAGAGACGGGGGGG - Intronic
1188912262 X:35864521-35864543 TATTTTTAGTAGAGACGGGGGGG - Intergenic
1188977341 X:36691171-36691193 TAATTCTAGGAGGGACAGGCTGG - Intergenic
1190408683 X:50113168-50113190 TATTTTTTGTAGAGACAGGGTGG + Intergenic
1191717112 X:64201246-64201268 TATTTCTAGCAAAGGCAGGCAGG - Intronic
1193679504 X:84501309-84501331 TGATTCTAGCAGAGACACAGAGG + Intronic
1195760280 X:108238279-108238301 TATTTTTAGTAGAGATGGGGGGG + Intronic
1196255592 X:113514593-113514615 TTTTTTTAGCAGTGCCAGGGTGG - Intergenic
1197234413 X:124043302-124043324 TATTTTTAGTAGAGACATGGTGG + Intronic
1197829035 X:130621788-130621810 TATTTTTAGTAGAGACGGGGCGG + Intergenic
1198206726 X:134472740-134472762 TATTTTTAGTAGAGACGGCGGGG + Intronic
1198724125 X:139658849-139658871 TATTTTTTGTAGAGACGGGGTGG + Intronic
1199810059 X:151340260-151340282 TATTTTTAGTAGAGATGGGGTGG + Intergenic
1200601400 Y:5209884-5209906 TATTTTTAGTAGAGATGGGGTGG - Intronic
1201551216 Y:15218822-15218844 TATTTATGGCAGAGACTGTGTGG + Intergenic
1201791536 Y:17846422-17846444 TATTTTTAATAGAGACAGTGTGG + Intergenic
1201799446 Y:17939101-17939123 TATTTTTAATAGAGACAGTGTGG + Intergenic
1201802107 Y:17966855-17966877 TATTTTTAATAGAGACAGTGTGG - Intergenic
1201810018 Y:18059567-18059589 TATTTTTAATAGAGACAGTGTGG - Intergenic