ID: 994168539

View in Genome Browser
Species Human (GRCh38)
Location 5:96633710-96633732
Sequence ACTTTGTCCTGGGTGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 221}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994168539_994168542 2 Left 994168539 5:96633710-96633732 CCTTTCTTCACCCAGGACAAAGT 0: 1
1: 0
2: 0
3: 26
4: 221
Right 994168542 5:96633735-96633757 GAACAGAAATAGCAAAGCCTAGG No data
994168539_994168546 30 Left 994168539 5:96633710-96633732 CCTTTCTTCACCCAGGACAAAGT 0: 1
1: 0
2: 0
3: 26
4: 221
Right 994168546 5:96633763-96633785 AGCTAGCTAGAGGGAAAAGATGG 0: 1
1: 0
2: 1
3: 34
4: 341
994168539_994168545 21 Left 994168539 5:96633710-96633732 CCTTTCTTCACCCAGGACAAAGT 0: 1
1: 0
2: 0
3: 26
4: 221
Right 994168545 5:96633754-96633776 TAGGAATGAAGCTAGCTAGAGGG No data
994168539_994168544 20 Left 994168539 5:96633710-96633732 CCTTTCTTCACCCAGGACAAAGT 0: 1
1: 0
2: 0
3: 26
4: 221
Right 994168544 5:96633753-96633775 CTAGGAATGAAGCTAGCTAGAGG 0: 1
1: 0
2: 0
3: 18
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994168539 Original CRISPR ACTTTGTCCTGGGTGAAGAA AGG (reversed) Intronic
900837406 1:5015852-5015874 ACTTGGTGCTGGGTGAAAAGTGG - Intergenic
904269774 1:29342366-29342388 CCTTGGACCTGGGAGAAGAATGG - Intergenic
904909728 1:33925642-33925664 ACTCTGGCCTCTGTGAAGAATGG - Intronic
905108586 1:35578199-35578221 GCTGTGTCCTGTGTGATGAAAGG - Intronic
905459974 1:38116180-38116202 CCTTTCTCCTGGGAGAAGACTGG + Intergenic
906613406 1:47219220-47219242 ACATAGGCCTGGGTGAAGATGGG + Exonic
907721914 1:56980104-56980126 CCTGTGTCCTGAGTTAAGAAAGG + Intergenic
914203230 1:145505087-145505109 TCTTTTTCTTAGGTGAAGAAAGG + Intergenic
914237159 1:145823010-145823032 TCTTTTTCTTAGGTGAAGAAAGG + Intronic
914482352 1:148078241-148078263 TCTTTTTCTTAGGTGAAGAAAGG + Intergenic
915897490 1:159823316-159823338 GCTTTGTGCTGGGGGCAGAATGG - Intergenic
919121584 1:193347657-193347679 ACTTTGGCCTGGTTGATGAATGG - Intergenic
920006210 1:202835606-202835628 ACTTTGGCCAGTGTGAAGAGTGG + Intergenic
920364022 1:205438672-205438694 CCTCAGCCCTGGGTGAAGAAGGG + Intronic
920368285 1:205460155-205460177 TCTTTGTGCTGGCTGATGAATGG - Intergenic
920534357 1:206728079-206728101 AATTGGTCCAGGGAGAAGAAGGG + Intronic
921251719 1:213304252-213304274 AGTATGTCCTGGGTTAAGGAAGG - Intergenic
921359645 1:214318821-214318843 GCTTTCTACTGGGTGAATAATGG + Intronic
922573727 1:226648304-226648326 TCTTTGTCCAGGGTGACAAATGG + Intronic
1064809355 10:19177484-19177506 CCTTTATGATGGGTGAAGAAAGG - Intronic
1066295237 10:34048331-34048353 ACTTTGGTCTGGGAGAAGGAAGG - Intergenic
1069622441 10:69846240-69846262 ACAGGGTCCTGGATGAAGAAGGG + Intronic
1069786721 10:70992965-70992987 ATTTTGTGCTGGGTGGAGAAGGG + Intergenic
1070577074 10:77687349-77687371 GACTTTTCCTGGGTGAAGAAAGG - Intergenic
1070782716 10:79146836-79146858 GCATTCTTCTGGGTGAAGAAGGG + Intronic
1073989638 10:109248001-109248023 ACTTTACCCTGGGTGTGGAATGG + Intergenic
1075235167 10:120721351-120721373 GCTTTGCCATGGGTGAACAAGGG - Intergenic
1076579513 10:131497256-131497278 ACTTTGACCTGGGTGAGGCATGG + Intergenic
1077730777 11:4726981-4727003 ACTCCATCCTGGGTGAAGACCGG + Intronic
1081455903 11:43222374-43222396 ACTTTTTCCTGGAAGAAGCAGGG - Intergenic
1083673922 11:64315124-64315146 ACTTAGTCCTGGATGAAGAGGGG + Exonic
1086350151 11:85936173-85936195 ACCCTGTCCTGGGTGGAGGAAGG - Intergenic
1086429471 11:86721312-86721334 TCCTTATCATGGGTGAAGAAAGG - Intergenic
1086583914 11:88430539-88430561 TGTTTGTCATGAGTGAAGAATGG - Intergenic
1087435641 11:98113527-98113549 ACAATGGCCTGGATGAAGAATGG + Intergenic
1088816294 11:113423207-113423229 CCTGTGACCTGGGTGAAGAAAGG + Intronic
1089340786 11:117755932-117755954 CCTTTGTCCTGGGAGAAGGACGG + Intronic
1093194373 12:16112608-16112630 TCTAGGTCCTGGGTGAAGAAGGG + Intergenic
1095838119 12:46661015-46661037 CCTTTGTACAGGGTTAAGAAAGG + Intergenic
1095855797 12:46859859-46859881 AATTTGTCCTAGCTGAAGTATGG - Intergenic
1095870960 12:47027395-47027417 ATTTTATCCTGGGTAAAGGACGG + Intergenic
1096753679 12:53780949-53780971 ACTTTATCCTGAGGGCAGAAGGG + Intergenic
1099668889 12:85665097-85665119 ACTTTGTCATGGGAGGAGGATGG - Intergenic
1102124960 12:110472524-110472546 ACTCTAGCCTGGGTGAAGGAGGG + Intronic
1104536629 12:129623538-129623560 CCATTATCCTGAGTGAAGAATGG - Intronic
1105344433 13:19560397-19560419 ACTTAGTCCTGGATGAAGAGGGG - Intergenic
1107326350 13:39247185-39247207 ATTTTTTCCTGGGAGCAGAAGGG - Intergenic
1108152010 13:47546035-47546057 ACTTTGGGGTGGGGGAAGAAGGG - Intergenic
1108199463 13:48028405-48028427 ACTTTAGCCTGTGTGGAGAAAGG - Intergenic
1109190563 13:59318068-59318090 GGTTTGTCTTGGGTGAAGAGTGG + Intergenic
1111794498 13:92900609-92900631 AAGTTGTCCAGGGTGAAGGAGGG + Intergenic
1111854415 13:93619483-93619505 ACTCTATCCTGGGTGACAAAGGG - Intronic
1111950040 13:94702936-94702958 ACTTTGGGCTGGTTGGAGAAGGG - Intergenic
1113654312 13:112058403-112058425 CCATTGTCCTGGGTGGGGAACGG - Intergenic
1114055232 14:18962863-18962885 ACTTTGTCCTGGGTTGTGAGTGG + Intergenic
1114107311 14:19438913-19438935 ACTTTGTCCTGGGTTGTGAGTGG - Intergenic
1117485525 14:56193148-56193170 TCTTTGTTCTGGATTAAGAAAGG + Intronic
1119178682 14:72588821-72588843 TCGTTGGCCTGGGTGAAGAAAGG + Intergenic
1121027760 14:90628992-90629014 ACTGTGTGCTGCGTGAAGACTGG + Intronic
1122286937 14:100657927-100657949 ACTTTGTCCTGGGTGTGAAAGGG + Intergenic
1122415596 14:101548185-101548207 TCCTTGTCCTGGGTGAATAAGGG - Intergenic
1123459860 15:20459830-20459852 ACATGGTTCTGGGAGAAGAAAGG - Intergenic
1123658202 15:22540590-22540612 ACATGGTTCTGGGAGAAGAAAGG + Intergenic
1124312066 15:28635082-28635104 ACATGGTTCTGGGAGAAGAAAGG + Intergenic
1125132408 15:36299039-36299061 ACTTTGTCCAGAGTGAAGTGAGG - Intergenic
1128564888 15:68694669-68694691 ACTGTGCCCTGGGGGAAGCAGGG + Intronic
1128818585 15:70631739-70631761 ACTTTGTCCTGGGACAAGGTGGG - Intergenic
1129161475 15:73750429-73750451 TCTTTGTCCGGGGGTAAGAATGG - Intronic
1131366081 15:91842210-91842232 ACTTAATCATGGGTAAAGAAAGG + Intergenic
1132345281 15:101104490-101104512 ACTTGGTTCTGGGTGACGAGGGG - Intergenic
1132517919 16:374485-374507 GCTTGCTCCTGGGTGAGGAAGGG - Intronic
1132610859 16:815656-815678 ACTCTGGCCTGGGTGACTAAGGG - Intergenic
1132852802 16:2032540-2032562 AGTTTGTCTTTGGTGAAGGATGG + Intronic
1132927540 16:2438963-2438985 ACTTTGGCCTGGGTGACAGAGGG + Intronic
1135797931 16:25463500-25463522 ACTTTCTCATGAGTAAAGAATGG + Intergenic
1136704274 16:32173087-32173109 ACGTGGTTCTGGGAGAAGAAAGG - Intergenic
1136763636 16:32756319-32756341 ACGTGGTTCTGGGAGAAGAAAGG + Intergenic
1136804463 16:33114067-33114089 ACGTGGTTCTGGGAGAAGAAAGG - Intergenic
1137481145 16:48852858-48852880 ACTTTGTCCTTGGTGACAAATGG + Intergenic
1137902119 16:52280041-52280063 GCTTTGTCATGGGGGAAGGAGGG - Intergenic
1139371105 16:66469944-66469966 ACTCTGCCCTGGGTGGAGCAGGG + Exonic
1139804817 16:69555654-69555676 ACTTCGTGCTGGGTGAGGTAAGG - Intergenic
1140218991 16:73030061-73030083 CCTTTGCCCTGGGAGGAGAATGG - Intronic
1141826173 16:86481953-86481975 ACCTTGCCATGGGTGAAGGAAGG - Intergenic
1203065785 16_KI270728v1_random:1016640-1016662 ACGTGGTTCTGGGAGAAGAAAGG + Intergenic
1142681045 17:1548857-1548879 ACTTTGTCCTGGGAGGCAAATGG - Intronic
1147679862 17:42235298-42235320 GCTTTCTCCTGGGTCTAGAACGG + Intronic
1148000432 17:44384418-44384440 ATTTTTCCCTGGGTGCAGAACGG - Intronic
1149361039 17:55896265-55896287 ACTATGTCCTGGGTGATAGAGGG - Intergenic
1149597436 17:57872621-57872643 ACTTCTCCCTGGCTGAAGAAGGG - Intronic
1150195456 17:63293708-63293730 ACTTTGCCTTAGTTGAAGAAAGG + Intronic
1151221557 17:72616522-72616544 CCTTCTTCCAGGGTGAAGAATGG + Intergenic
1151497963 17:74470612-74470634 ACAGTGTCTTGGGTGAAGGAGGG + Intronic
1151825370 17:76521069-76521091 ACTATTTCCTGGGGGAAGAACGG - Intergenic
1152425433 17:80216012-80216034 ACATTGTGCTGAGTGAAGTAAGG + Intronic
1152868914 17:82740637-82740659 ACTTTTTACTGTTTGAAGAATGG + Intronic
1153284641 18:3446888-3446910 ACTGTGTTCTAGGTGGAGAAAGG - Intronic
1153724559 18:7941914-7941936 ACCTTGTGATGGGTGAGGAAAGG - Intronic
1157239193 18:45993499-45993521 ACTTTGCCCTTGGTGAAGTAAGG - Intronic
1157620396 18:49013950-49013972 ACTGTGAACTGGGTGAAGAAAGG - Intergenic
1158217451 18:55114775-55114797 ACTTTGTCCTTGCTGTACAAAGG - Intergenic
1159696782 18:71568116-71568138 TCTTTGTTTTTGGTGAAGAAAGG - Intergenic
1164032488 19:21419978-21420000 ACCTTGTCCTGGGAGAGGAGTGG - Intronic
1166680876 19:44765960-44765982 TCTTTGTCCTGGTAGAAAAATGG + Intergenic
1167693078 19:50999206-50999228 GCTGGGTCCTGGGAGAAGAAGGG + Intronic
1167898587 19:52601453-52601475 AATTTGCTCTGGGTGAAGACGGG - Intronic
925186227 2:1848244-1848266 CCTTTGTCCTGGGAGCAGGAGGG + Intronic
925801804 2:7609328-7609350 ACTTTGGGCTGGATGATGAACGG + Intergenic
925901286 2:8511102-8511124 ACTTCTTCCAGGGTGAAAAAGGG + Intergenic
926202809 2:10813410-10813432 ACTTTGTCCTGGGGGGCGAGGGG + Intronic
930258261 2:49116215-49116237 ACTTTGTCCTGGAGGAAAATAGG + Intronic
930575811 2:53147006-53147028 ACTTTGTCCTAGCTATAGAAAGG - Intergenic
931777526 2:65553370-65553392 TCTTTGCCCTGGTTGGAGAAGGG + Intergenic
934476525 2:94597212-94597234 ACTTTGCCCTGGATTAAGGAGGG - Intronic
935218327 2:100991613-100991635 TCTCTGTCCTGGCTGAAGGAGGG - Intronic
937218183 2:120325889-120325911 AATTTGTGCCGTGTGAAGAAGGG - Intergenic
937707706 2:124940530-124940552 ATTTTGTCCGGGATGAAGGAAGG - Intergenic
1168744653 20:227918-227940 AGTTTGTGCTTGGTGTAGAAAGG + Intronic
1170205114 20:13789823-13789845 ACTTGGGCCAGGGTGAGGAAGGG + Intronic
1171344111 20:24452705-24452727 ACTTTCTGGTGGGTGAAGGAGGG - Intergenic
1172021884 20:31920411-31920433 ACTGTGTCTTGGGACAAGAATGG - Intronic
1172387975 20:34547320-34547342 AGTCTGTGCTGGGTGAGGAAGGG + Intronic
1172441796 20:34971353-34971375 TCTTTGTCCTTTGTGAAGATGGG + Intergenic
1173969819 20:47143959-47143981 ACTTTCTCCAACGTGAAGAAGGG + Intronic
1174041240 20:47701140-47701162 ACATTGCGCTGGGTGAAAAAAGG + Intronic
1174668863 20:52286894-52286916 ACTCTGTCCTAGATGAGGAAAGG - Intergenic
1175284588 20:57829564-57829586 ACGTTGGCCTGGGTGGAGGAGGG - Intergenic
1179142856 21:38741979-38742001 TCTTTGTCCAGGGAGGAGAAGGG - Intergenic
1180473714 22:15685415-15685437 ACTTTGTCCTGGGTTGTGAGTGG + Intergenic
1183507904 22:38219712-38219734 ACTTTGGCCTGGAGGGAGAAGGG + Exonic
1183754066 22:39742640-39742662 AATTTGGCGTGGTTGAAGAATGG - Intergenic
1184848196 22:47101987-47102009 GCTTTCTGCTGGGAGAAGAAGGG + Intronic
1185338866 22:50282874-50282896 ACTTCGTCCTGGGGGAGGGAGGG + Exonic
951244731 3:20327664-20327686 ACCTTGTCCTGGGTAAACAAGGG - Intergenic
952840076 3:37638941-37638963 ACATAGTCCTGGGAGAAGACGGG + Intronic
954079992 3:48207934-48207956 TCTTTGTCCTGGCAGAGGAATGG + Intergenic
958919903 3:100092844-100092866 AGTTTGTCTTGTGAGAAGAATGG - Intronic
959720119 3:109477518-109477540 ACTTCAGCCTGGGTGAGGAAGGG - Intergenic
960656539 3:120010722-120010744 ATTTTGGCCTGGGTGACAAAGGG + Intronic
964489928 3:157225546-157225568 ACTTCGGCCTGGGTCTAGAAAGG - Intergenic
965360400 3:167732877-167732899 ACTTTGTGCTGGATTAAGAAAGG - Intronic
969629673 4:8328978-8329000 ACTCTGGCCTGGGGGAGGAAGGG + Intergenic
971021227 4:22538028-22538050 ATTTGCTGCTGGGTGAAGAATGG + Intergenic
971035444 4:22688031-22688053 ACTATGTCATTGGAGAAGAAAGG - Intergenic
971913635 4:32829401-32829423 AATTTGTCCTAGGTGAAACATGG - Intergenic
973337092 4:48967677-48967699 AACTTGTGCTGGGTGAATAAAGG - Intergenic
975102158 4:70525865-70525887 ACTCCATCCTGGGTGATGAAGGG + Intronic
977354481 4:95927494-95927516 AATTTGTCCTGGCTGAAATATGG + Intergenic
979567576 4:122172754-122172776 AATATGGCCTGGGAGAAGAAAGG - Intronic
980877274 4:138674459-138674481 ATGTTGTCCTGGGTGGGGAAGGG - Intergenic
981952770 4:150430366-150430388 ACTTTATCCTGGGTGCAGTGGGG - Intronic
982691560 4:158553316-158553338 ATTTTGTCCTGTTTTAAGAAGGG + Intronic
982734536 4:158991927-158991949 ACTTCAGCCTGGGTGAAGCAAGG - Intronic
985973398 5:3394644-3394666 ACTTTGTTTTGGTTGAAAAAGGG + Intergenic
988108585 5:26783552-26783574 CCTTTGTCCTAGTTGATGAACGG - Intergenic
989342970 5:40397187-40397209 TCTTAGTGCTGGGTGAAGAGAGG + Intergenic
990949946 5:61288788-61288810 ATATAGTCCTGGGTGAATAAGGG - Intergenic
991435075 5:66589687-66589709 ACATTTTCCTGGGTGGAGATTGG + Intergenic
993409597 5:87557132-87557154 AATTTGTCCAGGGTTAAGATGGG - Intergenic
994094935 5:95839867-95839889 CCCTTGTCCTGGGTGTGGAATGG + Intergenic
994168539 5:96633710-96633732 ACTTTGTCCTGGGTGAAGAAAGG - Intronic
999500513 5:152142403-152142425 ATTTTGTCCTGGGAGGAGAGAGG + Intergenic
1000968052 5:167682972-167682994 AGTTTTTCCTGGGGAAAGAAAGG - Intronic
1001138011 5:169118553-169118575 GCTTTCTCCTGGGTTAACAATGG - Intronic
1003134715 6:3425628-3425650 GCATTGTTCTAGGTGAAGAAAGG + Intronic
1004255995 6:14065079-14065101 ACTCTGTCGTGAGTGAAGATGGG - Intergenic
1007258786 6:40547553-40547575 ACAATGACCAGGGTGAAGAAGGG - Intronic
1007691100 6:43702113-43702135 AATTTGTCCGAGGTGACGAAAGG + Intergenic
1008838329 6:55865972-55865994 TCTTTGCTCTGGGTGAAGAAGGG - Intronic
1011967482 6:93176910-93176932 GATTTGTCCTGGGAAAAGAAGGG - Intergenic
1012051360 6:94348836-94348858 ATATTGTCCTGGGAGTAGAATGG + Intergenic
1012840423 6:104322734-104322756 GCTTTGTTCTGGGTTCAGAAAGG + Intergenic
1014503459 6:122223482-122223504 ACTTTATCCTGGTTGGTGAAAGG - Intergenic
1015107488 6:129553870-129553892 ACTTGGTCCAGGGTGAAACACGG + Intergenic
1015704718 6:136075588-136075610 ACTTAGTTCTGGGTGAAGTGTGG + Intronic
1016705603 6:147103173-147103195 AATTTGTCATGGGTCAAAAAAGG + Intergenic
1018425424 6:163675825-163675847 ACTTTGTACTCTTTGAAGAATGG + Intergenic
1020384895 7:7590211-7590233 ACTGTGTACTGGGTGAACACAGG + Intronic
1020537640 7:9421848-9421870 ACTTTGGCCTGGGTGATAAAAGG - Intergenic
1020661947 7:10993974-10993996 ACTTTGGCCTGGGTGACAGAGGG + Intronic
1021790282 7:24197693-24197715 AATTTGTCCTGGGTGAAACGTGG - Intergenic
1022095812 7:27140587-27140609 ACTGGGTCCCGGGTGAAGAGTGG + Intronic
1023864065 7:44230497-44230519 ACATTGGCCTGGGTGAGCAAGGG + Intronic
1024205736 7:47159032-47159054 AATTTTTCATGGGTAAAGAACGG + Intergenic
1024481154 7:49864750-49864772 ACTTGGTCCCGGGTTCAGAAGGG - Intronic
1025254461 7:57374132-57374154 ACTTTGTCCTGTGGGTAAAAGGG + Intergenic
1025859464 7:65312912-65312934 CGTTTGTCCTGGGAGAAGCAGGG - Intergenic
1026425747 7:70291491-70291513 ATTTTGTTTTGGGTGTAGAATGG + Intronic
1027839215 7:83286444-83286466 AATTTGTCCTGGCTAAAGACAGG + Intergenic
1030242141 7:107339575-107339597 AGTTTGTTCTGGGTGCAGATGGG - Intronic
1032812733 7:135438157-135438179 GCTTTGTCCTGCATGTAGAAAGG - Exonic
1036273548 8:7330604-7330626 AAAGTGTCCTGGGGGAAGAAAGG - Intergenic
1036274113 8:7335346-7335368 AAAGTGTCCTGGGGGAAGAAAGG - Intergenic
1036274685 8:7340066-7340088 AAAGTGTCCTGGGTGAAGAAAGG - Intergenic
1036346668 8:7970280-7970302 AAAGTGTCCTGGGTGAAGAAAGG + Intergenic
1036347236 8:7975002-7975024 AAAGTGTCCTGGGGGAAGAAAGG + Intergenic
1036347799 8:7979748-7979770 AAAGTGTCCTGGGGGAAGAAAGG + Intergenic
1036412579 8:8516314-8516336 ATTTTGCCCTGGGAGAAGCATGG - Intergenic
1036841991 8:12131034-12131056 AAAGTGTCCTGGGTGAAGAAAGG + Intergenic
1036842552 8:12135788-12135810 AAAGTGTCCTGGGGGAAGAAAGG + Intergenic
1036843119 8:12140517-12140539 AAAGTGTCCTGGGGGAAGAAAGG + Intergenic
1036863822 8:12377284-12377306 AAAGTGTCCTGGGTGAAGAAAGG + Intergenic
1036864446 8:12382328-12382350 AAAGTGTCCTGGGGGAAGAAAGG + Intergenic
1038092281 8:24267877-24267899 ACTTATTCCTGGGTCTAGAAAGG + Intergenic
1038106723 8:24443515-24443537 ACTTTGTCTTGGCTGAAGATTGG + Intronic
1038483884 8:27920076-27920098 AGTTTGTCAGGAGTGAAGAAAGG + Intronic
1039327558 8:36502002-36502024 ACTATGTCCAGGGTAAACAAAGG + Intergenic
1040486128 8:47873509-47873531 ACTCCAGCCTGGGTGAAGAAAGG + Intronic
1041229217 8:55731927-55731949 ATTTTATCCTGGGTAAAGGATGG + Intronic
1045672027 8:104565902-104565924 ACTTGGTTGTGGGGGAAGAATGG + Intronic
1046817468 8:118600162-118600184 ACTTTATCCTGAGTGCAGCAGGG + Intronic
1048490033 8:134883958-134883980 GTTTTGTCCTGGGTGGCGAAGGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1050340339 9:4631020-4631042 ACTTTGCCCAGAGTGAAGGAAGG + Intronic
1051137084 9:13934646-13934668 AGTGTGACCTGGGTGAAGTATGG + Intergenic
1051917704 9:22228078-22228100 TCTCTGGCCTGGGTGAAAAAGGG - Intergenic
1052498799 9:29261891-29261913 ACATTGTCCTGGATGCACAATGG - Intergenic
1052853511 9:33392686-33392708 ACTTTGCCCTGGATTAAGGAGGG + Intronic
1053681535 9:40488866-40488888 ACTTTGCCCTGGATTAAGGAGGG + Intergenic
1053931530 9:43117196-43117218 ACTTTGCCCTGGATTAAGGAGGG + Intergenic
1054282178 9:63136068-63136090 ACTTTGCCCTGGATTAAGGAGGG - Intergenic
1054294626 9:63324383-63324405 ACTTTGCCCTGGATTAAGGAGGG + Intergenic
1054392648 9:64628870-64628892 ACTTTGCCCTGGATTAAGGAGGG + Intergenic
1054427296 9:65134079-65134101 ACTTTGCCCTGGATTAAGGAGGG + Intergenic
1054503080 9:65887461-65887483 ACTTTGCCCTGGATTAAGGAGGG - Intronic
1054953173 9:70876788-70876810 ACTTGTTGCTGGGTAAAGAATGG - Intronic
1055887549 9:81081836-81081858 ACTTTGTAATGAGTTAAGAAAGG - Intergenic
1055906833 9:81304588-81304610 ATTTTGTCCTGGAGGCAGAAAGG + Intergenic
1055989192 9:82087134-82087156 ACTTTGTCATTGGTGAGGGAGGG + Intergenic
1057303599 9:93900121-93900143 ACTTTGTCCTGGGGGTACTAGGG - Intergenic
1058040474 9:100296402-100296424 ACTGTGTCTTTGGTGACGAAAGG - Intronic
1058180296 9:101790251-101790273 ACTTTATCCTGAGGGTAGAAGGG + Intergenic
1059057932 9:111004064-111004086 GCTGTGTACTGGGTGAAGGATGG - Intronic
1059189198 9:112307417-112307439 ACTCTGGCCTGGGTGACAAAGGG + Intronic
1060392372 9:123288763-123288785 ACATTGTTCTGAGTGAAAAAAGG - Intergenic
1061674903 9:132210124-132210146 CCTTTGTCCTGAGTAAAGAGTGG + Intronic
1061901151 9:133672723-133672745 ACCATGTTCTGGGTGAGGAAGGG + Intronic
1188268479 X:28108704-28108726 ACTTTGTACTGGATGGTGAACGG + Intergenic
1189528642 X:41855104-41855126 ACTTTTTCCTGCTTGAACAAAGG + Intronic
1189654765 X:43232750-43232772 TCTATGTCATGTGTGAAGAAAGG - Intergenic
1189752840 X:44240331-44240353 ATGTTGTCCTGGCTGGAGAATGG - Intronic
1194415585 X:93607103-93607125 TCTATGTTCTGGGTGGAGAAAGG + Intergenic
1194571808 X:95561709-95561731 AATTTTTCCTGGGTCAAGCAAGG - Intergenic
1196396140 X:115263350-115263372 ACTTTCTCCTCACTGAAGAATGG - Intergenic
1196737067 X:118989393-118989415 AGATTGTCCTGGATGAAGAAAGG - Exonic
1198024010 X:132687297-132687319 ACTTTCTCCTGGGAGAAGGCAGG + Intronic
1198434721 X:136605593-136605615 CCTTTGTCCTAGGTGAAGGAGGG + Intergenic
1199194039 X:145006080-145006102 GCTTTATCCAGGGTCAAGAAAGG + Intergenic