ID: 994169913

View in Genome Browser
Species Human (GRCh38)
Location 5:96647759-96647781
Sequence CTTTCTGAAGGAGCTCGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994169913_994169919 7 Left 994169913 5:96647759-96647781 CCTTCCCGAGCTCCTTCAGAAAG 0: 1
1: 0
2: 2
3: 17
4: 182
Right 994169919 5:96647789-96647811 CCCTGCGTGCACCTTGATTTTGG 0: 1
1: 0
2: 67
3: 505
4: 1828

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994169913 Original CRISPR CTTTCTGAAGGAGCTCGGGA AGG (reversed) Intronic
900117531 1:1034907-1034929 CTTTCTGCGGGAGCTGGGGAGGG + Intronic
902087932 1:13877490-13877512 CTGTGTGAAGGAGCTCGAGGTGG - Intergenic
903788607 1:25877204-25877226 CTTTCTAAAGGAGCCCAGCATGG - Intergenic
904466063 1:30708135-30708157 CTTTGGGAAGGAGGTTGGGAAGG + Intergenic
907394453 1:54179487-54179509 CTTTCTGGAGGAGGTAGAGAGGG - Intronic
907718041 1:56945965-56945987 CTCTCTGAAGGAACTCGTAATGG + Exonic
908508084 1:64826077-64826099 TTTGCTGAAGGAGCTGGGAATGG + Intronic
912512211 1:110197354-110197376 CTTTCTGGAGGAGATGGTGATGG + Intronic
912583852 1:110743924-110743946 CTCTTTGAAGGTGCTAGGGAAGG - Intergenic
914420276 1:147522554-147522576 ATGTCTGAAGGAACTGGGGAAGG - Intergenic
915304403 1:154969488-154969510 CTTTGTGAAGGGGCTGGGGTGGG - Intronic
915451851 1:156010871-156010893 CTTTCTGGAGGAGGTAAGGAAGG - Intronic
916143253 1:161717996-161718018 CTGTCTGAAGGAACTCTGGCAGG - Intergenic
918067851 1:181113483-181113505 CCTTCTGAAGTAGCCCGGGAGGG + Intergenic
1062780542 10:201634-201656 CTTTCAGAATGATCTCGGGGAGG + Intronic
1065106321 10:22390232-22390254 CTTTCTGAAGGGTCACGGTAAGG + Intronic
1067054996 10:43045136-43045158 CTTTCTGAGGGTCCTCAGGAGGG - Intergenic
1067809646 10:49417317-49417339 GTTTCTGAAGGAGCCGGGGTGGG - Intergenic
1070786411 10:79164892-79164914 CTTTGGGAAGGGGCTCTGGAGGG - Intronic
1070867967 10:79720176-79720198 CTTTTTGGAGGAGTTCGAGAAGG - Intergenic
1071054651 10:81495028-81495050 GTTTATGAAGGAGTTTGGGAAGG + Intergenic
1071634879 10:87242377-87242399 CTTTTTGGAGGAGTTCGAGAAGG - Intergenic
1071660357 10:87495619-87495641 CTTTTTGGAGGAGTTCGAGAAGG + Intergenic
1074760968 10:116667265-116667287 CTTTCTGAAGGCGCTAGGGAAGG - Intronic
1075219546 10:120572679-120572701 CCTCCTGAAGGAGCTCAGGATGG + Intronic
1076767834 10:132646321-132646343 CTGTCTCAAGGAGGTCGGCAGGG + Intronic
1077609045 11:3632937-3632959 CTTTCTGCTGGAGGTAGGGAAGG + Intergenic
1077725040 11:4666176-4666198 CATCCTGAAGGAGCCCAGGAAGG + Intergenic
1078314105 11:10277835-10277857 CTCTCTGAAGGATTTAGGGAAGG - Intronic
1084507942 11:69581345-69581367 CTTTCTGAAGGTTCTCAGGGAGG - Intergenic
1084793471 11:71489608-71489630 CCTGCTGAAGGAGCTTTGGACGG + Intronic
1085503950 11:77045266-77045288 CTTACTGGAGGTGCTAGGGAAGG + Intergenic
1086142048 11:83510223-83510245 CTATCTGAAGGAGGGAGGGAGGG - Intronic
1089129912 11:116203381-116203403 CTTTCTAATGGAGCCCTGGAGGG - Intergenic
1090537103 11:127655216-127655238 CTTTCTGAAAGATCTCAGCATGG + Intergenic
1098238222 12:68439366-68439388 TTTTCTGAAGCCGCTAGGGAAGG + Intergenic
1099507442 12:83497131-83497153 CTTTCTGAAGTTACTAGGGAAGG + Intergenic
1100045324 12:90372998-90373020 CTTTTTGAAGGGGGTCGGGGGGG + Intergenic
1100740244 12:97583364-97583386 CTTTCTTCAGGAGCTCTGTAAGG - Intergenic
1101671528 12:106879586-106879608 ATTTCTTAAAGAGCTAGGGATGG - Intronic
1101766984 12:107710693-107710715 CTTTCTGAATGAGTTCTGTAAGG + Intronic
1101953459 12:109194067-109194089 CTCTCTGAAGGCGCTGGGGCAGG + Intronic
1102948396 12:117010650-117010672 ATTTCTGAAGCACCACGGGAAGG + Intronic
1103230371 12:119325386-119325408 CTCTCTGAAGGCTCTAGGGAAGG + Intergenic
1103902537 12:124310820-124310842 CTTTCTGAAGGGGCTGTGGATGG + Intronic
1104400625 12:128473010-128473032 CCTTCTGGAGGATCTAGGGAAGG + Intronic
1104685679 12:130782650-130782672 GTTTCAGAGGGAGCTGGGGACGG - Intergenic
1104847789 12:131855476-131855498 GTTTCTGAAGGAGGCCAGGAGGG - Intergenic
1105068964 12:133222369-133222391 GATTCCCAAGGAGCTCGGGAGGG + Intronic
1106155075 13:27147028-27147050 CTCTCTGAAGGTGCTGGAGAAGG - Intronic
1106170293 13:27282914-27282936 CCTTCTGGAGGAGCTAGGAAAGG - Intergenic
1107892368 13:44925299-44925321 ATTTCTAAAGGACCTGGGGAAGG - Intergenic
1111927397 13:94478164-94478186 CTTTCTCGAGGAGCTGGGGGTGG - Intronic
1113765032 13:112875875-112875897 CTTTCTTGAGGACGTCGGGAAGG - Exonic
1113842860 13:113370168-113370190 CTTCCTGAGGGAGCCCGGGGTGG - Intergenic
1113933679 13:113981961-113981983 CTTTCTGGAGGAGCTTGCGTTGG - Intronic
1117089526 14:52236130-52236152 GTCTCTGAAGGAGATGGGGAAGG + Intergenic
1117156842 14:52950689-52950711 CTTTCGGCAGAAACTCGGGAGGG + Intronic
1118305168 14:64649543-64649565 CACTCGGAAGGTGCTCGGGAGGG - Intergenic
1118603768 14:67488449-67488471 GTTTGTGAAGGAGCTGGGGAGGG - Intronic
1118842556 14:69524119-69524141 CTTCCTGATGGGGCTCAGGAGGG - Intronic
1120941823 14:89956515-89956537 CTTGCTGAAGGCGTTGGGGACGG - Intronic
1121454452 14:94029400-94029422 CCCTCTGAAGGCGCTAGGGAAGG + Intronic
1121711892 14:96044640-96044662 CTCTCTGAAGGTGCTGGGGGTGG + Intronic
1121801182 14:96775394-96775416 CCCTCTGAAGGTGCTAGGGAAGG + Intergenic
1123607838 15:22053966-22053988 CTCTGTGAAGGGGCTCAGGAAGG - Intergenic
1126351640 15:47750560-47750582 CATTCTGAAGGAGCAAGGAAGGG - Intronic
1128349825 15:66881389-66881411 CTTTTTGAAGGAGTTTGTGAGGG + Intergenic
1128729910 15:70014123-70014145 CTTCCTGGAGGAGGACGGGATGG - Intergenic
1128994102 15:72284291-72284313 CTTTCTGAAGGAGATTAAGAAGG - Intronic
1129299081 15:74615392-74615414 CTGTGTGCCGGAGCTCGGGAAGG - Exonic
1131965047 15:97833386-97833408 CTTACTGAAGGAGACAGGGAAGG - Intergenic
1202980072 15_KI270727v1_random:345764-345786 CTCTGTGAAGGGGCTCAGGAAGG - Intergenic
1132557792 16:580055-580077 CTTCCTGAGGGAACTCGGGATGG - Intronic
1133675158 16:8064261-8064283 CTTTCTGATGGTTCTCAGGATGG + Intergenic
1135398706 16:22150676-22150698 CTTTCTGAAAGAACGCAGGAAGG - Exonic
1138438932 16:57022741-57022763 TTTTCTGAAGGAGCTCGGAAGGG + Intronic
1140890582 16:79281508-79281530 CTTTCTCAAGGTGCTTGAGATGG - Intergenic
1142137215 16:88456917-88456939 CTTCCGGAAGGAGCCGGGGAGGG + Intronic
1142601127 17:1053422-1053444 GTTCCGGAAGGAGCTGGGGACGG + Intronic
1144520937 17:15951834-15951856 CCCTCTGAAGGAGGCCGGGAAGG + Intronic
1145903053 17:28500273-28500295 CTTTCTGAAGGAGGGAGGGAAGG + Intronic
1148735439 17:49862459-49862481 CTTCCTGGAGGAGCCAGGGAAGG + Intergenic
1152045349 17:77931441-77931463 CTTCCTGAAGCCGCTGGGGAAGG - Intergenic
1154053274 18:10983767-10983789 CTATCTGAAGGAGCTTGTGCAGG - Intronic
1155291899 18:24350853-24350875 CTTTCTCAAGAAGCTCCTGAAGG + Intronic
1155879898 18:31132269-31132291 CCCTCTGAAGGAACTGGGGAGGG - Intronic
1161177586 19:2855735-2855757 TTTTCTGAAGATGCTAGGGAAGG + Exonic
1164449151 19:28345055-28345077 CTTTCTGAAAGAGGTGGGAATGG + Intergenic
1165477063 19:36036998-36037020 CTCACTGAAGGGGCTCAGGAAGG - Intronic
1166852625 19:45767797-45767819 ATTTGGGAAGGAGCTCGGAATGG + Intronic
1166933940 19:46319887-46319909 TTTACAGAAGGAGCTTGGGAAGG + Intronic
1167871828 19:52377043-52377065 CATTCTGAAGGACATAGGGAGGG + Intronic
1168360805 19:55738314-55738336 GTATCTGAAGGAGCTCAGAAAGG - Exonic
926942333 2:18151704-18151726 CCCTCTGAAGGTGCTGGGGAAGG - Intronic
927782553 2:25951532-25951554 CCTTGTGAGGGATCTCGGGAGGG - Intronic
928534301 2:32225273-32225295 CTTCCTGAAGAGGCTCGGGAGGG - Intronic
929564633 2:42976689-42976711 CTCTCTGAAGGAGCTGGTGAGGG + Intergenic
932191596 2:69745344-69745366 TTTTCTGATGGAGCTGGGAAGGG + Intronic
932294344 2:70611582-70611604 CTTTCTGGAGGAGTTGGGAAGGG + Intronic
932742630 2:74303642-74303664 TTTTCTGAAGGAGCAGAGGAAGG + Intronic
934047484 2:88184926-88184948 CTGTCTGAAGGAAGTAGGGAGGG + Intronic
935099336 2:99977897-99977919 CTTTCTGGAGGAGCTCCAGCAGG - Intronic
936622532 2:114115437-114115459 CTTTCAGAAGGATCTCTGAATGG + Intergenic
937090112 2:119200688-119200710 CTTTCTGAGGGAAATGGGGAAGG - Intergenic
939627104 2:144491149-144491171 GTCTCTGAAGGAGCTGGGGTGGG + Intronic
939669160 2:144988486-144988508 CTTTCTGAGTGAGCTGTGGAAGG + Intergenic
941589029 2:167395500-167395522 CTTTCTGGAGGTTCTGGGGAGGG - Intergenic
943635776 2:190305355-190305377 CCTGCTGAAGGTGCTAGGGAAGG + Intronic
944850456 2:203713992-203714014 TTTTCTCAAGGAGATAGGGAGGG + Intronic
945025914 2:205619839-205619861 CTTTCTGAAGGAGCCCAGTCAGG - Intronic
946430690 2:219625803-219625825 CTCTCTGAAGGGACTAGGGAAGG + Intergenic
948060989 2:235043226-235043248 CTTCCAGAAGGAGCTTGTGATGG + Exonic
1169970967 20:11269124-11269146 CATCCTGAAGGAGGTCTGGATGG - Intergenic
1172439696 20:34956632-34956654 CTTTCTGAAGGAATCAGGGATGG + Intergenic
1173190234 20:40870358-40870380 CCCTCTGAAGGAGCTAGGGAAGG + Intergenic
1174254413 20:49243540-49243562 CTTCATGTAGGAGCTGGGGAGGG + Intronic
1174354309 20:49988103-49988125 CTTCCTGCTGGAGCTGGGGAAGG - Exonic
1174386141 20:50189697-50189719 GTTTCTGAAGTTGCTAGGGAGGG - Intergenic
1175719582 20:61277864-61277886 CGTTCTGATGGAGCAGGGGAGGG + Intronic
1175956414 20:62611899-62611921 CTCCCTGAAGGAGCTCAGGAGGG + Intergenic
1177499071 21:21927449-21927471 CTTTTTGAAAGAGCTCTGAAAGG + Intergenic
1178374458 21:32055382-32055404 CTTTCTGAATGAGGTCCAGATGG + Intergenic
1178604720 21:34025733-34025755 CCCTCTGAAGGCTCTCGGGAGGG - Intergenic
1180963852 22:19775701-19775723 CTGTCTGAAGGAGCTAGTGGTGG + Intronic
1181670716 22:24424426-24424448 CCTGCTGGAGGAGCTCGCGAAGG - Intronic
1182454381 22:30440410-30440432 CTTTCTCTAGGAGCTAAGGATGG + Intergenic
1182761474 22:32725702-32725724 CTTTCTGGAGGATCTAGGGGAGG - Intronic
1185015700 22:48341332-48341354 GTTTCTGAAGGCGTTAGGGAGGG - Intergenic
949532700 3:4972427-4972449 TTTTCTGAAGGAGCTTGTGTAGG - Intergenic
951602108 3:24388040-24388062 CTTACTGAAGGAGATCTGGGTGG - Intronic
952130968 3:30362541-30362563 CCTTCTGAAGGAGCTCTCAATGG + Intergenic
952362724 3:32646922-32646944 CTCTCTAAAGCAGCTCAGGAGGG + Intergenic
953578910 3:44135830-44135852 CCTGTTGAAGGAGCTCTGGATGG - Intergenic
956403442 3:68904182-68904204 CTTTCTGAAGGACCTCTGTGGGG - Intronic
957618527 3:82565511-82565533 CTTCCTGAAGGGGTTAGGGATGG - Intergenic
960739085 3:120812956-120812978 GTTTCTTAAGGAGATGGGGAAGG + Intergenic
961103766 3:124223661-124223683 CTTTCTGAAGGAGGTTAGTATGG + Intronic
961997279 3:131259342-131259364 TTCTCTGAAAGAGCTGGGGATGG + Intronic
962392354 3:134983741-134983763 CTTTCTGAAGGATCTGCAGAAGG + Intronic
964675760 3:159278226-159278248 GTTTCTCAAGGAGCTCAGGGAGG - Intronic
965157110 3:165075651-165075673 CTTTGTCAAGTAGCTAGGGAAGG + Intronic
968556204 4:1247728-1247750 GTTTCTGTAGGAGCGCGGCAGGG - Intronic
968951403 4:3695709-3695731 TTTTCTGAAGGAGCTTGTGGGGG + Intergenic
969820636 4:9717543-9717565 CTCTCTGAAGATGCTAGGGAAGG - Intergenic
972365659 4:38372039-38372061 CTTGCTGTAGGAGCCCAGGAAGG - Intergenic
972680737 4:41304606-41304628 CTATCTGAAGGAGCTGAGGAAGG + Intergenic
977125299 4:93158212-93158234 CGTTATGCAGGAGCTAGGGAGGG + Intronic
978280101 4:107001254-107001276 CTCTCTGAAGGCTCTGGGGAAGG - Intronic
983225530 4:165082588-165082610 CTTTTGGAAGGATCTGGGGAGGG + Intronic
987117233 5:14735613-14735635 CCCTCTGAAGGTGCTAGGGAAGG + Intronic
992143525 5:73822301-73822323 CTTTCTAAAGGATCCCAGGAAGG + Intronic
993457548 5:88143231-88143253 CTTTCTAAAAGAGCTAGGGATGG + Intergenic
994169913 5:96647759-96647781 CTTTCTGAAGGAGCTCGGGAAGG - Intronic
995748673 5:115430823-115430845 GTTTGGGAAGGAGCTGGGGAAGG - Intergenic
996399281 5:123043671-123043693 ATTGCTGAAGGAGCTCAGGGAGG - Intergenic
996724841 5:126665336-126665358 CTTTATAAAGGAGGTCAGGAAGG + Intergenic
996817521 5:127590066-127590088 CTTTCTTAAAAAGCTGGGGAGGG + Intergenic
997396476 5:133564036-133564058 CTCTCTGAAGGTTCTAGGGATGG + Intronic
998486521 5:142507484-142507506 CTTTCTGAAGTAGCTCTGTTGGG - Intergenic
999268951 5:150285284-150285306 ATCTCTGAAGGAGCTGGGCAGGG - Intronic
999681912 5:154068483-154068505 CTCTCTGAAGGCTCTAGGGAAGG + Intronic
999879944 5:155851289-155851311 CTTTCTGGAGGAACTCAAGAGGG + Intergenic
1002019849 5:176356383-176356405 TTTTCTGAATGAACTTGGGAAGG - Intronic
1002025145 5:176391768-176391790 CCCTCTGAAGGAGCTGGGGAAGG - Intronic
1002123808 5:177026318-177026340 GTTTCTGAAGGAGTTTGTGAAGG + Intronic
1002786228 6:402515-402537 GTTTCTGAAGGGGCTCAGGAAGG - Intronic
1003034825 6:2633391-2633413 CTGTCTGCAGGAGCTGGGGGAGG - Intronic
1003214574 6:4097691-4097713 CCTACTGTAGGAGCTCTGGATGG - Intronic
1005005977 6:21288033-21288055 CTTTCTGAAGGCTCTAGGGGAGG + Intergenic
1007377302 6:41465659-41465681 AGTTCTGAAGGGGCTCAGGATGG - Intergenic
1007495855 6:42259943-42259965 ATTTCTGAAAGAGCTGGGGGTGG + Intronic
1008197056 6:48537427-48537449 CTTTCTGAAATAGCTAGGTAAGG - Intergenic
1011369270 6:86615586-86615608 CCTTCGAAAGGAGCTCAGGAAGG + Intergenic
1011947368 6:92923029-92923051 CTTTATGAAGGAGCCAGAGAAGG - Intergenic
1013041501 6:106438446-106438468 CCTTCTGAAGGCTCTAGGGAAGG + Intergenic
1014234401 6:118938505-118938527 CCTCCTGAAGGTGCTAGGGAGGG - Intergenic
1018937857 6:168285313-168285335 TTCTCTGAAGGAGCAGGGGAAGG - Intergenic
1021946053 7:25728424-25728446 CTTTCTGAAGGTTCTGGGGAGGG - Intergenic
1022682181 7:32559213-32559235 CTTTCTGAAGAATCTGGAGATGG - Exonic
1032672784 7:134100299-134100321 CCCTCTGAAGGTGCTGGGGAAGG - Intergenic
1032794760 7:135268707-135268729 TTTATTGAAGGAGCTCTGGAGGG + Intergenic
1033481016 7:141740493-141740515 CTTCCTGCAGGAGCTTGGGCAGG + Intronic
1038367621 8:26952737-26952759 CTTTCTTAGGGAGATGGGGAGGG + Intergenic
1039275175 8:35927161-35927183 CTTTCTGAAGTAGATCCTGATGG + Intergenic
1039295173 8:36143190-36143212 CTTTCTGGAGGAGAAAGGGAAGG + Intergenic
1040494947 8:47958324-47958346 CTTTCTGAAGGCTCTTGGGGAGG - Intronic
1045918900 8:107506929-107506951 CTTTTTGAAGGATGTCAGGAAGG - Intergenic
1047335975 8:123936746-123936768 CTTTCTGAAGCAGTTCTCGAGGG + Intronic
1049072228 8:140365021-140365043 CTTTCTGGGGGAGCCAGGGAGGG + Intronic
1059311757 9:113393186-113393208 CTTACTGCAAGAGCTCAGGATGG + Intronic
1060731016 9:126037119-126037141 CTTTCTCAAGGAGACTGGGAAGG - Intergenic
1062344254 9:136107510-136107532 CCATCTGAGGGAGCACGGGAAGG + Intergenic
1186676054 X:11818562-11818584 CTTTCTGGAGGCTCTAGGGAAGG - Intergenic
1188152873 X:26700763-26700785 AGTTCTGAAGCAGCTCGGAAGGG - Intergenic
1188342550 X:29022094-29022116 CTTGCTGAAGGAGCTGGTGAAGG - Intronic
1189117039 X:38353546-38353568 CTTCCTTAAGGAAGTCGGGAAGG - Intronic
1190145531 X:47888508-47888530 CTCTTTGAAGGTGCTAGGGAAGG - Intronic
1190148746 X:47922817-47922839 CCCTCTGAAGGTGCTAGGGAAGG + Intronic
1191223341 X:58014942-58014964 CTTTCTCTAGGAGCTCTGGTAGG + Intergenic
1197219041 X:123894108-123894130 CTCTGTGAAGAAGCTGGGGAAGG - Intronic
1199590406 X:149462676-149462698 TTTTCTGCTGGAGCACGGGATGG - Intergenic