ID: 994176209

View in Genome Browser
Species Human (GRCh38)
Location 5:96714086-96714108
Sequence CTATTGATGTACCATGTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994176209 Original CRISPR CTATTGATGTACCATGTGCC AGG Intronic
901366984 1:8760880-8760902 CTTCTTATGTTCCATGTGCCAGG + Intronic
902417379 1:16248611-16248633 CTATTGCTGTACCTTGTGTTAGG - Exonic
902855675 1:19202772-19202794 CAATTGATGAAACATGGGCCGGG + Intronic
903896031 1:26605493-26605515 CTATTCACCTACTATGTGCCAGG + Intergenic
906905396 1:49884861-49884883 CTATAGATGTAGCATGTACCTGG + Intronic
907353508 1:53853129-53853151 ATATTGAGGACCCATGTGCCAGG + Intronic
907796240 1:57720683-57720705 CTATTTATGTACCATGTGACAGG - Intronic
909541951 1:76801443-76801465 GTATAGATGTCCCATGTGTCAGG - Intergenic
909856695 1:80542752-80542774 CTATTTATGTTCCATCTCCCTGG + Intergenic
911346439 1:96702121-96702143 CTATTGATGTTCTATTTGTCTGG + Intergenic
912152334 1:106875658-106875680 CCATTGCTTTTCCATGTGCCTGG - Intergenic
918477785 1:184944004-184944026 CTGTTGCTGTACAATGTGTCAGG - Intronic
921411732 1:214843158-214843180 CTGTTGCTGTTCCATCTGCCTGG + Intergenic
921795466 1:219338597-219338619 TTTTTTTTGTACCATGTGCCAGG - Intergenic
923915660 1:238500945-238500967 CTAGTGAAGCACCCTGTGCCTGG + Intergenic
1064572084 10:16704259-16704281 TTATACATGTACCATGTACCAGG + Intronic
1066489012 10:35875964-35875986 TTATTGGTTTACTATGTGCCAGG + Intergenic
1070325501 10:75386084-75386106 CTCTCGTTGTTCCATGTGCCAGG - Intergenic
1071505214 10:86227878-86227900 CTATGTATCTACCATGTGTCAGG - Intronic
1071745335 10:88412263-88412285 CTATTATTTTACTATGTGCCAGG + Intronic
1074395177 10:113092024-113092046 TTAATGAGTTACCATGTGCCAGG - Intronic
1080809018 11:35683937-35683959 TTTTTTATTTACCATGTGCCAGG + Intronic
1080925118 11:36748210-36748232 ATATTTATGTGCCATGTGCTGGG - Intergenic
1081547786 11:44083869-44083891 CTGTGGATGTGCCATTTGCCAGG + Exonic
1086114807 11:83237657-83237679 GTTTTGTTGTACCATGTACCTGG + Intronic
1090185215 11:124734578-124734600 CTATAGATGTGCCAGGTGTCTGG - Intergenic
1091145487 11:133275750-133275772 CTATTGAATATCCATGTGCCAGG - Intronic
1094114315 12:26893814-26893836 CATTTAATGAACCATGTGCCAGG - Intergenic
1095158114 12:38883051-38883073 CTATTTATTTACTAAGTGCCAGG + Intronic
1097614996 12:61873050-61873072 CTCTTGATGTTCCATGATCCAGG - Intronic
1100853237 12:98735697-98735719 ATTGAGATGTACCATGTGCCTGG + Intronic
1100897605 12:99201966-99201988 TTATATATGTACCATGTACCAGG + Intronic
1102417334 12:112775362-112775384 CTGTGCATGTACCATGTGCCAGG + Intronic
1103204076 12:119114620-119114642 TTAGTCATTTACCATGTGCCAGG - Intronic
1106619123 13:31356751-31356773 CCATTGATATACCATGTCTCTGG + Intergenic
1108441534 13:50458008-50458030 CTATTAATGTGCCCTGTGACTGG + Intronic
1111509465 13:89242123-89242145 TAATTGATGTTGCATGTGCCTGG - Intergenic
1113692480 13:112321335-112321357 CTCTGGATGTACCATCAGCCTGG - Intergenic
1116225345 14:42143836-42143858 ATAATGATGTAACATTTGCCAGG - Intergenic
1119878876 14:78084243-78084265 CTCTCTATGTACCATCTGCCAGG - Intergenic
1122261102 14:100523553-100523575 CTACAGATTTACTATGTGCCTGG - Intronic
1127711789 15:61606112-61606134 CTATTTATTTACTATGAGCCAGG - Intergenic
1128560728 15:68666240-68666262 CTGTTGACTTGCCATGTGCCAGG - Intronic
1128756055 15:70184940-70184962 GTATTGACCTACCATATGCCAGG + Intergenic
1129204092 15:74025144-74025166 CTCTTGATGGGCCATGAGCCAGG + Intronic
1131175309 15:90205625-90205647 CTACGGATGCAGCATGTGCCAGG - Intronic
1131380328 15:91958340-91958362 GTATTCATCTACCATGTGTCTGG + Intronic
1133053641 16:3133902-3133924 CTAAGCATCTACCATGTGCCAGG + Intronic
1134744542 16:16577582-16577604 GTATTGAAGAACCATGTGGCTGG - Intergenic
1135853238 16:25983443-25983465 GTATTCATGTTCCCTGTGCCTGG + Intronic
1136724535 16:32347839-32347861 CTGATCATCTACCATGTGCCAGG + Intergenic
1137251100 16:46741534-46741556 CTGCTGCTGTAACATGTGCCAGG - Intronic
1137484714 16:48881628-48881650 ATATTTATCTACCTTGTGCCAGG - Intergenic
1140801992 16:78496843-78496865 CTTTTGCTGTGCCATGTGCATGG + Intronic
1203001895 16_KI270728v1_random:169916-169938 CTGATCATCTACCATGTGCCAGG - Intergenic
1203133499 16_KI270728v1_random:1706322-1706344 CTGATCATCTACCATGTGCCAGG - Intergenic
1143749653 17:9019466-9019488 ATATGCATGTACTATGTGCCTGG + Intergenic
1144046575 17:11459509-11459531 CTGTACATGTGCCATGTGCCTGG - Intronic
1144498024 17:15762454-15762476 CAACAGCTGTACCATGTGCCTGG + Intergenic
1144605142 17:16658266-16658288 CAACAGCTGTACCATGTGCCTGG - Intergenic
1145161402 17:20577507-20577529 CAACAGCTGTACCATGTGCCTGG + Intergenic
1147445097 17:40470300-40470322 CTACAGACCTACCATGTGCCAGG + Intergenic
1150541227 17:66102200-66102222 CTAAACATCTACCATGTGCCAGG + Intronic
1151017644 17:70575986-70576008 CTATTTCTCTACCATGTACCAGG + Intergenic
1151844892 17:76645817-76645839 CTGCTGCTGTAGCATGTGCCTGG + Intergenic
1153757807 18:8301574-8301596 ATATTGATCTGCCATGTGCCAGG + Intronic
1155359179 18:24983024-24983046 CTGTTGAGTCACCATGTGCCTGG + Intergenic
1155992107 18:32288850-32288872 CTATTGATGAAGGATATGCCCGG - Intronic
1156113334 18:33755112-33755134 TTATTGATGAACCCTGTTCCAGG - Intergenic
1157322769 18:46647067-46647089 CTATATATGGACCATGTTCCAGG - Intronic
1158951226 18:62497262-62497284 CTATTGATCCTCCAGGTGCCAGG - Intergenic
1159518598 18:69489370-69489392 CCAGTGATGGACCATGGGCCAGG + Intronic
1160418336 18:78727189-78727211 CCTTGGATGTACCATGGGCCCGG - Intergenic
1161261915 19:3342544-3342566 TTGTGCATGTACCATGTGCCAGG - Intergenic
1166170352 19:41024030-41024052 CTACAGAACTACCATGTGCCAGG - Intergenic
1167573868 19:50308416-50308438 CTGCTGATGTGCCAAGTGCCAGG + Intronic
931107667 2:59074333-59074355 CTATTGATGAAGCATAGGCCTGG + Intergenic
934321607 2:91975793-91975815 CTGATCATCTACCATGTGCCAGG - Intergenic
934769231 2:96897275-96897297 CTAGACATGTACCATGTGCCAGG - Intronic
936893751 2:117403503-117403525 TTTTTGATGTACTATGTGACAGG + Intergenic
937250707 2:120522122-120522144 TTACTGATCTAACATGTGCCAGG - Intergenic
937703462 2:124890926-124890948 CTGTGTATTTACCATGTGCCAGG + Intronic
940178075 2:150901339-150901361 CTATTTATTTACCATGTGTAGGG + Intergenic
942895298 2:181046088-181046110 CTGATTATCTACCATGTGCCAGG - Intronic
943966370 2:194339004-194339026 ATATGTATGTATCATGTGCCAGG - Intergenic
945932804 2:215872677-215872699 CAATTGCTGTACCTTCTGCCTGG - Intergenic
946393464 2:219430610-219430632 ATAATGATGTACCACATGCCTGG - Intergenic
1168959190 20:1857073-1857095 TTATAGACTTACCATGTGCCAGG - Intergenic
1172020481 20:31910309-31910331 CTGAGCATGTACCATGTGCCAGG + Intronic
1172151103 20:32791034-32791056 CTCCTGATGTACCAAGTCCCTGG - Intronic
1173353083 20:42262659-42262681 ACATTGATGGAGCATGTGCCAGG - Intronic
1173804437 20:45914742-45914764 CTAATGATGTGTCATGTACCAGG - Intergenic
1174000129 20:47368573-47368595 TTATTGAGGTGCCATGTGCCAGG + Intergenic
1174008422 20:47428849-47428871 CCACTGATGTACCCAGTGCCTGG + Intergenic
1174784497 20:53419849-53419871 CTATTGATGTACAGTGTCCCAGG + Intronic
1175379732 20:58554531-58554553 CTAAGCATGCACCATGTGCCTGG + Intergenic
1177036387 21:16048402-16048424 CTAATGATGTGCCTTGGGCCTGG + Intergenic
1180979672 22:19872658-19872680 CTATTGAGGCTCCAGGTGCCTGG - Intergenic
1181449315 22:23007714-23007736 CTATTCACCTACCATGAGCCAGG + Intergenic
1181726834 22:24817223-24817245 CTGGGGATGTACTATGTGCCAGG + Intronic
1181968806 22:26674836-26674858 CTAAGGATCTACTATGTGCCAGG + Intergenic
949940274 3:9149366-9149388 CTTTTGATGTCCCATGAGGCAGG + Intronic
951826150 3:26871386-26871408 TTAAATATGTACCATGTGCCAGG + Intergenic
951844614 3:27072224-27072246 ATATTTATAAACCATGTGCCTGG - Intergenic
952890584 3:38037558-38037580 CTTTTGGGGTCCCATGTGCCTGG + Intergenic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
963899585 3:150721254-150721276 ATATTTATTTATCATGTGCCAGG - Intergenic
965460449 3:168955462-168955484 CTATTGATTTAACATCTGCCAGG - Intergenic
965647348 3:170897824-170897846 AGAATGGTGTACCATGTGCCTGG + Intronic
967020873 3:185521329-185521351 CTATTAATTTGCCATGTGTCTGG - Intronic
967415765 3:189216605-189216627 CTATTGAAGGTCCATGTGCTAGG - Intronic
968850998 4:3078248-3078270 CTAAACATGTACTATGTGCCTGG + Intronic
969063092 4:4454886-4454908 CTAAGCATTTACCATGTGCCAGG - Intronic
972381765 4:38526165-38526187 CACTTGATGTACCTTCTGCCAGG - Intergenic
974226423 4:59050932-59050954 CAGTTGATGTTCCATCTGCCTGG + Intergenic
977358722 4:95978699-95978721 CCATGAATTTACCATGTGCCAGG + Intergenic
979691359 4:123562122-123562144 TTATTGAGTTACAATGTGCCAGG - Intergenic
984672464 4:182506459-182506481 CTTTTTAAGCACCATGTGCCAGG - Intronic
985089189 4:186346103-186346125 CTATCTATGTACCAGGTGCTGGG + Intergenic
985671688 5:1210073-1210095 CTTTTGATGTACCAGTAGCCTGG - Intronic
986192797 5:5512319-5512341 CTACTCATCTACCATGTGCATGG - Intergenic
987348706 5:17001883-17001905 TTATTGATTCACCATGTGTCAGG + Intergenic
987767475 5:22251640-22251662 ATATGGTTGTACCATGTGCAAGG - Intronic
990613128 5:57479262-57479284 CTATTCATGTATCATTAGCCTGG - Intergenic
994176209 5:96714086-96714108 CTATTGATGTACCATGTGCCAGG + Intronic
994976645 5:106816312-106816334 ATAATGGGGTACCATGTGCCAGG - Intergenic
999587050 5:153101239-153101261 CTATTTATGTACCCTGTACCTGG + Intergenic
1000966839 5:167667758-167667780 CTGTTGATTTCCCAGGTGCCTGG + Intronic
1001102732 5:168827617-168827639 TTAATGTTGTCCCATGTGCCAGG + Intronic
1001992649 5:176130779-176130801 TTATTTATATACCATGTACCTGG + Intronic
1002224231 5:177707370-177707392 TTATTTATATACCATGTACCTGG - Intergenic
1002959358 6:1899187-1899209 CTAATTATTTACCATGTGCCTGG - Intronic
1004389743 6:15200020-15200042 TTAATGATTTACTATGTGCCAGG - Intergenic
1008405095 6:51110117-51110139 CTGGTTATGTACCATGTGCTAGG - Intergenic
1011561569 6:88622806-88622828 ATACTGATCAACCATGTGCCCGG + Intronic
1012044292 6:94249604-94249626 GTATTGATCAACTATGTGCCTGG - Intergenic
1012167471 6:95975790-95975812 CTATTGATGGAGTATGTTCCTGG + Intergenic
1012303879 6:97625968-97625990 GTAACTATGTACCATGTGCCAGG + Intergenic
1015704887 6:136077024-136077046 CTTCTTATGTACCCTGTGCCAGG + Intronic
1017522520 6:155214301-155214323 CAAAGGATGTGCCATGTGCCTGG - Intronic
1022538469 7:31113404-31113426 CTATTTGTGAACCATGGGCCTGG + Intergenic
1023687459 7:42751234-42751256 TTAATCATGTACCATGGGCCAGG + Intergenic
1026379507 7:69784867-69784889 CTATTGTGCTACTATGTGCCAGG + Intronic
1027846914 7:83391385-83391407 CAATTACTGTACTATGTGCCAGG - Intronic
1034547360 7:151797667-151797689 CTTTTGATCTATAATGTGCCTGG - Intronic
1036062351 8:5337677-5337699 CAGATGAAGTACCATGTGCCTGG + Intergenic
1042850622 8:73212502-73212524 ATATTGATCTTCCATGTACCAGG - Intergenic
1043437061 8:80245164-80245186 CTATTGATGAACTATGTCCCAGG + Intergenic
1045095884 8:98798088-98798110 CTATTGCTGTATCATGTGGATGG - Intronic
1046100131 8:109604458-109604480 TTATTGTTGTACCCAGTGCCTGG + Intronic
1047080048 8:121449643-121449665 CTATAGGTTTACCATTTGCCAGG + Intergenic
1048797350 8:138163380-138163402 CTAAACATGTGCCATGTGCCAGG - Intronic
1048857183 8:138695239-138695261 CTGATGATCTACCATGTGCCAGG - Intronic
1048939235 8:139383816-139383838 CTATCGATATAGCATGTGCCTGG - Intergenic
1050643437 9:7693353-7693375 CTATTGCTTTTCCAGGTGCCTGG - Intergenic
1060482624 9:124026102-124026124 ATATTGACCTGCCATGTGCCGGG + Intronic
1190741762 X:53293365-53293387 CTGAGCATGTACCATGTGCCAGG - Intronic
1192285200 X:69727903-69727925 TTTTTGATGTACTATGTGCCAGG + Intronic
1197331354 X:125156940-125156962 TTATTGAAGTATTATGTGCCAGG + Intergenic
1198408614 X:136342341-136342363 CTAAACATCTACCATGTGCCAGG + Intronic