ID: 994177386

View in Genome Browser
Species Human (GRCh38)
Location 5:96725814-96725836
Sequence TTATATTTGCATAAACTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 564}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994177384_994177386 14 Left 994177384 5:96725777-96725799 CCAGCTGGCTTATTTTCCTTGTT 0: 1
1: 0
2: 2
3: 33
4: 438
Right 994177386 5:96725814-96725836 TTATATTTGCATAAACTGAAAGG 0: 1
1: 0
2: 1
3: 50
4: 564
994177385_994177386 -2 Left 994177385 5:96725793-96725815 CCTTGTTAATCATTTAATAAATT 0: 1
1: 0
2: 5
3: 73
4: 849
Right 994177386 5:96725814-96725836 TTATATTTGCATAAACTGAAAGG 0: 1
1: 0
2: 1
3: 50
4: 564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994177386 Original CRISPR TTATATTTGCATAAACTGAA AGG Intronic
901981596 1:13039277-13039299 TAATTTTTGCATAAGGTGAAAGG + Intronic
902000486 1:13189636-13189658 TAATTTTTGCATAAGGTGAAAGG - Intergenic
902019730 1:13335403-13335425 TAATTTTTGCATAAGGTGAAAGG - Intergenic
904626446 1:31807647-31807669 AAATAGTAGCATAAACTGAACGG + Intronic
905077057 1:35281612-35281634 TTATAATTGCACAAAATTAAGGG - Intronic
906360426 1:45152577-45152599 TTATTTTTGCATATGGTGAAAGG - Intronic
906902347 1:49848793-49848815 TTTTATTTGAATAAATTTAAGGG - Intronic
907359612 1:53903864-53903886 TTATATTTTAATAAATTTAATGG + Intronic
908835166 1:68222634-68222656 CTCTAATTGCATGAACTGAATGG + Intronic
908840504 1:68275572-68275594 ATATATTTCCATAACATGAAGGG + Intergenic
908950363 1:69553939-69553961 ATATATTTGCATCAACTATATGG + Intergenic
909271953 1:73633961-73633983 TTATATTTGGAAAAACCTAAAGG + Intergenic
909363733 1:74795937-74795959 TTACTTTTGCATAAAATGTAGGG + Intergenic
909512283 1:76467767-76467789 TTATTTTTTCTTAAACTGTATGG + Intronic
909516259 1:76510646-76510668 TTATATTTGGATAAACCCATTGG + Intronic
909872186 1:80755583-80755605 TTTTATTTGCATAAATGTAATGG + Intergenic
910327109 1:86022503-86022525 TCATATTTACATAAAATTAATGG + Intronic
910574211 1:88740378-88740400 TTTTATTTGTATAAATTTAAGGG + Intronic
910834538 1:91495093-91495115 TTATATTTGTATAAATTTAAGGG + Intergenic
911212521 1:95157553-95157575 TTATATTTTTAAAAAATGAAAGG + Intronic
911366114 1:96939545-96939567 TTTTATCTGCACAAAATGAATGG + Intergenic
911547619 1:99238445-99238467 TTATATTTGTATAGTCTGACTGG - Intergenic
911860683 1:102944131-102944153 TTACATTTGCATTAAAAGAAAGG - Intronic
912525030 1:110276285-110276307 TTTTTTTTGTATAAATTGAAAGG - Intronic
914202981 1:145502917-145502939 TGATATATGTATACACTGAATGG - Intergenic
914236911 1:145820851-145820873 TGATATATGTATACACTGAATGG - Intronic
914482103 1:148076068-148076090 TGATATATGTATACACTGAATGG - Intergenic
915580564 1:156810499-156810521 TTATATTTCCATAAAGTAACCGG - Intronic
916200678 1:162268349-162268371 TTTTCTCTGGATAAACTGAATGG + Intronic
916477557 1:165184474-165184496 TTCCATTTGCATACACTTAAGGG + Intergenic
916672817 1:167039165-167039187 TTAAGTTTGCAGAAAATGAAGGG - Intergenic
916783431 1:168061316-168061338 TTACTTTTTCATAAACTAAATGG - Intronic
916792824 1:168138300-168138322 TTATATATGAATAAGCTGAGAGG - Intergenic
917388614 1:174506667-174506689 TGATATATGCATACACTGTAAGG - Intronic
918263701 1:182820293-182820315 AAATTTTTGCATTAACTGAAAGG + Intronic
918516015 1:185364232-185364254 TGATTTTTGCATATAGTGAAAGG - Intergenic
918584278 1:186167899-186167921 TTATATTTGCCTAAACTTGGAGG - Intronic
918947091 1:191080784-191080806 TTATTTTTACATAAAATGAAAGG - Intergenic
918971776 1:191429027-191429049 TTATACATGGATAAACTGGAGGG - Intergenic
919309044 1:195883026-195883048 GAATGTTTGCAAAAACTGAAAGG + Intergenic
919310801 1:195905020-195905042 TTATATTTCCATTAAATAAATGG + Intergenic
919316818 1:195981250-195981272 ATATATTTCCAGATACTGAATGG + Intergenic
919360627 1:196590085-196590107 TTTTATTTGTATAAATTTAAGGG - Intronic
919490657 1:198201270-198201292 TTATTTTAGGATACACTGAATGG + Intronic
920205744 1:204289946-204289968 TTATAATAGCATAAAATTAAGGG + Intronic
921486811 1:215724601-215724623 TTATTTTTGTATAAACTTAATGG - Intronic
921766671 1:218980666-218980688 ATATATTTACATACATTGAAAGG + Intergenic
922135686 1:222823652-222823674 ATTTATTTGCATAAATTTAAGGG - Intergenic
922152804 1:223019873-223019895 GTATACTTACATAAACTAAATGG + Intergenic
923191440 1:231624417-231624439 TTAACTTTGTATAAACTGTAAGG - Intronic
923388622 1:233491100-233491122 TTATATTTGAAAAGGCTGAAGGG - Intergenic
924836648 1:247654957-247654979 TTATATTTTCATCTACTAAAGGG - Intergenic
924950602 1:248879108-248879130 TTATAATTACATAAGCAGAAAGG - Intergenic
1062926180 10:1317205-1317227 TTATATTAGAAAAAAATGAATGG + Intronic
1063273676 10:4540047-4540069 TTATATTATCAGAAACTGATAGG + Intergenic
1064258078 10:13762220-13762242 TTATTTTTGCATAACCTAAAGGG + Intronic
1064528077 10:16278902-16278924 CTATATTTTCATGAACTGAGAGG + Intergenic
1064906670 10:20354404-20354426 TTATATTTGAATAACTTGAAAGG - Intergenic
1065110041 10:22431552-22431574 TAATATTGGCAAGAACTGAAAGG - Intronic
1065157379 10:22884422-22884444 TGATTTTTGTATAAAGTGAAAGG - Intergenic
1065469554 10:26063465-26063487 TAATATTTGTAAAAGCTGAAAGG + Intronic
1065650768 10:27888737-27888759 TTTTATTTGTATAAATTTAAGGG - Intronic
1066096376 10:32076410-32076432 TCATATTTGGATAAAATGACTGG + Intergenic
1066167654 10:32805422-32805444 TTAAATTTGCAAAAGCGGAAAGG + Intronic
1067768004 10:49103375-49103397 TTTAATTTGCATAAAATGACAGG + Intronic
1068433816 10:56965722-56965744 TAATTTTTGCATATAGTGAAAGG - Intergenic
1068466698 10:57402553-57402575 TAATATTTTCATGAGCTGAATGG + Intergenic
1068949798 10:62765564-62765586 TTTTATTTGTATAAATTTAAGGG - Intergenic
1069409690 10:68140614-68140636 TTATATTTGTAGTAGCTGAAAGG + Intronic
1070423939 10:76266786-76266808 GTATATTTACATACATTGAATGG + Intronic
1071453369 10:85821176-85821198 TTATATTTACATAAAATTATAGG + Intronic
1071892971 10:90032246-90032268 TTAACTTTGTATAAAGTGAAAGG - Intergenic
1072093466 10:92152723-92152745 TGATATTTAAACAAACTGAAAGG - Intronic
1072411685 10:95208462-95208484 TTACTTTTGTATAAACTTAAGGG - Intronic
1073528519 10:104209455-104209477 TTTTATTTGTATAAATTTAAGGG - Intronic
1073938511 10:108664600-108664622 TGATATTTGCAGAAAATGGAAGG - Intergenic
1075171222 10:120116924-120116946 TTATGTGTCCATAAACTAAAAGG - Intergenic
1075583301 10:123638664-123638686 TAAATTTTTCATAAACTGAAAGG - Intergenic
1075818345 10:125283891-125283913 TAATATTTGCCTAAATTAAATGG - Intergenic
1076489714 10:130850093-130850115 TTTTATTTGTATAAATTTAATGG + Intergenic
1077735416 11:4785674-4785696 TTCTATTTGCAGAATTTGAAAGG - Intronic
1077803758 11:5569260-5569282 TAAAATTTGGAAAAACTGAAGGG + Intronic
1078285123 11:9945421-9945443 TTATTTTTGTATATAGTGAAAGG - Intronic
1078286799 11:9964874-9964896 TTTTTTTTGCATAAATTTAAGGG + Intronic
1079107203 11:17579202-17579224 TAATCTCTGCATAAGCTGAAGGG - Intronic
1079288136 11:19159144-19159166 TTATATTTGCATTCATTTAATGG + Intronic
1079473391 11:20802472-20802494 TTATATTTGGAAAAACCTAAAGG - Intronic
1079747011 11:24146163-24146185 TGATTTTTGCATATAGTGAAGGG + Intergenic
1080065835 11:28012050-28012072 TTTTATTTGTATAAATTTAAGGG - Intergenic
1080194508 11:29593145-29593167 TTTTATTTGTATAAACTTAAGGG - Intergenic
1081059374 11:38454145-38454167 TCATATTTGCTCAAATTGAATGG - Intergenic
1081393227 11:42554577-42554599 TTATCTTTTAATAAACTGTATGG - Intergenic
1082621289 11:55425459-55425481 TTATATTGACATAAAATTAAAGG + Intergenic
1083129165 11:60607423-60607445 TTATATTTGTATAACAAGAATGG + Intergenic
1085378067 11:76085606-76085628 TTATATTTGCCTAAACTCCAAGG - Intronic
1085953522 11:81362894-81362916 TACTATTTGTATAAACTTAAGGG + Intergenic
1086254453 11:84858215-84858237 TTTTATTTGCATATCCTTAAGGG + Intronic
1086349345 11:85929743-85929765 TAATATTTGTATAAGCTGTAAGG - Intergenic
1086599060 11:88609899-88609921 TAATTTTTGCATATAGTGAATGG + Intronic
1086789233 11:91014949-91014971 TTATAGTTGTATAGAATGAAAGG - Intergenic
1086944680 11:92833160-92833182 TTGTATTTTCATAGACTGTATGG + Intronic
1087090721 11:94269625-94269647 TAATTTTTGCATAAAGTGTAAGG - Intergenic
1087093874 11:94302147-94302169 TTAAATTTGTATAAATTTAAGGG - Intergenic
1087230749 11:95659566-95659588 CTATATTTGTGCAAACTGAAAGG + Intergenic
1089540308 11:119185841-119185863 TTCCATTGGCATAAACTAAAAGG - Intronic
1090472579 11:126993381-126993403 TTGTATTTGCATACACTGTAAGG + Intronic
1091733620 12:2900426-2900448 TTAAATGTCCAAAAACTGAAAGG + Intronic
1092128850 12:6094323-6094345 TTATAGTTGCAGACACTGAAGGG - Intronic
1092609995 12:10162507-10162529 TTATATTTACATAATATGATGGG - Intronic
1093416252 12:18924289-18924311 TTTTATTTGTATAAATTTAAGGG + Intergenic
1093487666 12:19669241-19669263 TAATATTTGCATTAACTTTATGG - Intronic
1095153276 12:38820713-38820735 TTATATTTGCCTAACCTCATTGG - Intronic
1097623298 12:61967784-61967806 CTGTTTTTGCATAAAATGAATGG + Intronic
1097843986 12:64347764-64347786 TTAAAGTTACATAAACTAAAAGG - Intronic
1097870885 12:64601514-64601536 TTATAGTAAAATAAACTGAAAGG - Intergenic
1098436144 12:70469488-70469510 TTAAAGTTACATGAACTGAAAGG - Intergenic
1098583664 12:72131574-72131596 ATATATTTGCATGAAATGATTGG + Intronic
1098665428 12:73155866-73155888 TTAGATTTGCATAAATTAAAAGG + Intergenic
1099541015 12:83907771-83907793 TTTTATGTGTATAAACTTAAGGG - Intergenic
1099613548 12:84907476-84907498 TTATATTTGCATTTACCTAATGG - Intronic
1099897979 12:88672426-88672448 TAATTTTTGTATAAACTGTAAGG - Intergenic
1100077818 12:90808424-90808446 TTATATTTATATAAACTATATGG - Intergenic
1100182859 12:92104406-92104428 TTATTTGTGTATAAACTGTAAGG - Intronic
1100289979 12:93204508-93204530 TCTTATTTGGAGAAACTGAATGG + Intergenic
1101341320 12:103844012-103844034 TTATCTTTGGGTAAAATGAATGG - Intronic
1101782887 12:107851179-107851201 TTAAAGTCACATAAACTGAAAGG - Intergenic
1104249111 12:127073091-127073113 TTATATTTCTATAAACTTATTGG + Intergenic
1104659832 12:130603153-130603175 TTACATTTGCATATCCTGGATGG - Intronic
1105660124 13:22484904-22484926 TTAGTTTTGAATAAACTCAATGG + Intergenic
1105867724 13:24475385-24475407 TTGCAGTTGCATGAACTGAAGGG - Intronic
1106789395 13:33139334-33139356 TCACAGTTGCATAAATTGAAGGG - Intronic
1107314345 13:39115161-39115183 TAATTTTTGCATAAAGTGTAAGG + Intergenic
1108690635 13:52856328-52856350 GTATAGTTACATAAACTGGATGG + Intergenic
1109088423 13:58007044-58007066 TTATTTTTGAATAAATTAAAAGG + Intergenic
1109500121 13:63224668-63224690 TAATTTTTGCATACAGTGAAAGG + Intergenic
1109742070 13:66567136-66567158 TGATATTGACTTAAACTGAATGG - Intronic
1109830353 13:67778477-67778499 GTATATTTTCATAAACTGCAGGG - Intergenic
1110162944 13:72401185-72401207 TTTTATTTGCATAAATTTATGGG - Intergenic
1110256163 13:73436172-73436194 TTTTATTTGCATAAATTTAGGGG + Intergenic
1110302026 13:73939873-73939895 TCATAAATGCATAAACAGAAAGG + Intronic
1110338162 13:74357002-74357024 TAATTTTTGTATATACTGAAAGG + Intergenic
1110795405 13:79631363-79631385 TTATACTAGCTTGAACTGAAGGG + Intergenic
1110908379 13:80921897-80921919 TTATAGCTGCTTTAACTGAAGGG - Intergenic
1111040013 13:82735703-82735725 TTATTTTTGCATATGATGAAAGG + Intergenic
1111146583 13:84189861-84189883 TTCTATTTCCATAAAATGTAAGG - Intergenic
1111379939 13:87436204-87436226 TTTTATTTGTATATACTTAAGGG - Intergenic
1111421964 13:88023071-88023093 ATGTATTTGCATGAACTGTAAGG - Intergenic
1111627654 13:90810158-90810180 TTATAATTGCATATACTTACGGG + Intergenic
1111885855 13:94019347-94019369 TTATATTACCACAAACTGAGTGG + Intronic
1111936306 13:94561046-94561068 TTTTAATTGAATAAACTTAAGGG - Intergenic
1112126115 13:96470383-96470405 TTAAATTTGCATATTCTGAATGG + Intronic
1113684043 13:112267240-112267262 TAATATTTGTATAAAGTGTAAGG - Intergenic
1113977948 13:114245417-114245439 TTAAATTTTTCTAAACTGAATGG + Intronic
1114158309 14:20132822-20132844 TAATTTTTGTATATACTGAAAGG + Intergenic
1114992615 14:28306361-28306383 TTATTTTTGTATAAATTTAAGGG + Intergenic
1115083228 14:29482980-29483002 TAGTATTTGCTTAAATTGAAAGG - Intergenic
1116498326 14:45589778-45589800 TTATATTTTAATAAACTTCAGGG + Intergenic
1117198103 14:53361550-53361572 TTTTATTTGCATAAATTTATGGG + Intergenic
1117526825 14:56615992-56616014 ATATATTTGCACAAACTGCAAGG - Exonic
1117629703 14:57677711-57677733 ACATATATGCATAAAATGAAAGG + Intronic
1117933513 14:60873935-60873957 TTATATTGTCAAAAACTAAAAGG - Intronic
1118109665 14:62702948-62702970 TTTTATTTGTATAAATTTAAGGG + Exonic
1118303941 14:64638970-64638992 TTTTATTTGCATAAATTTAAGGG - Intergenic
1118575478 14:67238153-67238175 GTATATATGCAAAAACTGAAGGG - Intergenic
1118918120 14:70125178-70125200 TTTTATTTGTATAAATTTAAGGG + Intronic
1119165944 14:72492802-72492824 CTTTATTTGCAAAAACAGAATGG - Intronic
1120055747 14:79922036-79922058 TTTTATTTGTATAAATTTAAGGG + Intergenic
1120110602 14:80550578-80550600 TTATATTAGGATAAACTAAAGGG - Intronic
1120571154 14:86117931-86117953 TGATTTTTGCATACAGTGAAAGG + Intergenic
1120573132 14:86146519-86146541 ATATATTTGAATAGATTGAAGGG - Intergenic
1120599941 14:86490917-86490939 TCATTTTTTCATAAATTGAAAGG + Intergenic
1120742479 14:88123373-88123395 TAATTTTTGCATAAAGTGTAAGG + Intergenic
1122173351 14:99896134-99896156 TAAAATCTGCATAGACTGAAAGG - Intronic
1122289183 14:100670616-100670638 TTTTGTTTGCAGAAAGTGAAAGG - Intergenic
1124210611 15:27762049-27762071 TTATATTTGTATAAATGTAAGGG + Intronic
1124329528 15:28797751-28797773 TTATATTTTCATAAGCAGAGTGG + Intergenic
1125418889 15:39483037-39483059 TTATAGTTTCATAAATTGAAAGG - Intergenic
1126311466 15:47321657-47321679 TTATATCTCCTTATACTGAAAGG - Intronic
1126630768 15:50732306-50732328 TTTTATTTGTATAAATTTAAGGG - Intronic
1126645194 15:50868699-50868721 TTCTCTTTTCATAATCTGAAAGG + Intergenic
1126742512 15:51791830-51791852 TTATTTTTGTATAAGCTGTAAGG - Intronic
1127022653 15:54766607-54766629 TTACATTTGCAAAAACTTAAAGG + Intergenic
1128817767 15:70626676-70626698 ATAAATTTGCATAAATTTAAGGG - Intergenic
1129196254 15:73968793-73968815 TTAGATCTGAATAAACTCAATGG + Intergenic
1131533028 15:93210788-93210810 ATATATATACATAAACTGAGAGG + Intergenic
1137348688 16:47690586-47690608 TTATATTAGCATAGACTCATGGG - Intronic
1138271190 16:55697045-55697067 TTACATTTGGATAAAATAAAAGG - Intronic
1138904149 16:61310123-61310145 CCATGTTTGCATAAACTGAGAGG - Intergenic
1138960179 16:62019789-62019811 ATATATATGCATATACTGAAGGG + Intronic
1139058122 16:63212598-63212620 TTATATTTTCATATACTTATTGG - Intergenic
1139301962 16:65952954-65952976 ATATATTTGCTTCAACTAAAAGG - Intergenic
1140780063 16:78287388-78287410 TTCTATTTGCCAAAACTCAAAGG - Intronic
1142778341 17:2160153-2160175 ATATATTTACATACAATGAAAGG - Intronic
1144315305 17:14055125-14055147 AAATATTTGAATAAAATGAAAGG - Intergenic
1144375685 17:14638252-14638274 TAACAGTTGCATAAACTTAAAGG + Intergenic
1148400077 17:47350919-47350941 TTTTATTTGTATAAATTTAAGGG + Intronic
1149543537 17:57486525-57486547 TATTATTTGCATAAAACGAAAGG - Intronic
1149941923 17:60879325-60879347 TTATATGTGAATACAATGAAGGG + Intronic
1151148300 17:72062190-72062212 TTTTATTTGTATAAATTTAAGGG - Intergenic
1151753520 17:76056447-76056469 TAATTTTTGCTTAAACTGAAAGG - Intronic
1152004427 17:77670527-77670549 TTATATATATATAAACTGAATGG - Intergenic
1152527484 17:80896904-80896926 TTAAAATTACAAAAACTGAAAGG - Intronic
1153499604 18:5734788-5734810 TTTTATTTGCATAAATTTAAAGG - Intergenic
1153664468 18:7356479-7356501 TTATATTTGCCAAAAGTGAGAGG + Intergenic
1155595173 18:27477566-27477588 TTATATATGCATACAATTAATGG + Intergenic
1155648066 18:28105302-28105324 TAAAATTTGCATTAATTGAAAGG - Intronic
1156354063 18:36326197-36326219 TTCTATTCCCATAAACTCAATGG - Intronic
1156625785 18:38906596-38906618 TTACATTTGCACAAATTAAAAGG + Intergenic
1156630238 18:38958948-38958970 TTATAGATACATAAAATGAATGG - Intergenic
1157961574 18:52159638-52159660 TAATTTTTGCATAAAGTGTAAGG + Intergenic
1158024710 18:52882196-52882218 TTATATTTGTAAAAACCTAAAGG - Intronic
1158024718 18:52882285-52882307 TTATATTTGTAAAAACCTAAAGG - Intronic
1158052417 18:53239270-53239292 TTATAGTTACAGAAACTGGAGGG + Intronic
1158781806 18:60661766-60661788 TTTTATTTGTATAATCTTAAGGG - Intergenic
1159018317 18:63121137-63121159 TTATATTAGGATAAAATGAGAGG - Intergenic
1159556610 18:69952413-69952435 TTTTATTTGTATAAATTCAAGGG - Intronic
1159761989 18:72438496-72438518 TTTTATTTGCATAAATTTATGGG + Intergenic
1160076853 18:75685603-75685625 TCTTATTTGTATAAACTTAAGGG + Intergenic
1160549331 18:79683343-79683365 TGTTATTTGCATAATCTGAAAGG - Intronic
1164221953 19:23202863-23202885 TTAAAATTGCATAAAGTAAATGG + Intergenic
1166262681 19:41652233-41652255 TTATATCTTCATACCCTGAATGG - Intronic
1168376196 19:55881872-55881894 TTTTATTTGTATAAATTTAAGGG + Intergenic
926484778 2:13440902-13440924 TAATTTTTGTATAAAGTGAAAGG + Intergenic
926557994 2:14382013-14382035 TTTTATTTGTATAAATTTAAGGG - Intergenic
927766626 2:25815508-25815530 TTATAACTACATATACTGAAAGG + Intronic
928024693 2:27730036-27730058 GTATATTTGCATACACTTGAGGG + Intergenic
928319892 2:30274618-30274640 TGATCTCTGAATAAACTGAAAGG - Intronic
928605023 2:32937489-32937511 TTTTATTTGTATAAATTTAAGGG + Intergenic
929399244 2:41560850-41560872 TAATAGTTGCATAAAATGATTGG - Intergenic
929478550 2:42279019-42279041 TTATATTTACATAAACCAATAGG - Intronic
929537974 2:42796220-42796242 TTATCTTAGAAAAAACTGAATGG - Intergenic
929681456 2:43996691-43996713 GTATATGTGCATTTACTGAAGGG - Intergenic
930147670 2:48023875-48023897 TTATATTTGCATAAACCTTAAGG + Intergenic
930447418 2:51491461-51491483 ATACATTTCCATAAAATGAATGG - Intergenic
931011767 2:57924609-57924631 TTATATTTGAAAAAACCTAAAGG - Intronic
931061917 2:58539462-58539484 ATATATTTCTATAAATTGAATGG + Intergenic
931547488 2:63405755-63405777 TTACATATGAATAAAGTGAATGG - Intronic
931555644 2:63500860-63500882 TGCTATTTGCCTAAACTTAAAGG - Intronic
931580069 2:63762413-63762435 GTTTATTGGCATAATCTGAAAGG - Intronic
931655096 2:64503619-64503641 TTACATCTGCATGAATTGAAAGG - Intergenic
931663550 2:64592967-64592989 TTATTTTTGTATAAGCTAAAAGG - Exonic
931761625 2:65422492-65422514 CTATATTTGCAGTAAGTGAATGG + Intronic
931833743 2:66077883-66077905 TTTAATTTGCATAATCTGTATGG + Intergenic
931835597 2:66095693-66095715 TAATTTTTGTATAAAGTGAAAGG + Intergenic
931845784 2:66202592-66202614 TTATCTTTAAAAAAACTGAATGG - Intergenic
933044866 2:77522536-77522558 TAATATTTGCTATAACTGAAAGG - Intronic
933155719 2:78971032-78971054 TTACATTTGCATATCCAGAATGG - Intergenic
933205142 2:79498653-79498675 TTCTATCTGCATATTCTGAATGG + Intronic
934549493 2:95247332-95247354 TAATATTTGTATATAGTGAAAGG - Intronic
935556765 2:104518872-104518894 TTTTTTTTGCATAAATTTAAGGG - Intergenic
935557807 2:104529448-104529470 TTATTTTTGTATAAAGTGCAAGG - Intergenic
935624580 2:105161121-105161143 TAACATTTGTATAAAGTGAAAGG - Intergenic
935964256 2:108457148-108457170 TGATATTTGTATCAACTAAATGG + Intronic
936487147 2:112935789-112935811 TTATAGTGGCTTAGACTGAAAGG + Intergenic
937719158 2:125072053-125072075 TTATATTTAGAAAAACTTAAAGG - Intergenic
938582403 2:132658679-132658701 TTTAATTTGCCCAAACTGAATGG + Intronic
938745895 2:134277975-134277997 TTATATTAACTTAAACTAAAAGG + Intronic
938982297 2:136538237-136538259 CTATTTTTGTATAAACTTAAAGG + Intergenic
939298555 2:140303103-140303125 ATATATATGCATAAAATAAATGG + Intronic
939536479 2:143437377-143437399 TTTTATTTGCATACATTAAAGGG + Intronic
939579324 2:143929803-143929825 TCATATATGCATAAACTGCAGGG - Intergenic
939639298 2:144619669-144619691 TTATTTTTGAATAAATAGAAGGG + Intergenic
939911923 2:147993497-147993519 TGCTTTTTGCATAAGCTGAAGGG - Intronic
940169635 2:150814172-150814194 TTTTTTTTTTATAAACTGAATGG - Intergenic
940325307 2:152419182-152419204 TTATAGTTGCAAATACTTAAGGG + Intronic
940571274 2:155437895-155437917 TAATTTTTGCATACAGTGAAAGG + Intergenic
940776182 2:157886246-157886268 TTTTATTTGTATAAATTTAATGG + Intronic
940785585 2:157977821-157977843 TTATATTTGGAAAAACCTAAAGG - Intronic
941131765 2:161659616-161659638 TTATTTTTGTATAAATTTAAGGG - Intronic
941355545 2:164486831-164486853 TTCTATTTGGGGAAACTGAATGG + Intergenic
942001146 2:171648122-171648144 TTATATTTGGAAAAACCTAAAGG - Intergenic
942874910 2:180783576-180783598 TAATTTTTGTATAAAGTGAAAGG + Intergenic
943214576 2:185013723-185013745 TTAAATTCACATGAACTGAAAGG - Intergenic
943355099 2:186845293-186845315 TTATATTTCCATTTACTTAATGG + Intronic
943369443 2:187000049-187000071 ATATATTTTTATAAACTGAGAGG + Intergenic
943400060 2:187397546-187397568 TTTTATTTGTATAAATTTAAGGG + Intronic
943499074 2:188664367-188664389 TTATATTGGCATAAACGAAGAGG - Intergenic
945534306 2:210993651-210993673 ATATATTTTCATAAACTTAAAGG - Intergenic
945731538 2:213542673-213542695 TTCTATTTGCATAATCTCAGTGG - Intronic
946581414 2:221132031-221132053 TTAAATTTGCATTTTCTGAAAGG - Intergenic
946686360 2:222275491-222275513 TTTTAATTGCAAAGACTGAATGG - Intronic
947048136 2:226011730-226011752 TTTTTTTTGAAAAAACTGAAGGG + Intergenic
948669206 2:239556137-239556159 TTATTTTTGCAGAAATTGACAGG - Intergenic
948719569 2:239890233-239890255 TTACATTTGCATAAGAAGAATGG + Intergenic
1170188302 20:13617593-13617615 TTATATTTTCATAAGCAGAGTGG - Intronic
1170333227 20:15238520-15238542 TTATATTAGAATAAAATCAAAGG - Intronic
1170466674 20:16628549-16628571 TTATATTAGCAGAAGCTTAAAGG - Intergenic
1170948139 20:20910180-20910202 TTGTATTTGCAGATACTCAAAGG - Intergenic
1173053758 20:39591076-39591098 TTTAGTTTGAATAAACTGAATGG + Intergenic
1173431719 20:42993611-42993633 TCATATGTAAATAAACTGAAAGG - Intronic
1174952898 20:55062682-55062704 TAATTTTTGTATAAACTGTAAGG + Intergenic
1175580898 20:60098493-60098515 TTGTATTTGCATAAACTCTTTGG - Intergenic
1177365600 21:20131735-20131757 TTATATTTACAATAAATGAATGG + Intergenic
1177642617 21:23863195-23863217 ACACATTTGCATAAACTGACAGG + Intergenic
1178459282 21:32787377-32787399 TTTTATTTGTATAAACTTATGGG + Intergenic
1178960747 21:37062417-37062439 TTAAATTTGCATGAACTGTTTGG + Intronic
1179915238 21:44473196-44473218 TTATAATTGCATGAACAGCAGGG + Intergenic
1181663631 22:24373599-24373621 TAATTTTTGCATAAAGTGTAAGG - Intronic
1182140190 22:27948164-27948186 TTGTATTTGTAAACACTGAAGGG - Intergenic
1183795025 22:40110184-40110206 TTATAATTGCATATACTTATGGG + Intronic
949233658 3:1782233-1782255 TTATATTTGTATAAATCCAAAGG - Intergenic
949532555 3:4970728-4970750 TAATTTTTGTATAAAGTGAAAGG - Intergenic
949973410 3:9431386-9431408 TTACATTTGCATAAAGTGGTTGG + Intronic
951091199 3:18575900-18575922 TTCTATATGCAAAAACTGCATGG + Intergenic
951163318 3:19453337-19453359 TAAAATTTGCATAAATTTAAAGG - Intronic
951434633 3:22647680-22647702 TTGTATTTAAAAAAACTGAAAGG - Intergenic
952124356 3:30281790-30281812 TGATATTTGACTAAACTGAATGG + Intergenic
952183987 3:30948482-30948504 TTTTATTTGTATAAATTTAAGGG - Intergenic
952829031 3:37547972-37547994 TACTATTTGCATAAAATAAAAGG - Intronic
953917325 3:46928435-46928457 TTATTTTTGCATCAACCTAATGG - Intronic
955538072 3:59945702-59945724 TTATTTTTGCATACATTAAAAGG + Intronic
955834306 3:63037723-63037745 TTTTATTTGTATAAATTTAAGGG + Intergenic
956387859 3:68739964-68739986 TTATATTTGTATAAATTTAAGGG - Intronic
956688088 3:71850693-71850715 TTATATTTCTATAAATGGAATGG - Intergenic
956779758 3:72594624-72594646 TTATATTGGCTTAAACTAAGAGG - Intergenic
957112021 3:75974095-75974117 TTACAGTTGCTGAAACTGAAGGG + Intronic
957142091 3:76373427-76373449 TTATATGTGCATAATTTGGATGG + Intronic
957531578 3:81446722-81446744 TTATATTTTCATAAAAACAAAGG - Intergenic
957755011 3:84473580-84473602 TTGTATTTGGAAAAACTCAAAGG + Intergenic
957773464 3:84724239-84724261 TTTTATTTGTATAAATTTAAGGG - Intergenic
958872257 3:99574276-99574298 TTATTTTTGTATATGCTGAAAGG - Intergenic
959048893 3:101505330-101505352 TTTTATTTGTATAAATTTAAGGG - Intronic
959730823 3:109599750-109599772 TTACATTTGAATATACTGCATGG - Intergenic
959995649 3:112677544-112677566 TTTTATTTGTATAAATTTAAAGG + Intergenic
960233963 3:115259936-115259958 TTATTTTTGCATAAGATGTAAGG - Intergenic
960292921 3:115908218-115908240 TTATATATATATAAACTGAGGGG - Intronic
961111274 3:124285491-124285513 TTTTATTTGTATAAATTTAAAGG - Intronic
961952775 3:130767654-130767676 TTATATTTGGAAAAACCTAAAGG + Intergenic
962053426 3:131843283-131843305 TTATTTGTGCATAAACTGAGTGG + Intronic
963231518 3:142912923-142912945 TTCTGTTTTCATAAACAGAACGG - Intergenic
963299261 3:143580778-143580800 TGATATTTGACTTAACTGAAGGG + Intronic
963392897 3:144691124-144691146 CTAAATTTGCATAAAATGTATGG - Intergenic
963539661 3:146568813-146568835 TTTTTTTTGCATGAAGTGAATGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964707973 3:159640917-159640939 TTAAATTTGCATAATCTGGCAGG + Intronic
964886964 3:161494830-161494852 TAATTTTTGCATAGAGTGAAAGG + Intergenic
965039866 3:163492694-163492716 TAATATTTCCAAAAACTCAAGGG + Intergenic
965386501 3:168052539-168052561 TTTTATTTTCAAAAACTTAAGGG - Intronic
965614054 3:170574925-170574947 TTCTATTCTCATCAACTGAATGG + Intronic
967138321 3:186531353-186531375 TTAGATTTGCTTAAAAGGAAAGG + Intergenic
967799013 3:193633498-193633520 TTACAATTGCACAAATTGAAGGG - Intronic
968037655 3:195561625-195561647 TAATATTTTCTTAAACTGAAAGG - Intergenic
970378461 4:15481797-15481819 TTAAATATGCAGAAACTCAAAGG + Intronic
970631193 4:17947655-17947677 TTATAATTGCATAAATTTATGGG - Intronic
970649756 4:18163618-18163640 TTAAATTTGTATAAATTTAAGGG + Intergenic
971500220 4:27310993-27311015 TTATCCTTCCATCAACTGAATGG - Intergenic
971529077 4:27661773-27661795 TTTTATTTGTATAATCTTAAAGG + Intergenic
972843869 4:42964030-42964052 TTATCTTTTCATAAAATGACAGG - Intronic
972867064 4:43245782-43245804 TAATATTTGCATATGGTGAAAGG - Intergenic
972910967 4:43816620-43816642 TTATATATATATAAAATGAACGG - Intergenic
973236935 4:47915106-47915128 TTATATAGGCAGAAACTGAGAGG + Intronic
973340524 4:48998896-48998918 TTTTATTTGTATAAACTTATGGG + Intronic
973876526 4:55225370-55225392 TTTTATTTGTATAAATTTAAGGG - Intergenic
973903468 4:55501934-55501956 GTATATTTGTATAAACTACAAGG + Intronic
974283312 4:59828343-59828365 TAATAATTGCTTAAACTCAATGG + Intergenic
974767693 4:66369274-66369296 TTATATGTGAGGAAACTGAAAGG - Intergenic
974893427 4:67908479-67908501 TTTTATTTGTATAAATTTAAGGG - Intergenic
975311347 4:72907110-72907132 TAATTTTTGTATAAGCTGAAAGG + Intergenic
976157004 4:82156931-82156953 TAATTTTTGTATAAAATGAAAGG - Intergenic
976898519 4:90142260-90142282 TGAGATTTGCATAAACAAAAAGG - Intronic
977060329 4:92251201-92251223 TAATATTTGTATAAAGTGTAAGG + Intergenic
977987845 4:103405502-103405524 TTATATTTATTTATACTGAATGG + Intergenic
978476135 4:109132854-109132876 TTCTACTTGCAAATACTGAATGG + Intronic
978528263 4:109688756-109688778 TTATTTTTTAATAAACTGCAGGG - Exonic
978728709 4:111999575-111999597 ATATATTTGACTAAATTGAAAGG + Intergenic
979132606 4:117066714-117066736 TGATATTTTCATAATCTGAAAGG + Intergenic
979151850 4:117327403-117327425 ATATATTTGTATAAAATAAAGGG - Intergenic
979571627 4:122233164-122233186 TTGTATTAGAATCAACTGAATGG - Intronic
979936082 4:126698197-126698219 CTATATTATCATAAACTGATAGG + Intergenic
980329597 4:131393214-131393236 TTTTATTTGTATAAATTTAAGGG + Intergenic
980504326 4:133695507-133695529 TTATATTTGTATATACTGAAAGG - Intergenic
980731752 4:136833033-136833055 TTATTTTTGTATAAAGTGTAAGG + Intergenic
981363325 4:143872397-143872419 TTAAATTTGCTTATACTGCATGG - Intronic
981383156 4:144096454-144096476 TTAAATTTGCTTATACTGTATGG - Intergenic
981816370 4:148835224-148835246 TTATTTTCGCTGAAACTGAAGGG - Intergenic
982556434 4:156872186-156872208 TTATATTAGCATATATTAAATGG - Intronic
983256475 4:165405892-165405914 TTATATTGGCATAAAATGGCAGG + Intronic
983286759 4:165749804-165749826 TTATATTGGCATAAACCTAGGGG + Intergenic
983699549 4:170575135-170575157 TTATTTTTGCATAAGATGTAAGG - Intergenic
983724105 4:170897586-170897608 TTATATTTTTATATACAGAAAGG - Intergenic
985319909 4:188699355-188699377 TTATATTTACATTAACTGATAGG - Intergenic
985782835 5:1880046-1880068 TTATATTTGACTAAACTTACAGG + Intronic
985839133 5:2292496-2292518 TTATTTTTGTATATGCTGAAAGG - Intergenic
986459630 5:7957107-7957129 TTTTATTTGTATAAATTTAAAGG - Intergenic
986478119 5:8157044-8157066 TTATTTATGGATAACCTGAAAGG + Intergenic
986614627 5:9603834-9603856 TTAAATGTGTATAAACCGAATGG + Intergenic
986883829 5:12209394-12209416 TTACATTTGAATAAAATAAAAGG - Intergenic
986900764 5:12430388-12430410 TTATTTTTAAATAAAATGAAGGG + Intergenic
986962170 5:13227472-13227494 TTATATTTTGAAAAATTGAAAGG - Intergenic
987110033 5:14677142-14677164 TTAAATTTACCTAAACTGCAAGG + Intronic
987490168 5:18569991-18570013 TTCTATTAGCATTCACTGAATGG - Intergenic
987504023 5:18746838-18746860 TTATATATACATATAGTGAAAGG - Intergenic
988422243 5:31020485-31020507 TTTTATTTGCATAAATTTAGAGG - Intergenic
989070969 5:37511275-37511297 TTATATTAGTATACACTCAATGG + Intronic
989364557 5:40641120-40641142 TTATATTTTTCTCAACTGAATGG - Intergenic
989399614 5:40994584-40994606 AAATATTAGCATAAACTCAATGG - Intergenic
989530633 5:42503913-42503935 TTATATGTGCTTAGAATGAAAGG + Intronic
990166452 5:52998898-52998920 TTATTTTTGCATATACTAATTGG - Intronic
990689285 5:58345569-58345591 TTAAAATTCCATAAACTGAGTGG + Intergenic
990795115 5:59531282-59531304 TAACATTTGCATAGACTCAAAGG - Intronic
991434265 5:66580361-66580383 TTTTATTTGTATAAATTTAAAGG + Intergenic
991468797 5:66945187-66945209 TTAAATTTGCAGAGACTGATTGG + Intronic
992276405 5:75124954-75124976 ATATATTTGTATAAATTTAAAGG - Intronic
992355259 5:75975330-75975352 TGATATCTGCCTAAAATGAAAGG + Intergenic
992390077 5:76322861-76322883 TTAATTTTGCATAAAGTGTAAGG - Intronic
993176703 5:84495631-84495653 CTATAATTGGAAAAACTGAAAGG + Intergenic
993318607 5:86443378-86443400 TTAAATTTGTATAAATTTAAGGG - Intergenic
993322733 5:86494158-86494180 TTTTATTTGTATAAATTTAAGGG + Intergenic
993419801 5:87686309-87686331 TTATATTTGCTAGATCTGAAAGG + Intergenic
993700117 5:91109311-91109333 TTCTGATTGAATAAACTGAAAGG - Intronic
993706406 5:91176691-91176713 TTACACTTGCATAAACTAGAAGG + Intergenic
993755045 5:91718276-91718298 TTTTATTTATATAAACTTAAGGG + Intergenic
994177386 5:96725814-96725836 TTATATTTGCATAAACTGAAAGG + Intronic
994377865 5:99035783-99035805 TTTTATTTGTATAAATTTAAGGG + Intergenic
994596847 5:101849339-101849361 TTATATTTGGAAAAACCTAAAGG - Intergenic
994894117 5:105679572-105679594 TTAGAGTTGTATGAACTGAAAGG - Intergenic
995474714 5:112536117-112536139 TTATATTTGCAGAAATAGAATGG + Intergenic
996053674 5:118961284-118961306 TTATATTTCTATAAAAAGAAAGG - Intronic
996233113 5:121090755-121090777 CAATATTTACATAAACTGATAGG - Intergenic
996259097 5:121443875-121443897 TTCTATTTGTATAAATTTAAAGG + Intergenic
997281945 5:132654873-132654895 TTGTATTTACATAAACTAATAGG + Intergenic
998538616 5:142958033-142958055 TAACATTTGAAAAAACTGAAAGG + Intronic
998876176 5:146601711-146601733 CTAAATTTGTATAAACTTAATGG + Intronic
1000003840 5:157165207-157165229 TTTTATTTGTATAAATTTAAGGG - Intronic
1000243811 5:159432615-159432637 TTATGTTTAAATAAACTGAGAGG + Intergenic
1000676991 5:164133023-164133045 TTATAGTTTCATAAGCAGAAGGG + Intergenic
1001486712 5:172124845-172124867 TTAAATTTGAAAAAACTAAATGG + Intronic
1002631019 5:180578707-180578729 TTGTATTTACATAAACTAAATGG + Intergenic
1004033615 6:11899568-11899590 TTTTATTTGCATAAATTTACAGG + Intergenic
1006572995 6:35020914-35020936 TTAAATTTGAAAAAACTTAAAGG + Intronic
1007376324 6:41459354-41459376 TCATGTGTGGATAAACTGAAGGG + Intergenic
1007876648 6:45110854-45110876 TTTTAATGGCATAAACTGTAAGG + Intronic
1008072431 6:47111321-47111343 TTATATTTGCAGAAAATTTAAGG + Intergenic
1008096860 6:47347811-47347833 TTACAGATGCAGAAACTGAAGGG - Intergenic
1008306334 6:49905750-49905772 TTATATTTGCATAAAAATCAAGG + Intergenic
1009056943 6:58347581-58347603 TTATATTTTCTTTAAGTGAAGGG + Intergenic
1009234300 6:61103987-61104009 TTATATTTTCTTTAAGTGAAGGG - Intergenic
1009290401 6:61873377-61873399 TTATATTTTCATAAATTTATTGG - Intronic
1009522556 6:64701822-64701844 TTTTATTTGAATAAATTTAAGGG - Intronic
1009618297 6:66038845-66038867 ATAAATTTGCATAAACAGAAAGG - Intergenic
1009619444 6:66053944-66053966 TTTTATTTGCAGAAACAAAATGG - Intergenic
1009792867 6:68425829-68425851 TTATATTTGCATAACCTTTTGGG - Intergenic
1010194729 6:73227717-73227739 TTAGTGTTGCACAAACTGAAAGG + Intronic
1010196433 6:73244240-73244262 TTAGTTTCGCACAAACTGAAAGG + Intronic
1010501246 6:76603027-76603049 TAATATTTGAATAAAGTGTAAGG - Intergenic
1010528319 6:76931915-76931937 TTATACTTGTATAAATTTAAGGG + Intergenic
1010629312 6:78178414-78178436 TAATATTTGTATAATGTGAAAGG - Intergenic
1011140978 6:84156203-84156225 TTATTTTTGTATAAAGTGAGAGG - Intronic
1011234517 6:85201615-85201637 TTATTTTTGCATAAGGTGTAAGG + Intergenic
1011460116 6:87594018-87594040 TTCCATTTTCATAAACTTAAAGG - Intronic
1011988596 6:93482855-93482877 TAATTTTTGTATAAACTGTAAGG - Intergenic
1012509499 6:99986911-99986933 TTATATTTTTATATACTTAAGGG - Intronic
1012509757 6:99989772-99989794 TTATATTTTCAAAAAGTGGAAGG - Intronic
1012665838 6:101968146-101968168 TTATATTTGCATAAGATGCATGG - Intronic
1013003696 6:106050122-106050144 TTCTATTTCCATAAAATGAGAGG + Intergenic
1013659139 6:112276840-112276862 TCATAGATGCATAAACTGAGAGG + Intergenic
1013758244 6:113485433-113485455 TTTAATTTGTATAAATTGAAGGG - Intergenic
1013815986 6:114098344-114098366 ATATATTTGCAAACACTGAGTGG + Intronic
1013856070 6:114573808-114573830 TATTATTTGCATAAATTTAAGGG - Intergenic
1013970152 6:116007930-116007952 TTTTATTTGAAAAAAATGAAGGG + Intronic
1014425897 6:121305681-121305703 TTATAGTTGCAGCAACTGATAGG + Intronic
1015044133 6:128759135-128759157 TAAAATGTGCATATACTGAAGGG + Intergenic
1015568529 6:134598624-134598646 ATATATTTGCATTAACTGTCTGG + Intergenic
1015932076 6:138371245-138371267 TTATATATGCAAAAAATAAAGGG - Intergenic
1016436412 6:144042340-144042362 TAATTTTTGCATAAGGTGAAAGG + Intronic
1016591747 6:145753472-145753494 TTATATTTGCATTAAGAGAGAGG + Intergenic
1017267372 6:152463908-152463930 TTTTATTTGTATAAATTGATGGG + Intronic
1018005199 6:159615534-159615556 TTTTATTTGTATAAATTTAAGGG - Intergenic
1018536725 6:164828064-164828086 TTTTATTTGTATAAACTTATTGG + Intergenic
1020878263 7:13726016-13726038 TGATATTTGTAAAAAATGAATGG - Intergenic
1020897175 7:13954926-13954948 TTTTATTGGCATTTACTGAAAGG - Intronic
1020970235 7:14928677-14928699 TTCTATTTGCATAAATTTATGGG + Intronic
1021220755 7:17972935-17972957 TTATGTTTGCATACAGTGACTGG + Intergenic
1021279096 7:18694797-18694819 TTCCATTTGCATAAACTGGAGGG - Intronic
1021343459 7:19491715-19491737 TTAAGTTGGCATAAACTGACTGG + Intergenic
1021343990 7:19500139-19500161 TTTAATTTTCATACACTGAAAGG - Intergenic
1021910475 7:25381141-25381163 TTTTAATTGAATAAACAGAAAGG - Intergenic
1022267117 7:28767898-28767920 TCATATTTGTAAGAACTGAATGG - Intronic
1022696945 7:32716189-32716211 TTATATTTTAATAAACCAAAAGG - Intergenic
1022960509 7:35421877-35421899 TTTTATTTGTATAAACTGATGGG + Intergenic
1023645897 7:42314459-42314481 ATGTATTTGCTTAAAATGAAGGG - Intergenic
1023716554 7:43050280-43050302 TTATATTTGGAAAAACCTAAAGG + Intergenic
1024181088 7:46895851-46895873 TAATTTTTGTATATACTGAAAGG + Intergenic
1024747240 7:52422198-52422220 TTATATATGCATATAATAAAGGG + Intergenic
1025771637 7:64512875-64512897 TTAAAGTTACATAAACTGAAAGG - Intergenic
1026028293 7:66765801-66765823 CTATATTTGTATAAGGTGAATGG - Intronic
1027370365 7:77503017-77503039 TTACATTTCCATTAACAGAAGGG + Intergenic
1027406114 7:77862986-77863008 TTTTATTTGAATAAACTCTATGG - Intronic
1027463421 7:78484485-78484507 TTATATCTGCATGAACTGGGTGG - Intronic
1027544417 7:79508760-79508782 TTCTATTTGAATAAACTTATTGG - Intergenic
1027943046 7:84709096-84709118 TTAGATTTGCATAAAGCTAAAGG - Intergenic
1028283657 7:88967097-88967119 TTATACTATCAAAAACTGAAAGG - Intronic
1030841926 7:114364681-114364703 TTAGATTTCCATAAACGGTATGG + Intronic
1031235700 7:119173555-119173577 TTATATTTGCATAATAAGAATGG - Intergenic
1031263494 7:119552892-119552914 GTATATTTTCAAAAACTGAGGGG - Intergenic
1031304637 7:120110898-120110920 TTTTATTTGCATAAATTTAAGGG + Intergenic
1031566695 7:123307301-123307323 TTATATTTGGACAAATGGAAAGG - Intergenic
1031764828 7:125764782-125764804 TTATTTTTGGAAAAATTGAAAGG + Intergenic
1031900543 7:127405283-127405305 TTTTATTTGTATAAATTTAAGGG - Intronic
1035646876 8:1230831-1230853 TAATTTTTGCATATGCTGAAAGG - Intergenic
1036439616 8:8769121-8769143 TTTGATTTGCATTACCTGAATGG + Intergenic
1037141394 8:15524449-15524471 TTACATTTCCATAAACTCAGAGG + Intronic
1037307495 8:17521225-17521247 TTATATTTCAACAAAATGAAGGG + Intronic
1038303210 8:26375284-26375306 TTATATTTTCTTAAACTCACAGG - Intergenic
1038966881 8:32583669-32583691 TGAAATTTGCATTATCTGAAGGG - Intronic
1039013135 8:33117599-33117621 TGAAATTAGCATGAACTGAAAGG + Intergenic
1039806315 8:41002715-41002737 TTGTATTTGTATAAATTTAAGGG + Intergenic
1039811763 8:41055238-41055260 CTATATTTGCAAAAAATGAAAGG - Intergenic
1040064571 8:43134804-43134826 TTAAAGTCACATAAACTGAAAGG - Intergenic
1040628741 8:49183927-49183949 TTTTATTTGTATAAATTTAAGGG - Intergenic
1040682074 8:49823100-49823122 TTAAAATTGCATACACTGCAGGG - Intergenic
1040775709 8:51040884-51040906 TTTTATTTGTATCAATTGAAGGG + Intergenic
1040843124 8:51805463-51805485 TTATATATATATAAAATGAATGG + Intronic
1040870888 8:52099826-52099848 TCATATTAGCAAAAACTGTACGG - Intergenic
1041341410 8:56850064-56850086 TTATTTTTGTATAAAGTGTAAGG - Intergenic
1041425085 8:57711803-57711825 GAATATTTGCATAAACATAATGG + Intergenic
1041922496 8:63198102-63198124 TTATTTCTGCATAAACGGCAGGG - Intronic
1042259594 8:66844156-66844178 TGATATTTGAGTAAACTGAATGG - Intronic
1042716376 8:71777486-71777508 TTTCATTTGTATAAACTTAAGGG - Intergenic
1043340806 8:79236332-79236354 TTTTATTTGTATAAAGTTAAGGG - Intergenic
1043551319 8:81376145-81376167 TTCTATTTGCATAAAATTACCGG + Intergenic
1043618313 8:82155773-82155795 ATATATTTGCATATTCTGACTGG + Intergenic
1043824408 8:84908089-84908111 TTATAATTGCATATATTTAAGGG + Intronic
1044289822 8:90454585-90454607 TTTTATTTGCCTAAAATGAAAGG - Intergenic
1044362200 8:91300126-91300148 TTAGATTTGAACAAAATGAAAGG - Intronic
1044478484 8:92656496-92656518 TTAAATTTGCAAAAATAGAACGG + Intergenic
1045240599 8:100397424-100397446 ATATATATGCAAACACTGAAAGG - Intronic
1045621463 8:103982986-103983008 TTATATTTGGAAAAACCTAAAGG + Intronic
1045768010 8:105699425-105699447 TCATATTTGTACAAACTTAAAGG + Intronic
1045991240 8:108310691-108310713 TTATATTTGGAAAAACCTAAAGG + Intronic
1046150341 8:110215888-110215910 TTATATTTGGAGAAACCTAAAGG + Intergenic
1046426581 8:114059905-114059927 TTTTATTTGTATAAACTTAAGGG - Intergenic
1046980785 8:120334255-120334277 TTGTATGTGCATAACCTGTATGG - Intronic
1048139506 8:131779766-131779788 TTTTATTTGCATAAATTTAGCGG + Intergenic
1048260620 8:132942085-132942107 ATTTATTTCCATAAACAGAAGGG - Intronic
1048748519 8:137643728-137643750 TGATATTTGCATTTATTGAAGGG + Intergenic
1048756590 8:137746348-137746370 TTTTATTTGTATAAATTTAAGGG + Intergenic
1049019805 8:139948354-139948376 TTATATTGGCAAAAACAAAAGGG - Intronic
1050720417 9:8582698-8582720 TTACATTTGGACAATCTGAAGGG - Intronic
1050861025 9:10431259-10431281 TGATTTTTGCATAAAGTGTAAGG - Intronic
1051620004 9:19041029-19041051 TTATATTTGGAAAAACCTAAAGG + Intronic
1052869016 9:33485268-33485290 TGATTTTTGCATATAGTGAAAGG - Intergenic
1052872210 9:33518238-33518260 TTGTATTTGTATAAATTTAAGGG + Intergenic
1054779163 9:69150632-69150654 TGATATTTGTTTAACCTGAAAGG + Intronic
1055015250 9:71609799-71609821 TTATATGTGAATGAAATGAATGG - Intergenic
1055142593 9:72892603-72892625 TTATATTTGAGAAAACAGAAGGG - Intergenic
1055209844 9:73778556-73778578 TTTTATTTGCAAAAAGTCAATGG - Intergenic
1055360259 9:75482175-75482197 ATATATTTTCATAAAGTGGATGG - Intergenic
1055387876 9:75783515-75783537 TTATTTTTGTATATAGTGAAAGG + Intergenic
1055726390 9:79234107-79234129 ATATATTTGCTTTAACAGAAAGG - Intergenic
1056148644 9:83762140-83762162 TTATATTTGGAAAAACCTAAAGG + Intronic
1056182480 9:84099045-84099067 TTCTATTCGAATTAACTGAAGGG + Intergenic
1058201453 9:102047114-102047136 TTATTTTTGCATATGGTGAAAGG + Intergenic
1058353017 9:104049067-104049089 TTATATTTGCATAAAAACAGAGG + Intergenic
1058396723 9:104561989-104562011 TGATATTTGCATAAATTTATGGG - Intergenic
1058978151 9:110144015-110144037 TGATATTTGCAGATAATGAAGGG - Intronic
1059765252 9:117378053-117378075 TTATATTTTTATAAAAGGAATGG + Intronic
1059915618 9:119096442-119096464 TTGTAGGTGAATAAACTGAAAGG - Intergenic
1060319791 9:122547384-122547406 TTTTATTTGTATAAACTTAGAGG + Intergenic
1185815300 X:3149479-3149501 TTTTATTTGTATAAATTTAAGGG - Intergenic
1185932261 X:4216307-4216329 TTGTATTTGTATAAATTTAAGGG + Intergenic
1186019839 X:5242023-5242045 TTATATAAACATAAATTGAACGG + Intergenic
1186766351 X:12774229-12774251 TTACAGATGAATAAACTGAAGGG - Intergenic
1187231523 X:17428105-17428127 TAATTTTTTCATAAATTGAAAGG - Intronic
1187586739 X:20671225-20671247 TTTTATTTGCCTAAATTTAAGGG + Intergenic
1187590471 X:20712018-20712040 TTAGATTTTCATATACTCAATGG - Intergenic
1187605809 X:20881605-20881627 TTATATTTGGATAAACCTAAAGG + Intergenic
1187714012 X:22083739-22083761 TTATATTTGGATAAACCTAAAGG - Intronic
1187723860 X:22181978-22182000 TTATATTTGGAAAAACCTAAAGG - Intronic
1187968192 X:24633361-24633383 TTATATTTGTATATACTTAATGG - Intronic
1188415642 X:29930283-29930305 TGATAGTTGCATAAACAGATAGG + Intronic
1188663205 X:32786687-32786709 TTTTCTTTGCATTAACTAAAAGG - Intronic
1188745378 X:33834805-33834827 TTATATTTGGAAAAACCTAAAGG - Intergenic
1188767881 X:34118989-34119011 TGATATTTCAAAAAACTGAATGG - Intergenic
1188798138 X:34491804-34491826 TAATTTTTGCATTAACTCAAGGG + Intergenic
1189942141 X:46135613-46135635 TTTTATTTGTATAAATTTAAGGG + Intergenic
1190501534 X:51083676-51083698 TTTTATTTGTATAAATTTAAGGG - Intergenic
1190540170 X:51469196-51469218 TTAAGTTTGCATAAACTCATTGG - Intergenic
1190961042 X:55247916-55247938 TTATATTTGGAAAAACCTAAGGG + Intronic
1190977733 X:55423112-55423134 TAATTTTTGCATAAAGTGTAAGG - Intergenic
1192686356 X:73309765-73309787 TAATATTTGTATAAAGTGTAAGG - Intergenic
1192797773 X:74438684-74438706 TTATCTAGGCAGAAACTGAAGGG - Intronic
1193004279 X:76598252-76598274 TAATTTTTGCATAAAGTGTAAGG + Intergenic
1193170254 X:78327880-78327902 TTATATTAGCATATACTGGCAGG - Intergenic
1193338151 X:80314456-80314478 TTAAAATTACATGAACTGAAAGG - Intergenic
1193667536 X:84340544-84340566 ATACATTTTCATAAACTGGAAGG + Intronic
1193846812 X:86482257-86482279 TTATAATTGCATAAATTTATGGG - Intronic
1194196403 X:90898890-90898912 TTATATTTGGAAAAACCTAAAGG - Intergenic
1194549649 X:95280969-95280991 TGTTATTAGCACAAACTGAAAGG - Intergenic
1195531771 X:105965785-105965807 TTTTAATTCCAAAAACTGAATGG + Intergenic
1195584117 X:106543949-106543971 TTTTATTTGTAAAAATTGAAGGG + Intergenic
1195772313 X:108364438-108364460 TTTTATTTGTATAAATTTAAGGG + Intronic
1195807285 X:108789068-108789090 TTATATTTGGAAAAACCTAAAGG - Intergenic
1196006958 X:110846990-110847012 TTGTATTTGTATAAATTTAAGGG - Intergenic
1196039175 X:111183409-111183431 TTATATTTGTAAAACCTTAATGG + Intronic
1196426326 X:115573424-115573446 TTATTTTTGTAAAAACTAAATGG - Intronic
1196639665 X:118043977-118043999 TTATATTTGGAGAAACCTAAAGG + Intronic
1196921404 X:120589393-120589415 TAATATTTGCATAAATTTATAGG - Intergenic
1197015763 X:121624561-121624583 TCTTATTTGCATAAATTTAAGGG + Intergenic
1197064057 X:122217690-122217712 TCATAATTCCATAAAATGAATGG - Intergenic
1197325013 X:125082141-125082163 TTTTATTTATATAAACTTAAGGG - Intergenic
1197368536 X:125597880-125597902 CTATATATGCATAAAGGGAATGG + Intergenic
1197469527 X:126850375-126850397 TTATTTTTGTATAAAGTGTAAGG - Intergenic
1197931646 X:131702564-131702586 TTATATTTGTATATATTTAAGGG - Intergenic
1198147736 X:133874402-133874424 ATATATGTGCATAAAATGGAAGG - Intronic
1198247945 X:134849361-134849383 TTCTAGTTGCATAAAATGAAAGG - Intronic
1199001425 X:142641946-142641968 TTATATCTGTACAAACGGAAAGG + Intergenic
1199135645 X:144248102-144248124 TTATATTTGAAAAAATTGAAAGG + Intergenic
1199207530 X:145165970-145165992 TAATTTTTGCATAAAGTGTAAGG - Intergenic
1199282428 X:146017851-146017873 TTATATTTCTTTAAACTAAATGG + Intergenic
1199371474 X:147055045-147055067 TTTTATTTGTATAAATTTAAGGG - Intergenic
1199513546 X:148650115-148650137 TTACATTTGGATAAATTGATGGG + Intronic
1200344986 X:155439278-155439300 TTACATTTGCAAAGACTGCAGGG - Intergenic
1200542246 Y:4473090-4473112 TTATATTTGGAAAAACCTAAAGG - Intergenic
1200968381 Y:9122745-9122767 TTATCTTTTCAGAAACTGTATGG - Intergenic
1201266003 Y:12207231-12207253 TTTTATTTGTATAAATTTAAGGG + Intergenic