ID: 994177457

View in Genome Browser
Species Human (GRCh38)
Location 5:96726992-96727014
Sequence GCTGCCCATCAGCCACATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994177455_994177457 3 Left 994177455 5:96726966-96726988 CCCATCATGGACTTTCTGTAGGC 0: 1
1: 0
2: 0
3: 8
4: 117
Right 994177457 5:96726992-96727014 GCTGCCCATCAGCCACATTCTGG No data
994177456_994177457 2 Left 994177456 5:96726967-96726989 CCATCATGGACTTTCTGTAGGCT 0: 1
1: 0
2: 2
3: 13
4: 134
Right 994177457 5:96726992-96727014 GCTGCCCATCAGCCACATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994177457 Original CRISPR GCTGCCCATCAGCCACATTC TGG Intronic
No off target data available for this crispr