ID: 994177531

View in Genome Browser
Species Human (GRCh38)
Location 5:96728069-96728091
Sequence ACCTCCATGCAGAGGCAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994177531_994177538 24 Left 994177531 5:96728069-96728091 CCATTCTGCCTCTGCATGGAGGT 0: 1
1: 0
2: 0
3: 29
4: 209
Right 994177538 5:96728116-96728138 ACAAATGTTTCTCTTCAATAAGG 0: 1
1: 0
2: 0
3: 28
4: 344
994177531_994177534 -3 Left 994177531 5:96728069-96728091 CCATTCTGCCTCTGCATGGAGGT 0: 1
1: 0
2: 0
3: 29
4: 209
Right 994177534 5:96728089-96728111 GGTGAACCCCAGGTTGTGTACGG 0: 1
1: 0
2: 1
3: 10
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994177531 Original CRISPR ACCTCCATGCAGAGGCAGAA TGG (reversed) Intronic
900620732 1:3586579-3586601 TCCTCCATGCAGACACAGCACGG - Intronic
901610438 1:10493915-10493937 AACTCCAAGAAGAGGCAGGAAGG + Intronic
902110137 1:14071544-14071566 AGTTCCATGCAGAAGCAGGAGGG - Intergenic
903126885 1:21254465-21254487 TCTTCCAAGCAGAGGAAGAAAGG - Intronic
903353547 1:22732347-22732369 ACCTGGAGGCAGAGGCAGCAGGG + Intronic
903609092 1:24597025-24597047 TCTTCCATGAAGAGTCAGAAGGG + Intronic
904294469 1:29508952-29508974 ACCTCCATTCAGAGGCAACAGGG + Intergenic
905033059 1:34900388-34900410 AGGTACATGCAGAGGCAGAAGGG + Intronic
905891451 1:41521011-41521033 CACTCCATGTGGAGGCAGAATGG + Intronic
906773386 1:48505656-48505678 TCCTCTTTGCAGAGTCAGAAGGG + Intergenic
907823855 1:57996680-57996702 ACATCTATGCAGAGCTAGAAGGG - Intronic
907856422 1:58308012-58308034 ACCCCCATGTAGAAGGAGAAAGG + Intronic
908650773 1:66330446-66330468 TCCTTCATGCAGAGGAAAAAAGG - Intronic
910557193 1:88547677-88547699 TCTTCCTTGCAGAGGAAGAACGG + Intergenic
910765135 1:90774557-90774579 ACATTCATGCAGAGTGAGAATGG + Intergenic
911011598 1:93287130-93287152 ATCTCCAGGCAGAGGCTGCATGG + Intergenic
912173057 1:107124145-107124167 ACCCCCATTCAGTGGCAGGATGG + Intergenic
913441150 1:118899027-118899049 ACCACCATGCAGAAGCAGCAAGG - Exonic
915282367 1:154831281-154831303 GGCTCCATACAAAGGCAGAATGG + Intronic
916748816 1:167705454-167705476 ACTCCCATGGAGAGGCAGAATGG + Exonic
917700027 1:177571205-177571227 ACCTCCAGGCAAAGACCGAATGG - Intergenic
917748877 1:178037071-178037093 ACCTTCAGGGAGAGGGAGAAAGG - Intergenic
919459523 1:197859766-197859788 ACTTCCATACATAGGGAGAAAGG - Intergenic
920819106 1:209363733-209363755 ACTTCCTTACAGAGGTAGAAAGG + Intergenic
922313509 1:224419567-224419589 ACCTACGTGCAAAAGCAGAATGG - Exonic
922533002 1:226358623-226358645 CCTTCCATGCTGAGGCTGAATGG + Intergenic
924052245 1:240091489-240091511 ACAGCCATGCAGAGGCAGACAGG + Intronic
924153389 1:241151437-241151459 ACCTGCATGCAGCGGGTGAAGGG + Intronic
1063366324 10:5493144-5493166 GCCTCCATGCAGAGCCGGGAAGG + Intergenic
1063366885 10:5496447-5496469 ACCTCCGGGCAGAGCCAGGATGG + Intergenic
1065381667 10:25096894-25096916 AACTCCTGGCAGGGGCAGAATGG - Intergenic
1066369868 10:34811431-34811453 ACCTGCCTGCAGGGGCAGATGGG - Intronic
1066469572 10:35685266-35685288 ACCTCCATTCAAAAGCATAAAGG - Intergenic
1067012892 10:42730999-42731021 ACCACCATGGTGGGGCAGAAAGG - Intergenic
1067844979 10:49712448-49712470 ACCTCAGTCCAGAGGCAGCATGG + Intergenic
1068826400 10:61444865-61444887 ATCTGCAAGCAGAGGCATAAAGG + Intronic
1069253696 10:66305003-66305025 GCCACCAGGGAGAGGCAGAAGGG - Intronic
1070647027 10:78208884-78208906 ACCTCCATTCAGGGGAAAAATGG + Intergenic
1074081893 10:110174594-110174616 GCCTCCATTCAGAAGCACAAAGG - Intergenic
1075027285 10:118994637-118994659 ACCCCCAGGCAGAGGAAGAGAGG - Intergenic
1076555200 10:131316867-131316889 ACCTCGATGCTGGGGCAGAGGGG - Intergenic
1077550872 11:3199707-3199729 AGCTCCGTGGAGAGGCAGAGAGG + Intergenic
1079371361 11:19855724-19855746 ATCTCCTTGGAGAGACAGAAGGG - Intronic
1081987257 11:47314770-47314792 GACTCAATGCAGAGGCAGATAGG + Intronic
1082704835 11:56480825-56480847 AGCTACATGGAGAGGTAGAAAGG + Intergenic
1084218998 11:67666396-67666418 AACTCCCTGCAGGGGCAGATGGG + Exonic
1085221234 11:74875342-74875364 ACTCCCCTGCAGAGGCAGAGTGG + Intronic
1085545952 11:77318629-77318651 GCCTCCATGCAGTTGCTGAAAGG - Intergenic
1085822400 11:79806724-79806746 AGCTTCATGCAGAGGCAAAAAGG - Intergenic
1088181510 11:107117991-107118013 TGCTGCATCCAGAGGCAGAAAGG + Intergenic
1094486160 12:30927245-30927267 ACATCCCTGCACAGGCAGACAGG - Intronic
1095282032 12:40363634-40363656 TTCTCTATTCAGAGGCAGAAAGG - Intronic
1096748277 12:53742804-53742826 ACCACCCTGCAGCGGGAGAATGG - Intergenic
1096893624 12:54797351-54797373 ACCTCCTTATAGAGGGAGAAGGG - Intergenic
1100784083 12:98060810-98060832 ACAACCATGAAGTGGCAGAAAGG + Intergenic
1101922543 12:108944522-108944544 CCCTCCACACAGTGGCAGAATGG - Intronic
1103226602 12:119293118-119293140 ACATTCATTCAGAGGCAGAGAGG + Intergenic
1103817745 12:123672020-123672042 ACCAGCATGCAAAGGCAGCAAGG - Intronic
1104236078 12:126937749-126937771 GTCTCCATGCAGATGGAGAAGGG + Intergenic
1104852591 12:131884370-131884392 ACCTCCATTCAGCCACAGAAAGG + Intergenic
1104883246 12:132086801-132086823 ACCACCATGTAGAGGAAAAATGG + Intronic
1105885278 13:24636762-24636784 AGCTCCATGAAGAGGCAGCATGG - Intergenic
1107631952 13:42351423-42351445 CCCCCTATGCAGAGGGAGAAGGG - Intergenic
1108761400 13:53570171-53570193 AGCTCCATGGATATGCAGAAAGG - Intergenic
1110342233 13:74405442-74405464 GCTTCCATACATAGGCAGAAAGG - Intergenic
1114332552 14:21652095-21652117 ATCTCCATTCAGAGGCAATAAGG - Intergenic
1116201364 14:41801932-41801954 ACCTCAATGAAGAAGCAGAAAGG + Intronic
1118906420 14:70027042-70027064 AAGCCTATGCAGAGGCAGAAAGG + Intronic
1118975228 14:70670934-70670956 GCCACCATGGATAGGCAGAAGGG + Intronic
1119205995 14:72793907-72793929 ACCTCCATCCAGAAGCAGCAAGG - Intronic
1119517126 14:75257199-75257221 AGTTCCAAGCAGAGGAAGAAGGG - Intronic
1120156660 14:81100867-81100889 ACCTCCATACAAAGCCAGAGAGG - Intronic
1120548175 14:85835971-85835993 AACTCCATGCAAAGGAAGATTGG + Intergenic
1121115223 14:91338565-91338587 TCCTCCCTGCAGAGGCAGTAAGG + Exonic
1121595031 14:95156500-95156522 ACCTCCAGGCAGAGCCATCAGGG + Intronic
1121670231 14:95703948-95703970 ACCTCAATGAAGAGGAAGGAAGG + Intergenic
1121817899 14:96942546-96942568 ACCAGCATGCAGAGGCAGGGAGG - Intergenic
1122468536 14:101950443-101950465 GCCTTCATGAAGAGGAAGAAAGG - Intergenic
1125462622 15:39920785-39920807 CCAGCCATGCAGAGGCAAAAAGG - Exonic
1128436932 15:67661819-67661841 ATCTCCATTCTGAGGAAGAAGGG - Intronic
1128625092 15:69193203-69193225 ACCTCCAGGCAGAAGCTGGAGGG + Intronic
1129667814 15:77589218-77589240 AGCCCCCTGCAGAGGCAGCAGGG + Intergenic
1130982164 15:88820241-88820263 GTCTCCTTGCAGAGGCAGACAGG + Intronic
1131728648 15:95255224-95255246 AACTCAATGCATGGGCAGAATGG - Intergenic
1132542897 16:519583-519605 ACCTCCACTGAGAGGCAGGAAGG + Intronic
1136084281 16:27873599-27873621 AGCCCCAAGCAAAGGCAGAAGGG + Intronic
1136399443 16:30009860-30009882 ACCTACATGCACAGCCAGCAGGG + Intronic
1137274994 16:46927515-46927537 CCATCCATGCAGGGCCAGAACGG - Intronic
1137321773 16:47391122-47391144 ACCCACAAGCAGAGGCACAAAGG + Intronic
1138012688 16:53397625-53397647 ACCCCCCAGCAGAGGCAGACTGG + Intergenic
1140703082 16:77600937-77600959 AGCTCAATGCCTAGGCAGAAAGG + Intergenic
1143740139 17:8946505-8946527 ACAGCAATTCAGAGGCAGAAGGG + Intronic
1146230270 17:31101537-31101559 AGGTGCATGCAGAGGCATAATGG - Intronic
1146582520 17:34051569-34051591 ACCTCCATGCCCATTCAGAAGGG - Intronic
1146628915 17:34456016-34456038 ACCTCCATGCAGTGGATGGAAGG - Intergenic
1146638177 17:34521274-34521296 ACCTCCATGTGGGGACAGAAAGG - Intergenic
1147008429 17:37423595-37423617 ACCTGCAAGCAGAGGAAAAAAGG - Exonic
1147226925 17:38986366-38986388 ACCTCCAAGGAGAGAAAGAAGGG - Intergenic
1148482847 17:47971257-47971279 ACCACCCTGCAGGGCCAGAACGG - Intronic
1151151294 17:72089631-72089653 ACCTCCTTGCTGTGGCAGGAGGG - Intergenic
1152314303 17:79571395-79571417 ACCCGCAGGCATAGGCAGAAGGG - Intergenic
1152553292 17:81040467-81040489 GCCTCAACCCAGAGGCAGAAAGG + Intronic
1154253056 18:12760293-12760315 ACCTGCATGCCAAGGAAGAAAGG - Intergenic
1157279438 18:46335926-46335948 AGCTAAATGCGGAGGCAGAAGGG - Intronic
1158187864 18:54791948-54791970 CCCACCATGGAGAGCCAGAAGGG - Intronic
1158909684 18:62047441-62047463 ACCTCCACTCAGAGGTAGAAAGG + Intronic
1160137624 18:76286046-76286068 CCCTCCCTGCAGAAGCACAAAGG + Intergenic
1161633074 19:5369122-5369144 ACCTACATGTAGATGCAGACGGG - Intergenic
1162341951 19:10096572-10096594 ACCTGCAGGCAGAGGAGGAACGG + Exonic
1163207026 19:15811268-15811290 ACCTCCAAGAAGAGGCCAAATGG + Intergenic
1163245004 19:16088010-16088032 AGCTACCTGCAGAGACAGAAAGG - Exonic
1164823343 19:31266609-31266631 ACCTTCAGGCAGAGCCAGGAAGG + Intergenic
1165793955 19:38507700-38507722 ATCTCCATGCAGAGGCCTTAAGG + Exonic
1165942862 19:39423940-39423962 ACCTCCTTGCTCAGGCAAAAGGG - Exonic
1167636038 19:50656320-50656342 GTCTCCATGCAGAGGCAGAGGGG - Exonic
925310062 2:2875740-2875762 AGCTCCCGGCAGAGGCAGGAAGG + Intergenic
925554888 2:5120349-5120371 TCCTCCTTACAGAAGCAGAAAGG - Intergenic
926198408 2:10777088-10777110 ACCTGTTTGCAGAGACAGAATGG + Intronic
926401620 2:12502962-12502984 ATTTACATGCAGAGGCAGAAAGG - Intergenic
927615932 2:24595741-24595763 ACCTCTATGCAGAGGCTGCAAGG - Intronic
927752966 2:25686405-25686427 ACCACCATGCAGGGGCAGCCTGG - Intergenic
927997058 2:27494124-27494146 ATCTCCCTGCAGCGGCAGAATGG - Exonic
932892392 2:75608484-75608506 AACTCCATGGAGATGCAGAGTGG - Intergenic
934972668 2:98775602-98775624 GCTTCCATGAAGAGGCAGATCGG - Intergenic
936392084 2:112084448-112084470 ACCGCCACACAAAGGCAGAAAGG - Intronic
940286952 2:152042055-152042077 CCCTAAATGCAGAGCCAGAATGG + Intronic
942110986 2:172682547-172682569 ACCTGCATGCAGAGGAGGACAGG - Intergenic
943283104 2:185963207-185963229 TCCCCCATGCAGAGGGAGGAAGG + Intergenic
943805650 2:192121604-192121626 GTCTCCTTTCAGAGGCAGAATGG - Intronic
947065640 2:226221807-226221829 ACCTGCATGGAGAGGAAGACTGG + Intergenic
948076214 2:235167202-235167224 AGATCTTTGCAGAGGCAGAAAGG - Intergenic
948180968 2:235979938-235979960 TACTGCATGCAGAGGCAGCAAGG - Intronic
948236175 2:236392918-236392940 ACCACCAGGAAGAGGCAAAAGGG - Intronic
1170791891 20:19515574-19515596 CCCTCCAGGCAGAGGCACAGAGG - Intronic
1171484584 20:25477673-25477695 ACCTCCAAGCATTGGCAGATCGG + Intronic
1172015630 20:31870803-31870825 ACGTCCAGGCAGAGCCGGAAGGG - Intronic
1172294376 20:33798198-33798220 TTCTCCATTCAAAGGCAGAAGGG + Intergenic
1174203887 20:48826013-48826035 ATCTCCTTTCACAGGCAGAAGGG + Intronic
1174304396 20:49604806-49604828 TCCCCCATGCAGATGAAGAACGG - Intergenic
1174662931 20:52230418-52230440 ACCTCCATCCCCAGGCAGGAGGG - Intergenic
1175221692 20:57421003-57421025 ACTTCTAGGCAGAGGCACAAAGG - Intergenic
1175549748 20:59809329-59809351 ACCACGATGCAGAGGCCGAGCGG - Intronic
1177107124 21:16973476-16973498 GCTTCCAGGCAGAAGCAGAAAGG + Intergenic
1178273084 21:31211547-31211569 ACCTCCATTCAAAAGAAGAATGG + Intronic
1180244263 21:46536267-46536289 CCCACCTTGCACAGGCAGAAAGG - Intronic
1180735439 22:18012964-18012986 ACCTGCATGCAGTGGGGGAAAGG - Intronic
1181423576 22:22818650-22818672 ACCTCCCTCCTGAGCCAGAATGG + Intronic
1183124969 22:35768348-35768370 CCCTGCATGCAGCGGGAGAAGGG + Exonic
949954324 3:9255387-9255409 GCCACCATACAGAGGCAGAATGG - Intronic
950350281 3:12343366-12343388 ATCTCCATGCACAGTCAGAAGGG + Intronic
951422417 3:22503074-22503096 ACCTACATTTAGAAGCAGAAAGG - Intergenic
952215197 3:31271434-31271456 GGCTGCAAGCAGAGGCAGAAAGG + Intergenic
953920054 3:46945354-46945376 ACCTCCATTAATAGGCAGATAGG - Intronic
953923172 3:46966128-46966150 ACCTACGTGCAGGGACAGAAAGG + Intronic
954371384 3:50171153-50171175 ACCTCCACCCAGGGGCAGACTGG + Intronic
960698198 3:120415921-120415943 ACCTCAATGCAGAGACAGGTGGG + Exonic
961633426 3:128317986-128318008 CACTCCAGGCAGAGGCAGGATGG + Intronic
962087575 3:132207980-132208002 ACCACTTTGCAGAGGCACAATGG + Intronic
962355099 3:134686948-134686970 TCCTCCATGCAGAGTCTGAAGGG + Intronic
963307722 3:143672294-143672316 AACTAAATGCAGAGGCAGAGAGG + Intronic
966420805 3:179732470-179732492 AACTCCTTGCAGAACCAGAAGGG - Intronic
966889330 3:184395333-184395355 TTCTCCATGCAGGGGCAGAAGGG + Intronic
967832652 3:193933783-193933805 ACCTACAGGCAGAGGCAAAGTGG - Intergenic
969166633 4:5321808-5321830 ACCTCCAGGCAGAGGCAGTTGGG - Intronic
973899182 4:55450130-55450152 AACTCCGAGAAGAGGCAGAAGGG + Exonic
974223243 4:59003465-59003487 TCCCCCATGCAGAGGGAGGAGGG - Intergenic
975647659 4:76561478-76561500 ACCTCCAGGCAGAGACTCAAGGG - Intronic
976387663 4:84480185-84480207 ACCTTCCTGCAGAGGCAGGGAGG + Intergenic
979549544 4:121975550-121975572 ATCTCCATGAAGAGGGTGAAAGG - Intergenic
980656015 4:135787333-135787355 TCCTCCATGCAGAGACAGAGTGG + Intergenic
980964757 4:139510267-139510289 ACCTCGATGCAGCGGCTGGAAGG - Exonic
981028596 4:140100980-140101002 GGCTCCATGGAGAGGCAGACAGG + Intronic
982245857 4:153349661-153349683 TCCACTATGCAGAGGAAGAAGGG - Intronic
989143874 5:38228990-38229012 ACCTCCCTGCAAAGGAAGATGGG - Intergenic
991769358 5:70026027-70026049 ATCCCCATGCAGAGGCGGAGAGG - Intronic
991848653 5:70901445-70901467 ATCCCCATGCAGAGGCGGAGAGG - Intronic
992259583 5:74956388-74956410 ACCTCCTGCCTGAGGCAGAAGGG + Intergenic
993187252 5:84635896-84635918 CCCTCCCTGCAGAGACAGCAGGG + Intergenic
993740114 5:91528469-91528491 ACCGGCATGCTGAGGCAGAAGGG + Intergenic
994177531 5:96728069-96728091 ACCTCCATGCAGAGGCAGAATGG - Intronic
994264117 5:97694290-97694312 ACCTCTTTGCAGAGTCTGAAGGG - Intergenic
997114594 5:131112560-131112582 AGCTCCAGGCACAGGCAGAGGGG - Intergenic
997397595 5:133576640-133576662 ACCTCCATCCAGCAGCAGAGGGG + Intronic
1002163254 5:177329437-177329459 ACCTCCAATCAGCAGCAGAATGG + Intergenic
1003501455 6:6706462-6706484 AGCTCCATGCACAGGCTGAATGG - Intergenic
1004386046 6:15173651-15173673 ACCTCCATCCAATGGCAGAATGG - Intergenic
1007008220 6:38387805-38387827 ACATCCATGCAGAATCATAAAGG + Intronic
1010525620 6:76897012-76897034 AACACCATGAAGAGGCAGCAAGG - Intergenic
1012786052 6:103627346-103627368 ACCTCCAGGCAGAGGGACCAAGG - Intergenic
1013771983 6:113638066-113638088 ACCTCCCTGCAGAGCCAGGCAGG + Intergenic
1015447710 6:133326656-133326678 CACTCCCTGCAGAGGAAGAAAGG - Intronic
1017724428 6:157267305-157267327 AGCTCCATGCAGAAGCCGCATGG - Intergenic
1018035038 6:159874545-159874567 AACTCCTTCCAGAGGCAGATGGG - Intergenic
1019745772 7:2699787-2699809 CCCTCCCTGCAGAGCTAGAAGGG - Intronic
1020000470 7:4752821-4752843 ACCTCCCTGCTGAGGCAGGATGG - Intronic
1024736226 7:52307788-52307810 ACCTCCACTCAGAGGCAAAGAGG - Intergenic
1026214040 7:68332467-68332489 CCCACCATGGGGAGGCAGAATGG + Intergenic
1028623907 7:92855795-92855817 ACATCCTTGGAGAGGCAGAATGG - Intergenic
1029600478 7:101560379-101560401 AGCTCCAGGCAGAGGCAGGCAGG - Intergenic
1030628278 7:111867761-111867783 CTCTCCATGCAGAGAGAGAAGGG + Intronic
1031009586 7:116512046-116512068 ACGTCCAAGCACAGGCAGATAGG - Intergenic
1032616960 7:133483229-133483251 AGCACCATGGAGAGGCAGGAAGG + Intronic
1034003569 7:147443374-147443396 ACCTGCAGGCAGTGGCAGCATGG - Intronic
1034233317 7:149549338-149549360 AACTCCATGGAGAGACCGAATGG - Intergenic
1034487783 7:151376795-151376817 ACCTACCTGCGGAGTCAGAAGGG - Exonic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1037522860 8:19697204-19697226 ACCACCATGAAGAGGAAAAATGG + Intronic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1038134039 8:24766669-24766691 AATTGCATTCAGAGGCAGAAGGG + Intergenic
1039891480 8:41688584-41688606 ACTTCCCTGCAGAAGAAGAAAGG + Exonic
1041127056 8:54652846-54652868 ACCTCCTTGCAGTGCCAGGAAGG - Intergenic
1044607256 8:94058156-94058178 AGCTCCATGCCGAGGCTGCAAGG - Intergenic
1045078173 8:98593813-98593835 AACTCCTTGAAGAGACAGAATGG + Intronic
1045289641 8:100821440-100821462 TCCTCCAGTGAGAGGCAGAAAGG - Intergenic
1046843069 8:118883012-118883034 ACTTGTAAGCAGAGGCAGAATGG + Intergenic
1049167993 8:141138694-141138716 ACATACATCCAGAGACAGAAAGG - Intronic
1049815987 8:144600633-144600655 ACCTCCATGCACACGCAGGTAGG - Intronic
1049816095 8:144602106-144602128 ACCTCCATGCACATGCACACAGG - Intronic
1049816113 8:144602342-144602364 ACCTCCATGCACATGCATACAGG - Intronic
1050609957 9:7341782-7341804 ACTTGCATGCAAAGGCAGTATGG + Intergenic
1053122460 9:35557243-35557265 AGTTCCTTGCAAAGGCAGAAGGG + Intronic
1056068523 9:82961778-82961800 AGCCCCATGCAGTGGAAGAAAGG - Intergenic
1059331227 9:113536978-113537000 AGCTCAATGCAGAGGCTCAAGGG - Intronic
1059619601 9:115988857-115988879 AACCTCAGGCAGAGGCAGAATGG - Intergenic
1060468983 9:123931460-123931482 ACCTAAAGGCAGAGGCAAAAGGG - Intergenic
1061804347 9:133129603-133129625 ACCACCACACAGAGCCAGAAAGG + Intronic
1061920245 9:133778655-133778677 ATCCCCAGGCAGAGGCAGAGAGG - Intronic
1061924909 9:133801249-133801271 ACCTCCATGAAGAGCCTGAAAGG + Intronic
1062214670 9:135382762-135382784 AGCTCCACACAGAGGCAGGAGGG + Intergenic
1062399448 9:136366030-136366052 GCCTCCAAGCAGAGGCGGAAGGG - Intronic
1203444628 Un_GL000219v1:44186-44208 ACCGACAGTCAGAGGCAGAACGG - Intergenic
1187478778 X:19635771-19635793 ACTTCCATGCAGGGACAGGAGGG - Intronic
1190364062 X:49675336-49675358 GACTCCATGCAGAGTCAGATGGG - Intergenic
1193524613 X:82573611-82573633 ACCCCCATGCAATGGCAGCATGG - Intergenic
1195151268 X:102072435-102072457 GCATCCATGCAGAGGCAGTGTGG - Intergenic
1195343670 X:103927634-103927656 ACTATCTTGCAGAGGCAGAAAGG - Intronic
1197018555 X:121657824-121657846 ACATCCATGCAGAGACAAAAAGG + Intergenic
1197195126 X:123692372-123692394 ATCACCATGCAGATGCATAATGG + Intronic
1200563297 Y:4734268-4734290 ACCCTCATGCAGAGGCACAGGGG + Intergenic