ID: 994181711

View in Genome Browser
Species Human (GRCh38)
Location 5:96774626-96774648
Sequence ATGCCTTGATTAATGAAACA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 175}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994181711_994181712 18 Left 994181711 5:96774626-96774648 CCATGTTTCATTAATCAAGGCAT 0: 1
1: 0
2: 0
3: 18
4: 175
Right 994181712 5:96774667-96774689 AATATTTTACATTAAAATCTTGG 0: 1
1: 1
2: 15
3: 118
4: 1549

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994181711 Original CRISPR ATGCCTTGATTAATGAAACA TGG (reversed) Exonic
902593149 1:17489318-17489340 ATGTCTTGGTTAATGAAGAAAGG + Intergenic
904904330 1:33883738-33883760 ATGCCTTGAATTGGGAAACAAGG + Intronic
905464716 1:38144232-38144254 AAGCCCTGATCAATCAAACAGGG - Intergenic
905842670 1:41197309-41197331 ATGACTGGATTAACAAAACATGG + Intronic
908724658 1:67162686-67162708 ATACCTTGATTAATTATCCAAGG + Intronic
909080649 1:71107563-71107585 CTGCCAGGTTTAATGAAACAAGG + Intergenic
909675083 1:78230194-78230216 AGGCCTTAATAAATGATACATGG + Intergenic
909853383 1:80498032-80498054 ATGGCTTGATTACTTAAATAGGG + Intergenic
910938337 1:92505396-92505418 ATGTCTTCATTATTGAAACGAGG - Intergenic
913549366 1:119902681-119902703 TTGTCTTGATGAATGACACAGGG - Intergenic
916013018 1:160723940-160723962 ATTCCTTGATTAGGGAACCAAGG + Intergenic
916156853 1:161859441-161859463 GTGCTTTGATTACTGAAAGATGG + Intronic
917857182 1:179110223-179110245 CTGCCTTGTTTAAAGAAGCATGG - Intronic
919528705 1:198687522-198687544 ATGCCTTTATATATGAAACAAGG - Intronic
923392479 1:233527506-233527528 ATGCCATAATTTATAAAACAAGG + Intergenic
923729765 1:236538980-236539002 ATACTTTGATAAATGAAAAATGG + Exonic
924066865 1:240232779-240232801 ATGCCGTGGTTATTAAAACAGGG - Intronic
1064846650 10:19662908-19662930 ATTCTATGATTAATGAAAAATGG - Intronic
1066146241 10:32561151-32561173 AGGCCTTGCTTTATGAAACTGGG - Intronic
1069217034 10:65833593-65833615 ATGTTTTAATTAATGAAATATGG + Intergenic
1071266508 10:83969324-83969346 ATGTTTTGATAAATGCAACATGG + Intergenic
1075116415 10:119630640-119630662 ATGCCTTGAGAAATTAAATATGG - Intergenic
1076830455 10:132991836-132991858 CTGCCGTGATTAAAGAGACAAGG - Intergenic
1080138731 11:28889689-28889711 ATGCATTTATGAATAAAACATGG - Intergenic
1080840036 11:35975740-35975762 ATGCCGTGATTCATGAGAGAAGG + Intronic
1086192921 11:84101781-84101803 ATGTCTTGATTAATGAGAGTAGG + Intronic
1097792152 12:63826564-63826586 ATTCATTGTTTAATGAAAAATGG + Intergenic
1098387712 12:69936247-69936269 ATGAAATGATTAATGAAAGAGGG - Intronic
1100194395 12:92227676-92227698 ATGCCTTAAGTAATGGATCAAGG + Intergenic
1100634598 12:96423540-96423562 ATGCCCTGATGAAACAAACAAGG - Intergenic
1101034026 12:100687114-100687136 ATGCATTGAATAATGGAAAATGG - Intergenic
1101158281 12:101948256-101948278 ATGATTTGAATAATGAAAAATGG + Intronic
1104027122 12:125035785-125035807 TTTCCTTGTTTAATGAAAGATGG - Intergenic
1108066296 13:46581072-46581094 TTACCTTGGTTAATGAAATAAGG + Intronic
1111029549 13:82577216-82577238 CTTCCTTGATAAATGGAACAAGG - Intergenic
1111819955 13:93200635-93200657 ATGATTGGATAAATGAAACATGG + Intergenic
1111877916 13:93919614-93919636 ATGCTTTGATTAATGAACCTGGG + Intronic
1112394951 13:99021014-99021036 CTGCCTTGATTTATGAAATATGG - Intronic
1113158011 13:107347445-107347467 ATGCTTTGAGTTATGAAAAAAGG + Intronic
1114298302 14:21350449-21350471 ATGTATTGTTTAATGAATCATGG + Intronic
1115178992 14:30600174-30600196 GAGCCTTGTTTCATGAAACAAGG + Intronic
1117393591 14:55286327-55286349 AAGCCTTCATTAATGAACCTCGG + Intronic
1121531286 14:94656032-94656054 TTGCTTTGATTAATGAAATATGG + Intergenic
1125860012 15:42990084-42990106 ATTCCTTGATTAAAGAAAATAGG + Exonic
1131865953 15:96710104-96710126 TTGCCTGAAATAATGAAACAGGG + Intergenic
1135869116 16:26132901-26132923 ATGAGTTGCATAATGAAACAAGG + Intronic
1139203290 16:65001376-65001398 TTGCCTTCATTAAGGAAACTTGG - Intronic
1140131763 16:72168086-72168108 ATGTCTTCATTCATGAAACAAGG + Intronic
1143120742 17:4605085-4605107 ATGCCTTGCTTTAAGAAGCAGGG - Intronic
1144272212 17:13629157-13629179 ATGACTGGATTGATGAGACAGGG - Intergenic
1144790244 17:17854161-17854183 ATGCCTTGAGTATTATAACAGGG + Intronic
1146375627 17:32292102-32292124 ATGCCCTGATTAAGAACACAGGG + Intronic
1146603818 17:34240893-34240915 ATACCAGGATTGATGAAACATGG - Intergenic
1150881266 17:69031199-69031221 AAGCCTTGAATGATGAAATAAGG - Intronic
1151259680 17:72906646-72906668 AGACCTTGTTTAATGAAACAGGG + Intronic
1153958487 18:10119754-10119776 ATGCATTGACCAATGGAACAGGG + Intergenic
1156113380 18:33755701-33755723 ATTCCTAGATTCATGAAAGAAGG - Intergenic
1158427997 18:57356308-57356330 GTCCTTTGAATAATGAAACAGGG - Intronic
1159298326 18:66525615-66525637 ATTCCTGGATTATTAAAACAAGG + Intronic
1162203315 19:9037012-9037034 ATGGATGGATTAATGAAAGATGG + Intergenic
1164666027 19:30037729-30037751 ATGGCTTGATTAATGGAAAAGGG - Intergenic
1165771310 19:38381968-38381990 GAGCCTTGATGAATAAAACAGGG + Intronic
929256273 2:39814475-39814497 AATCCCAGATTAATGAAACAAGG - Intergenic
930905613 2:56562773-56562795 ATGCCTTGTGAAATGAAATAGGG + Intergenic
931005216 2:57842936-57842958 CTTCCCTGAATAATGAAACAAGG + Intergenic
931051145 2:58416307-58416329 ATCCATTGATTACTGACACAGGG + Intergenic
935890933 2:107677199-107677221 ATGCATAAATTAATGAAACATGG - Intergenic
937764685 2:125646455-125646477 ATGCCATGATTAATGAGAATTGG - Intergenic
939762944 2:146207170-146207192 GTGCCTAGATTAATTAAACAAGG - Intergenic
941496837 2:166215327-166215349 ATGCCTACATTAAAGAAAGAAGG + Intronic
941555764 2:166979128-166979150 ATGCCTTTTTTCATGGAACATGG + Intronic
942179712 2:173368704-173368726 ATACCTTGATTAATGCAAAGAGG - Exonic
942904103 2:181160251-181160273 ATGACTTAATTAATGTTACAAGG - Intergenic
946601699 2:221365896-221365918 GTGCCTGGATTAAGGGAACAAGG + Intergenic
946602189 2:221367472-221367494 GTGCCTAGATTAAGGGAACAAGG + Intergenic
946602272 2:221367728-221367750 GTGCCTAGATTAAGGGAACAAGG + Intergenic
946602436 2:221368240-221368262 GTGCCTAGATTAAGGGAACAAGG + Intergenic
947914188 2:233821136-233821158 ATGCCTTGACTCCTGAACCATGG - Intronic
1170363437 20:15573473-15573495 ATGCCTTGATTAGAGAACTAAGG - Intronic
1175568855 20:60003556-60003578 TCTCTTTGATTAATGAAACATGG + Intronic
1178394740 21:32233146-32233168 ATGCCTTTATTCAGAAAACAAGG - Intergenic
1179174594 21:38999048-38999070 ATTCCTTGAAAAATTAAACATGG + Intergenic
1179491142 21:41742304-41742326 ATCCCTTCATTAAAGAAAGAAGG + Intronic
1182114875 22:27750588-27750610 ATGCCAAGATTACCGAAACATGG + Exonic
949132159 3:516485-516507 ATCCCTTTATTAATGTAACACGG + Intergenic
951326727 3:21311944-21311966 ATGAATGGATTAATGAAATATGG - Intergenic
957080080 3:75629961-75629983 ATGCCTGGCTTAATCAAACTTGG + Intergenic
957307065 3:78470759-78470781 ATGCCTTGGTCAATGAAGTATGG - Intergenic
958535980 3:95403957-95403979 ATGCCTATATTAGTGAAGCAAGG - Intergenic
958601931 3:96305738-96305760 GTGGCTGGATTACTGAAACATGG + Intergenic
959572009 3:107894794-107894816 AAGCATGGAGTAATGAAACAGGG + Intergenic
960128582 3:114027872-114027894 CTGCCTTGAGTAATGAAACTTGG - Intronic
960450428 3:117800047-117800069 ATGCATTGTTGAATTAAACAGGG + Intergenic
962449565 3:135501446-135501468 ATTCCTTGATTCAAGACACAAGG + Intergenic
962926728 3:140000515-140000537 ATGTCTTGATCCATAAAACAGGG + Intronic
962932075 3:140047971-140047993 TTGCCTTAAATAATGACACAAGG + Intronic
963624566 3:147654836-147654858 ATGACTTGGATGATGAAACACGG - Intergenic
964284785 3:155106360-155106382 ATGCCTTGGTTGAAGAAAGATGG - Intronic
964530546 3:157663160-157663182 ATGCATTTATTTATGAAACAGGG - Intronic
964636528 3:158863649-158863671 ATGTTTTGATTAATGACAGACGG + Intergenic
973227961 4:47807882-47807904 ATGCCTTCATTAAGGAGACTCGG - Intronic
973855584 4:55007335-55007357 ATGCCTTCAGTAAGCAAACAGGG - Intergenic
974078337 4:57188293-57188315 ATGCCCTAATGAAGGAAACATGG - Intergenic
975514857 4:75235468-75235490 AGGCCATGGTTAATGAAAAATGG - Intergenic
975643554 4:76524549-76524571 CTGCCTTAATTAACAAAACAGGG + Intronic
975939454 4:79624653-79624675 ATGCCCTTATTAAGCAAACAAGG - Intergenic
977236094 4:94509015-94509037 CTGCTTTGAGTAATAAAACATGG - Intronic
978190505 4:105905479-105905501 ATGCCATCATTTATGAAAAAGGG - Intronic
978929164 4:114289522-114289544 AGGACTTGCTTTATGAAACAGGG - Intergenic
979210963 4:118102248-118102270 GTGGCTTGATTATTGAAAAATGG - Intronic
979836389 4:125373716-125373738 ATTACTTGATTGAAGAAACAGGG + Intronic
979943222 4:126789931-126789953 ATACTTTCATTAATAAAACATGG - Intergenic
982052667 4:151517629-151517651 ATGCCTTGGTCAATGATAGATGG + Intronic
983806977 4:172006130-172006152 CTGCACAGATTAATGAAACAGGG - Intronic
983922852 4:173365881-173365903 ATGCATTGATTCAGGCAACATGG - Intergenic
984920150 4:184756784-184756806 ACCCCTTGATTAGAGAAACAGGG + Exonic
985232427 4:187835200-187835222 ATGCCTTGTTTGATGTAACAGGG - Intergenic
986837832 5:11660954-11660976 GTGGCTTGATTTCTGAAACATGG + Intronic
986900352 5:12423104-12423126 ATGTCATGGTTAATGAAATAAGG + Intergenic
988568592 5:32341894-32341916 AAGTTTTGATTAATGAAAAAAGG - Intergenic
991074294 5:62517838-62517860 ATGTCATGATTAAAGAAAAAAGG - Intronic
994181711 5:96774626-96774648 ATGCCTTGATTAATGAAACATGG - Exonic
1003556977 6:7148656-7148678 ATGCTATGCTTAAGGAAACAGGG + Intronic
1003869799 6:10392607-10392629 ATGTCTTGTTCAATCAAACAAGG + Intergenic
1004014243 6:11717987-11718009 ATTCCTTCATGAATAAAACAAGG + Intronic
1004478903 6:16000367-16000389 AAGCCATGAATAATGTAACAAGG + Intergenic
1004552739 6:16665031-16665053 ATGCCTGGCTTAATGGAAAATGG + Intronic
1005107919 6:22245659-22245681 ATCCATGGATAAATGAAACATGG - Intergenic
1006239918 6:32668624-32668646 ATGCCCTGAATAATGCAGCAGGG - Intergenic
1006321952 6:33324505-33324527 GTGCCTTGGTGAAAGAAACAGGG - Intronic
1007898666 6:45389457-45389479 ATGTCTTGCTTAAAGAAATATGG + Intronic
1008713970 6:54265769-54265791 ATGCCATTAATAGTGAAACAAGG + Intronic
1008961097 6:57267140-57267162 ATGCATTGATTAATTAATGAAGG - Intergenic
1009747161 6:67832010-67832032 ATGCCATGATGAAAGCAACATGG - Intergenic
1011648922 6:89487726-89487748 ATTCCTTGATCAATGAGAGAAGG - Intronic
1012751614 6:103170419-103170441 ATGAATGCATTAATGAAACAAGG - Intergenic
1013681002 6:112526258-112526280 TCTCCTTGATTAATGAAAAATGG - Intergenic
1014188563 6:118464551-118464573 ATGCCTTTATTAATTATATATGG + Exonic
1015794606 6:136998498-136998520 ATAACTTGATTAATGACCCAGGG + Intergenic
1015804978 6:137099759-137099781 ATGCCTTGAATAAGAAAAAAGGG - Intergenic
1015925153 6:138301648-138301670 ATCCCTGGATGACTGAAACATGG + Intronic
1017993962 6:159514833-159514855 ATCCCTTATTTTATGAAACAAGG + Intergenic
1025685113 7:63709970-63709992 ATGTATTTATTACTGAAACAAGG - Intergenic
1028364667 7:90013383-90013405 AAGCCTTGAATTATGAAACCTGG + Intergenic
1028464736 7:91138143-91138165 AGGCTTTGATTATTGAACCATGG - Intronic
1031341862 7:120612912-120612934 ATAGCATGATTAATGAAACAAGG - Intronic
1031785051 7:126019431-126019453 ATGTCATGATAAGTGAAACAGGG - Intergenic
1031900819 7:127408709-127408731 AAGCCTTGCTTAAGGAAATAAGG + Intronic
1032828733 7:135599487-135599509 ATGACTTTATTAATGAGGCATGG - Intronic
1034463440 7:151211240-151211262 ATGCTGTGATTAAAGAAACCTGG + Intronic
1034511599 7:151539846-151539868 ATGTATTGATTTTTGAAACAGGG + Intergenic
1038522376 8:28244341-28244363 GTCAATTGATTAATGAAACAGGG - Intergenic
1038896794 8:31792388-31792410 ATGACTTGTTTAATGGCACATGG + Intronic
1038986939 8:32821628-32821650 ATGACTTTGTCAATGAAACATGG + Intergenic
1039203763 8:35126099-35126121 ATGCCTTGATTCTGGAAAGAAGG - Intergenic
1039825149 8:41166913-41166935 ATGCCTTTTAAAATGAAACAAGG - Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041406648 8:57506588-57506610 ATGCCTGAATAAATGAAAGATGG + Intergenic
1041853418 8:62419910-62419932 ATGGCTTGATTAATTGAACATGG - Intronic
1044249163 8:89986021-89986043 ATGACATCAGTAATGAAACAAGG + Intronic
1044482953 8:92714122-92714144 ATGCCATGATTAAAGAAAAGGGG - Intergenic
1044541621 8:93414704-93414726 ATGGCTTGGTTAATGTCACATGG - Intergenic
1045961706 8:107976293-107976315 ATGGTTTAATTAAAGAAACATGG + Intronic
1045965359 8:108018313-108018335 ATGCCTATAGTAATGACACATGG + Intronic
1046434988 8:114175847-114175869 ATGCCTTTCTTAATGAAATATGG - Intergenic
1047162241 8:122393423-122393445 ATTCTCTGTTTAATGAAACATGG + Intergenic
1047811855 8:128419136-128419158 ATGTCTTCATTCATAAAACAGGG - Intergenic
1047868796 8:129059596-129059618 CTGTCTGGATTAATGAAACTAGG + Intergenic
1049074311 8:140382088-140382110 ATGCATGGATAAATAAAACATGG + Intronic
1051054943 9:12973863-12973885 ATGCATTGATGAGTCAAACATGG + Intergenic
1051322776 9:15926953-15926975 ATGACTTATTTAATGAATCAAGG + Intronic
1052732442 9:32305349-32305371 ATGCCTTCATTTATGAAATTGGG - Intergenic
1054323037 9:63692067-63692089 ATTCCTAGTTTGATGAAACATGG - Intergenic
1056822863 9:89855737-89855759 TAGCCTTGAATAATTAAACACGG + Intergenic
1058280730 9:103110209-103110231 ATGTATTAATTAATGAAATATGG + Intergenic
1061465927 9:130779648-130779670 ATGCCTTGACTAAACAAACAAGG + Intronic
1061659271 9:132117652-132117674 AGGCCTTAAATACTGAAACAAGG - Intergenic
1185473980 X:402510-402532 TTCCCTCGATAAATGAAACAAGG + Intergenic
1186227405 X:7414629-7414651 ATGCTTGTATAAATGAAACATGG + Intergenic
1186481580 X:9900081-9900103 TGGCCTTGATGAATGAAGCAGGG - Intronic
1187906981 X:24076002-24076024 AAGCCTTAATAAAGGAAACAGGG - Intronic
1188303712 X:28536765-28536787 GTGCCATGTTTATTGAAACAGGG + Intergenic
1188474509 X:30576576-30576598 ATGCCTTCATTAACTAAATATGG - Intronic
1189172340 X:38921701-38921723 ATGCCTTATTTAGTGCAACAAGG + Intergenic
1189768135 X:44393031-44393053 CTGCCTCAATTAAGGAAACATGG + Intergenic
1189851800 X:45185352-45185374 ATGCCTTGATTTTTTAAAAAAGG + Intronic
1190546139 X:51529768-51529790 ATACCATGATCAATGAAACATGG + Intergenic
1195438498 X:104873678-104873700 TTGCCTTGACCAATGCAACATGG - Intronic
1195545062 X:106104963-106104985 ATCCTTTGAATAATAAAACATGG - Intergenic
1197320685 X:125025949-125025971 ATGCCTTTATTCATTAAAGATGG + Intergenic
1197631878 X:128870272-128870294 ATGCCTTGATAAATGAAGTTTGG - Intergenic
1198762638 X:140049180-140049202 ATGCCTGTATTATTAAAACAAGG - Intergenic
1199807582 X:151315734-151315756 ATGTCTTTATTAATGAAATCTGG + Intergenic
1201305586 Y:12547233-12547255 TGGCCTTGATGAATGAAGCATGG - Intergenic