ID: 994184823

View in Genome Browser
Species Human (GRCh38)
Location 5:96805943-96805965
Sequence GTACCGGGACCTTGGATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994184813_994184823 27 Left 994184813 5:96805893-96805915 CCAACTCGTTATGAGCTGACAGA 0: 1
1: 0
2: 0
3: 1
4: 45
Right 994184823 5:96805943-96805965 GTACCGGGACCTTGGATCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994184823 Original CRISPR GTACCGGGACCTTGGATCAG AGG Intronic
No off target data available for this crispr