ID: 994187369

View in Genome Browser
Species Human (GRCh38)
Location 5:96830207-96830229
Sequence CCAGCTTGTGGTCCCCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994187362_994187369 30 Left 994187362 5:96830154-96830176 CCCAGCTGTAAGGATAAACCTAG 0: 1
1: 0
2: 0
3: 9
4: 73
Right 994187369 5:96830207-96830229 CCAGCTTGTGGTCCCCAAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 136
994187363_994187369 29 Left 994187363 5:96830155-96830177 CCAGCTGTAAGGATAAACCTAGA 0: 1
1: 0
2: 0
3: 5
4: 94
Right 994187369 5:96830207-96830229 CCAGCTTGTGGTCCCCAAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 136
994187365_994187369 12 Left 994187365 5:96830172-96830194 CCTAGAAGGAAAGTAGCCTATGT 0: 1
1: 1
2: 0
3: 13
4: 171
Right 994187369 5:96830207-96830229 CCAGCTTGTGGTCCCCAAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 136
994187366_994187369 -4 Left 994187366 5:96830188-96830210 CCTATGTACAGACTGCAGACCAG 0: 1
1: 0
2: 2
3: 5
4: 113
Right 994187369 5:96830207-96830229 CCAGCTTGTGGTCCCCAAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994187369 Original CRISPR CCAGCTTGTGGTCCCCAAGC TGG Intronic
902487361 1:16757946-16757968 CCAGCTTGTCCTGCTCAAGCTGG - Intronic
906109104 1:43311720-43311742 CCAGCTTGTGGTCTCCCCGCTGG + Exonic
906409767 1:45569091-45569113 CCAGCTTCTGCTCACAAAGCTGG + Intronic
906561895 1:46764401-46764423 TCAGCCTGTGGCCCCTAAGCTGG + Intronic
906961447 1:50421613-50421635 CCAGCTTGGGTTCCTCAAGGCGG - Intronic
908056112 1:60289133-60289155 CCAGGTTTAGGTACCCAAGCTGG - Intergenic
914232218 1:145773919-145773941 ACAGCCTGTGTTCCCCATGCTGG - Intronic
915543507 1:156583103-156583125 CAGCCTTGTGGTCCCCCAGCTGG - Exonic
916072018 1:161176000-161176022 CCTGCTTGTGGGCTCCCAGCTGG - Exonic
916504597 1:165416728-165416750 CCAGATGGTGATCCCCAAACTGG - Intronic
1063160156 10:3412943-3412965 CCAGCCTGGGGTCCCCTAACGGG + Intergenic
1064228285 10:13506501-13506523 CCTGCATGTGGTGCCCTAGCAGG - Intronic
1066388920 10:34963343-34963365 CCAGCTGGTGGCCTCCAAGATGG - Intergenic
1067753322 10:48985896-48985918 CCTGCTTCTGGGCCCCAGGCAGG - Intergenic
1068120540 10:52779167-52779189 CCAGCCTCTGGGCCCAAAGCCGG - Intergenic
1070195345 10:74151445-74151467 CCTGCGTGTTGGCCCCAAGCTGG - Intronic
1070871404 10:79756889-79756911 TCTGCTTGGGATCCCCAAGCAGG - Intergenic
1071509884 10:86254853-86254875 CCAGCCAGGGATCCCCAAGCAGG + Intronic
1071638340 10:87279097-87279119 TCTGCTTGGGATCCCCAAGCAGG - Intergenic
1071656903 10:87458855-87458877 CCTGCTTGGGGATCCCAAGCAGG - Intergenic
1071656904 10:87458855-87458877 CCTGCTTGGGATCCCCAAGCAGG + Intergenic
1073443572 10:103567591-103567613 CTTGCTTTTGTTCCCCAAGCCGG + Intronic
1076831794 10:132999096-132999118 CCAGTTTGCGGACCCCAGGCCGG + Intergenic
1077481844 11:2818649-2818671 CCAGCTGCTGGTCCCTAACCGGG + Intronic
1077877423 11:6320032-6320054 CCAGCTGGTGGCCCACAGGCCGG + Intronic
1084660954 11:70546031-70546053 CAAGCTGGTGGTACCCAAGGGGG - Intronic
1085172189 11:74458902-74458924 CCAGCTTCTGGCCTCCAGGCAGG - Intronic
1085309340 11:75506970-75506992 CAATCCTGTGGTCCCCAGGCAGG + Intronic
1086195748 11:84137028-84137050 CCAGATTGTGGTCCCAGGGCAGG + Intronic
1090403418 11:126463283-126463305 CCCGCTTGCCGTCCCGAAGCAGG + Exonic
1090496104 11:127214237-127214259 CCAGTTTGTCTTCCCCAGGCAGG - Intergenic
1092847280 12:12595438-12595460 CCAGCTTTTGTTGCCCAGGCTGG - Intergenic
1103804809 12:123563960-123563982 CCAGCCTGTGTCTCCCAAGCTGG - Intergenic
1104781025 12:131420626-131420648 ACAGCTCGGGGTCCACAAGCAGG + Intergenic
1105211274 13:18258497-18258519 CAAACTTGGGGTCCCCAAGCAGG + Intergenic
1107990288 13:45813435-45813457 AGGGCTTGTGGTCACCAAGCTGG - Intronic
1108598740 13:51972537-51972559 CAAGCTTGGGGTCACCAAGAGGG - Intronic
1110392184 13:74986789-74986811 CCAGGATGTGGTCCCAAATCAGG + Intergenic
1112853966 13:103742845-103742867 CCAGCTTGTCATCCGAAAGCAGG + Intergenic
1113542101 13:111116380-111116402 CCGGCTGGTGGTTCCCAGGCTGG + Intronic
1117658858 14:57983943-57983965 CCAGCATGTGAACCCCAAGTAGG - Intergenic
1122372630 14:101237069-101237091 TCAGCATGGGGTCCCCAAGAAGG + Intergenic
1122462567 14:101907672-101907694 CCAGTCTGCGGTCCCAAAGCTGG + Intronic
1124374232 15:29120582-29120604 CAACCTTGTGGCCCCCAGGCTGG + Exonic
1129109539 15:73329492-73329514 CCAGCCAGTGGGCCCCCAGCAGG - Intronic
1130107367 15:80939075-80939097 CCAGCTTGTCTGCCCCCAGCTGG - Intronic
1130552996 15:84903936-84903958 CCAGCATGTGGTTCCAGAGCTGG + Intronic
1131516394 15:93080440-93080462 CCTGCTTGAGGTCACCCAGCAGG + Intronic
1132295044 15:100728638-100728660 CCAGCTTTTGGTCTCCAATCTGG - Intergenic
1132721361 16:1317794-1317816 ATGGCTTGTGGTGCCCAAGCAGG + Intronic
1132931686 16:2462037-2462059 CCAGCCTGGGGTCCCCACCCTGG + Intronic
1134257506 16:12624276-12624298 TCAGTTTGTGGCCCCCAAGGAGG - Intergenic
1134892306 16:17851991-17852013 CTAGCTTGGGGCCCCCCAGCTGG + Intergenic
1135068933 16:19335426-19335448 CCAGCTTGTGAGCTCCAGGCGGG + Intergenic
1136247477 16:28984236-28984258 CCGGATTGTGGTGCCCCAGCGGG + Exonic
1137310420 16:47251359-47251381 CCAGCTTGTGAGCCCCAAAGGGG + Intronic
1141652626 16:85401623-85401645 CCAGGGTGGGGTCCCCAGGCTGG + Intergenic
1143621623 17:8084243-8084265 CTGGCTGGTGGTCCCCAGGCTGG + Intronic
1144747696 17:17626666-17626688 CCAGATCGTGGTCCCCTCGCAGG + Intergenic
1144840875 17:18184750-18184772 CCAGCTGGTGATCCAAAAGCTGG + Exonic
1147336514 17:39729714-39729736 ACAGCTGGTGTTCTCCAAGCTGG - Exonic
1150549106 17:66192343-66192365 CCAGCTTGTGGGCCCCTTGGCGG + Intergenic
1150625094 17:66836316-66836338 CCATCTTGTGTTCCCCAGGATGG - Intronic
1151319066 17:73342047-73342069 CCATCCTGTGGTCTCCAGGCAGG - Intronic
1151417746 17:73977515-73977537 CCAGCTTTTAATCCCCAAGATGG - Intergenic
1153888866 18:9493986-9494008 CCAGCTTGTGGACAGAAAGCCGG - Intronic
1155235074 18:23810880-23810902 CCAGCTTGTGGTGCTAATGCTGG + Intronic
1157552507 18:48591261-48591283 CCACCTTGTGGGTCCCAGGCTGG + Intronic
1158673917 18:59501329-59501351 CAGGCTTGTGGTTCCCAAACTGG + Intronic
1162456698 19:10789303-10789325 CCTGCCTGTGGTCACCCAGCAGG - Intronic
1164402066 19:27909594-27909616 CGGGCCTGTGGTCCCCACGCCGG + Intergenic
1164772229 19:30818343-30818365 GCAGCCTGTGTTCACCAAGCGGG + Intergenic
1166312342 19:41969877-41969899 CCAGCTTGAGCTCCCTACGCAGG + Intronic
1202703847 1_KI270713v1_random:6294-6316 CCAGCTTGTCCTGCTCAAGCTGG + Intergenic
926352579 2:12010174-12010196 ACAGCTTGTGTTCCCTCAGCTGG - Intergenic
934994958 2:98949468-98949490 CTAGCTTGTGAGCCCCAAGAGGG + Intergenic
937086776 2:119177186-119177208 CCAGCTGGTGGTAGCCATGCTGG - Intergenic
937516813 2:122664601-122664623 TCAGCTTGGGGTCCCCAACCAGG + Intergenic
942396364 2:175553887-175553909 CTATCTTGTAGTCCCCAGGCTGG + Intergenic
947453222 2:230227376-230227398 CCAGCCCATGGTCACCAAGCAGG + Intronic
948942200 2:241202241-241202263 GCAGCTGGTGGATCCCAAGCAGG - Exonic
1169217159 20:3800584-3800606 CCAGCTGGGTGTCCCCAGGCAGG + Intronic
1173269270 20:41517092-41517114 CCAGCTTCTATTCCCCAGGCTGG + Intronic
1179485359 21:41706493-41706515 CCAGCTGGAGGCCCCCAGGCAGG + Intergenic
1180764963 22:18340940-18340962 CAAACTTGGGGTCCCCAAGCAGG - Intergenic
1180814068 22:18778744-18778766 CAAACTTGGGGTCCCCAAGCAGG + Intergenic
1181200251 22:21213079-21213101 CAAACTTGGGGTCCCCAAGCAGG + Exonic
1181701486 22:24623880-24623902 CAAACTTGGGGTCCCCAAGCAGG - Exonic
1184550239 22:45200484-45200506 CTTGCCTGTGGTCACCAAGCAGG + Intronic
1185284669 22:49994928-49994950 CCAGCAGGTGGCCCCCAGGCAGG + Exonic
1203226584 22_KI270731v1_random:81845-81867 CAAACTTGGGGTCCCCAAGCAGG - Intergenic
1203264165 22_KI270734v1_random:4431-4453 CAAACTTGGGGTCCCCAAGCAGG + Intergenic
950445250 3:13033719-13033741 CCAGCCTGTGGGCACCAGGCAGG + Intronic
953994940 3:47512667-47512689 CCAGCCTGGGGTGCCCAAGACGG + Intronic
954211894 3:49102445-49102467 CCACCTTCTGGGCCCCAAGTTGG - Exonic
954297981 3:49684742-49684764 CCAGCTTGTCCTGCTCAAGCTGG - Exonic
954878662 3:53819606-53819628 CCAGCCTGGGGTCCCCCACCCGG - Exonic
958678667 3:97297063-97297085 CCATCATGTGGTCTCCAGGCAGG + Intronic
959821103 3:110736719-110736741 CCAGCCTGTGTTGCCCAGGCTGG + Intergenic
960331595 3:116366605-116366627 CTGGCATGTGGTCCCCAAGAAGG + Intronic
961168779 3:124781137-124781159 CCAGCATGTGAGCGCCAAGCAGG - Intronic
961681383 3:128602594-128602616 CCAGCTGGGGGTCCCAAAGTGGG + Intergenic
966761763 3:183425602-183425624 CCACCTTGAGGTCCCCCAGTAGG + Intronic
966888282 3:184388606-184388628 CCTGCATGGGGTCCCCCAGCTGG - Exonic
966888283 3:184388606-184388628 CCAGCTGGGGGACCCCATGCAGG + Exonic
968650108 4:1757090-1757112 CCATCTTGGGGTCACCAGGCGGG - Intergenic
969185260 4:5469717-5469739 CCAACATGTGGTCCTCTAGCAGG - Intronic
976092368 4:81471718-81471740 CCGGGCTGTGGTCCCCCAGCCGG + Intronic
978061566 4:104345613-104345635 CCAGCCTGTGGCTCCCAGGCTGG - Intergenic
978771195 4:112457845-112457867 CCAGCTTGTGTTTCCAAAACAGG - Intergenic
984155976 4:176196445-176196467 CCACCTTGTGTTGCCCAGGCTGG - Intergenic
985223875 4:187738293-187738315 CCAGTTTCTGGTCACCAAGCTGG - Intergenic
985227748 4:187780967-187780989 ACAACTTGTGATCCCCAGGCTGG + Intergenic
985645241 5:1081855-1081877 ACAGCTTGTGCGCCGCAAGCAGG + Intronic
986128368 5:4904806-4904828 CCACCTTAGGGTCCCCAGGCTGG + Intergenic
986608495 5:9545748-9545770 CGTGCTCGTGGCCCCCAAGCCGG - Exonic
990150265 5:52809751-52809773 CCATCTTGTCCTCCCCAAGTGGG + Intronic
994187368 5:96830207-96830229 CCAGCTTGGGGACCACAAGCTGG - Intronic
994187369 5:96830207-96830229 CCAGCTTGTGGTCCCCAAGCTGG + Intronic
996507600 5:124285847-124285869 CCAGCTTGATCTCTCCAAGCTGG + Intergenic
997258431 5:132446917-132446939 CCAGCTTATTCTCCTCAAGCTGG - Intronic
998474869 5:142412195-142412217 ACAGCAGATGGTCCCCAAGCTGG - Intergenic
1005047784 6:21658555-21658577 CCAGGTTGTGCACACCAAGCAGG + Intergenic
1006670616 6:35727869-35727891 CAAGCCTGGGGTACCCAAGCAGG + Intronic
1007687287 6:43674395-43674417 CCAGCTGGTGGTTCCCAGACTGG - Intronic
1013251177 6:108334949-108334971 GGAGCATGTGGTCACCAAGCAGG - Intronic
1015450812 6:133364265-133364287 ACAGCTTGTGGCCCCAAAGAGGG - Intronic
1015830772 6:137366243-137366265 ACAGCTTGTTGTCCCCCAGGCGG - Intergenic
1016317331 6:142805278-142805300 ACAGCTTGTGCTCCCCATGGAGG + Intronic
1023388859 7:39687998-39688020 CCACCTTGGGCTCCCAAAGCTGG + Intronic
1026043036 7:66884871-66884893 CCAGCCTGTGTTGCCCAGGCTGG + Intergenic
1026588054 7:71673642-71673664 CCAGCCTGTGCCCCCCAGGCTGG + Intronic
1029213969 7:98931796-98931818 CCAGATTTTGGTACCCACGCAGG - Intronic
1034146040 7:148872951-148872973 CCACCTTGTCCTCCCAAAGCTGG - Intronic
1034343401 7:150371811-150371833 CCAGCTAGTTGCCCACAAGCGGG + Exonic
1038022391 8:23561550-23561572 CCTGCTTGAGGTCCCAGAGCTGG + Intronic
1048312721 8:133338133-133338155 CAAGTGTGTGCTCCCCAAGCAGG - Intergenic
1055637644 9:78294627-78294649 CCAGCTGGTTGTTGCCAAGCAGG - Intergenic
1056589115 9:87951426-87951448 CCAGCTTGTGCTACCCAGACTGG + Intergenic
1056598163 9:88024748-88024770 CCATCATGTGATCCACAAGCAGG - Intergenic
1060190545 9:121589592-121589614 TCATCAGGTGGTCCCCAAGCAGG - Intronic
1060520332 9:124290623-124290645 CCAGCCCCTGGTCCCCAAGAGGG - Intronic
1061604082 9:131695339-131695361 CCGGCTTGTCTTCCCAAAGCAGG + Intronic
1062600683 9:137317473-137317495 CGAACCTGTGGTCCCCAGGCCGG + Intronic
1062634698 9:137484710-137484732 CCAGCTTGGGCTCCCCACGGAGG - Exonic
1186812495 X:13204155-13204177 GGAGCTTGTGGTCCCCCAGAGGG - Intergenic
1192557415 X:72101564-72101586 CCAGCCTTTTCTCCCCAAGCTGG + Intergenic
1193704293 X:84802299-84802321 CCACTTTCTAGTCCCCAAGCAGG - Intergenic
1202187715 Y:22205388-22205410 CTAGCTTTTGTTTCCCAAGCTGG + Intergenic
1202203645 Y:22381008-22381030 CTAGCTTTTGTTTCCCAAGCTGG - Intronic