ID: 994195613

View in Genome Browser
Species Human (GRCh38)
Location 5:96919888-96919910
Sequence ATGGGCCTTGTGAAGAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994195613_994195617 -9 Left 994195613 5:96919888-96919910 CCCCCATTCTTCACAAGGCCCAT 0: 1
1: 0
2: 1
3: 14
4: 192
Right 994195617 5:96919902-96919924 AAGGCCCATTGAGAATTATGTGG 0: 1
1: 0
2: 0
3: 6
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994195613 Original CRISPR ATGGGCCTTGTGAAGAATGG GGG (reversed) Intronic
900311247 1:2034251-2034273 ATTGTCCTTTTGAAGAATGAGGG + Intergenic
900755033 1:4428650-4428672 AGGGGCCTGGTGAAGACTGTGGG + Intergenic
904463403 1:30693623-30693645 ATGGGCTTTGTCAGGACTGGTGG - Intergenic
905414713 1:37795809-37795831 ATGGGCGGTGTCCAGAATGGCGG - Exonic
906101984 1:43269887-43269909 ATGAGCCTTGTGAAGGAGTGTGG + Intronic
906127300 1:43434796-43434818 GTGGAGCTTGTGTAGAATGGGGG + Intronic
906448433 1:45922955-45922977 ATGGGGCTGGTGAACAATGTGGG + Intronic
906780303 1:48567415-48567437 ATGAGCCTGGTGAGGTATGGAGG + Intronic
908181987 1:61614935-61614957 ATGGGCCTTGTACAGAAAGGAGG - Intergenic
909665115 1:78123472-78123494 AAGGGCCTTGTGGATAATGAGGG + Intronic
912885553 1:113468988-113469010 ATAAGCCTTTTGAAGAATTGAGG + Intronic
913163119 1:116163267-116163289 ATAGGGCATGTCAAGAATGGAGG + Intergenic
914402314 1:147334049-147334071 AGGGGCTTTGAGCAGAATGGTGG + Intergenic
916141630 1:161705045-161705067 AGGGGCCTTCTGAAGATTTGGGG - Intergenic
918093532 1:181316956-181316978 CTGGGCCTTGTAAAGATGGGTGG + Intergenic
922324794 1:224517902-224517924 CTGGGCCTTGGGAATGATGGGGG + Intronic
922483485 1:225955762-225955784 ATCAGCCTTGTGGGGAATGGAGG + Intergenic
1064721504 10:18234207-18234229 ATGTGCTTTGTGCTGAATGGAGG + Intronic
1065139741 10:22708596-22708618 ATGAGCCCTTAGAAGAATGGTGG - Intronic
1067800523 10:49355333-49355355 AGGGGCCTTGAGAAGCAGGGTGG - Intergenic
1068325757 10:55484127-55484149 TGGGGCCTTCTGAAGAGTGGAGG + Intronic
1068536761 10:58248061-58248083 ATGCTCCTTGTGAAAAATCGGGG + Intronic
1069941950 10:71962667-71962689 AAGGGCCTTGTCCAGAATAGAGG - Intergenic
1070017830 10:72552319-72552341 ATGTTCCATGTGCAGAATGGGGG - Intronic
1070137207 10:73705416-73705438 ATTTGCCTTGTGACAAATGGAGG - Intergenic
1070760478 10:79021322-79021344 ATGGGCTTGGTCAAGAGTGGAGG - Intergenic
1075579448 10:123606037-123606059 ATGGGACCTGTGAAAAATGCAGG + Intergenic
1077661718 11:4074495-4074517 CTGGGCCTTGTGCAGCCTGGGGG - Exonic
1078889526 11:15541867-15541889 ACGGGCCTTCTGAAGGATGTGGG - Intergenic
1079015920 11:16868617-16868639 ATAGGCATTGAGAAGAAGGGAGG - Intronic
1080352530 11:31401718-31401740 ATGGCTCTTCTGGAGAATGGAGG + Intronic
1081284945 11:41256466-41256488 ATGGGCATTGTGCAGCATGGTGG - Intronic
1082646752 11:55735578-55735600 TTGGGCCTTGTGAACCCTGGAGG - Intergenic
1082891892 11:58148239-58148261 ATGGGTCTAGTGTAGAATGATGG + Intronic
1085225766 11:74919587-74919609 ATGGCTCCTGTGAAGAAGGGTGG + Intronic
1087979131 11:104589510-104589532 ATGGGCCTAGTGTAAGATGGTGG + Intergenic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1091189247 11:133676342-133676364 ATGAGACTTGAGAATAATGGAGG + Intergenic
1091302137 11:134514599-134514621 AGGGGCCTTGTGTAGACTGGTGG - Intergenic
1091836261 12:3588262-3588284 ATAGGCCTTTTGGAGAATTGAGG - Intronic
1092281796 12:7102983-7103005 TTGGGACTTGTGGAGAATGAGGG - Intronic
1092342634 12:7689726-7689748 ATGGGCATTGTTAATTATGGTGG + Intergenic
1093367835 12:18325396-18325418 ACGGGCATTGTGAAGGAAGGTGG + Intronic
1095975902 12:47941072-47941094 GTGGCCATTGAGAAGAATGGTGG + Intronic
1096395602 12:51263802-51263824 ATGGGCCTTTCGAAGCATTGTGG - Intronic
1096631294 12:52928351-52928373 AGGGGCATTGTTAAGGATGGTGG - Intronic
1100429800 12:94521172-94521194 TTGGGCCTTGTGATGCAAGGAGG - Intergenic
1101003711 12:100381295-100381317 CTGGGCATTGTGCAGAATGATGG + Intronic
1105882523 13:24616569-24616591 ATAGGCCTTGGTAAGAAAGGTGG + Intergenic
1106488439 13:30193432-30193454 AGGGTCCTAGTGAAGAAAGGAGG + Intergenic
1109595001 13:64539986-64540008 TGGGGCCTTTTGAAGAGTGGAGG - Intergenic
1109946077 13:69434003-69434025 ATTGGCCATGGGAAGAATGTTGG - Intergenic
1111874472 13:93875880-93875902 ATGGGTCTTGTGAGGAAGGCTGG + Intronic
1112286799 13:98111774-98111796 AAGGCCCTTGTGCAGAATGAGGG + Intergenic
1112786809 13:102960415-102960437 ATGGGGGATGTGAAGAATAGAGG + Intergenic
1116477822 14:45362207-45362229 ATGGTCCTTGTGTATGATGGTGG - Intergenic
1119371431 14:74147802-74147824 ATGGGGGTTGGGAGGAATGGGGG + Intronic
1119407093 14:74405743-74405765 ATGGGCCTTAGGAGGAGTGGTGG - Intergenic
1120483895 14:85086109-85086131 ATGGGCATATAGAAGAATGGAGG - Intergenic
1120566894 14:86071248-86071270 AAGGGCTATGTGAAGAATGCGGG - Intergenic
1120701470 14:87703756-87703778 CTGAGCCATGAGAAGAATGGTGG + Intergenic
1121204978 14:92156771-92156793 AAGAGACTTGTGAAGTATGGTGG + Intronic
1127166457 15:56248938-56248960 ATGTGCCTTGAAAGGAATGGAGG - Intronic
1127483820 15:59401300-59401322 TTGGGCCTTGTGATGCAAGGCGG - Intronic
1128702717 15:69815868-69815890 CTGGGGCCTGTGTAGAATGGAGG - Intergenic
1130034232 15:80342781-80342803 ATGGGGCTGGGGAAGTATGGAGG - Intergenic
1131031263 15:89187897-89187919 ACGGGCCTTGTGGTGAGTGGTGG - Intronic
1133300475 16:4779419-4779441 TTGGGCATTGTGCAAAATGGTGG + Intronic
1135222880 16:20628273-20628295 ATGGGACATCTGAAGACTGGTGG - Intronic
1135477039 16:22785916-22785938 AATGGCCTTATAAAGAATGGGGG - Intergenic
1137520340 16:49189784-49189806 ATGGGCCTTGATAAGAATAAAGG - Intergenic
1138440269 16:57030114-57030136 ATGGGCCTTGAGAAAAGAGGAGG + Intronic
1139776873 16:69321881-69321903 ATGAGCCTTGTGGACATTGGGGG + Intronic
1139948920 16:70659891-70659913 ATGGGCCCTGGGTAGAGTGGGGG + Intronic
1143011629 17:3869335-3869357 ATGGGCCTCCAGCAGAATGGCGG + Intronic
1143769077 17:9156434-9156456 CTGGGCCATGTGAAGTCTGGGGG + Intronic
1146202871 17:30875256-30875278 ATGGGGCTTTTGGAGAATAGAGG + Intronic
1146443085 17:32914042-32914064 AGGAGCCTTGGGAATAATGGGGG + Intergenic
1146501375 17:33367739-33367761 GTGGTCCTTGTTAACAATGGTGG - Intronic
1148483330 17:47974759-47974781 TTCTGCCTTGTGTAGAATGGGGG - Intronic
1149958300 17:61078226-61078248 ATGGGCTTCTTGAAGAATGTGGG + Intronic
1150714387 17:67559128-67559150 ACGGGGCTTGGGAGGAATGGGGG - Intronic
1151469016 17:74306292-74306314 ATGGGCCCTAAGAAGAATGGAGG - Intronic
1154009437 18:10562476-10562498 ATGAGCCTTCTGAAGAATCGAGG + Intergenic
1155324678 18:24653828-24653850 CTGGCCCTTGAGAAGAATGTGGG - Intergenic
1155693243 18:28652635-28652657 ATCTGCATTGAGAAGAATGGAGG + Intergenic
1157567319 18:48688356-48688378 ATGGGGCTGGTGAAGAAGAGAGG + Intronic
1158102782 18:53849161-53849183 ATGTGTAATGTGAAGAATGGGGG + Intergenic
1163904456 19:20138973-20138995 ATGAGCTTTATGAAGAAAGGTGG + Intergenic
1163909258 19:20175135-20175157 ATGAGCATTATGAAGAAAGGTGG - Intronic
1163913952 19:20222320-20222342 ATGAGCATTATGAAGAAAGGGGG + Intergenic
1163926681 19:20351937-20351959 ATGAGCATTATGAAGAAAGGGGG + Intergenic
1163930185 19:20382524-20382546 ATGAGCATTATGAAGAAAGGGGG - Intergenic
1164758589 19:30709548-30709570 ATGGTCTTTGTGCAGAATTGGGG + Intronic
1166250877 19:41570099-41570121 ATGGCCATTCTGAAGACTGGGGG + Intronic
1167743695 19:51339221-51339243 GTGGGGCTAGTGAAGAAGGGTGG - Intronic
929120631 2:38481217-38481239 AAGAGCCTTCTGAAAAATGGAGG + Intergenic
929899139 2:45986432-45986454 ATGGGCCTTGGGGAGAATGATGG + Intronic
929939738 2:46324397-46324419 ATGGGCCTTGCTAAGAACTGTGG - Intronic
931922209 2:67032972-67032994 ATAGGTCTTGTGAAAAATGATGG + Intergenic
932284495 2:70520811-70520833 ACAGGCCTTGTGGAGAGTGGTGG - Intronic
932685433 2:73865179-73865201 ATTGGGGTTGAGAAGAATGGAGG + Exonic
933946818 2:87294053-87294075 ATGGGCATTGTCAGGGATGGTGG - Intergenic
935307732 2:101753924-101753946 ATGGCCCTTGTCCAGAAGGGTGG + Intronic
937989503 2:127654427-127654449 CTGGGCTTTGTGAAGAATGCCGG - Exonic
939529674 2:143342014-143342036 ATGGGCATTGTGAAGAATATTGG - Intronic
941025696 2:160453795-160453817 AGGGTGCTTGTGAAGAAGGGTGG - Intronic
942438483 2:176006117-176006139 ATGGGCCTTGATAAGAATGGTGG - Intergenic
943825345 2:192384322-192384344 AGGGGCCTTTTGGAGAGTGGGGG - Intergenic
944094985 2:195955627-195955649 TTGGGCCTTGTAAATAAAGGAGG - Intronic
945462171 2:210121483-210121505 TGGGGCCTTTTGGAGAATGGAGG + Intronic
947186299 2:227458610-227458632 CTGGCCTTTGTGGAGAATGGAGG + Intergenic
948655540 2:239474808-239474830 ATAGGACTTGTGATGAATTGAGG + Intergenic
1168990957 20:2095381-2095403 AGGGGCCATGGAAAGAATGGTGG - Intergenic
1170533443 20:17316708-17316730 ATGGGGCTGGTGGAGAAAGGAGG - Intronic
1171006409 20:21469878-21469900 GTGGGCTTTGTAAAGAATTGGGG + Intergenic
1172145182 20:32752534-32752556 ATGGACGTCGTGAAGATTGGAGG + Intergenic
1173521801 20:43705415-43705437 ATGGGCCTTGGGACCACTGGTGG + Intronic
1173878488 20:46392449-46392471 ATGGGCCTTAAGAAGAAGGTTGG - Intronic
1174304021 20:49602538-49602560 CTGGGCCTTGTGGAGAAATGAGG - Intergenic
1176387709 21:6147232-6147254 AATGGCCTTGTGAGGACTGGAGG + Intergenic
1177741831 21:25164008-25164030 TGGGGCCTTTTGGAGAATGGAGG - Intergenic
1179735763 21:43391016-43391038 AATGGCCTTGTGAGGACTGGAGG - Intergenic
1181467343 22:23117323-23117345 ATGGCCGATGTGATGAATGGTGG - Intronic
1183238196 22:36636133-36636155 GTGGGCCATGTTAAGAATGTTGG - Intronic
1184372668 22:44092545-44092567 ATTGTCCTTATGAAGGATGGAGG + Intronic
1184864865 22:47196432-47196454 AGGGACCTTGTGAAGAAGGAAGG + Intergenic
950702776 3:14761644-14761666 ATGGGCCTGGGGAGGTATGGAGG + Intronic
950948309 3:16974086-16974108 ATGGGCCTTGGGAAGTATCAGGG + Intronic
951072964 3:18353398-18353420 AAGGGCCCTGGGAAGAAAGGAGG - Intronic
951204580 3:19911821-19911843 ATTGGCCTTGCCAAGCATGGTGG + Intronic
952514638 3:34091551-34091573 ATGGGGCTTGTGAAGACTAGAGG - Intergenic
953202685 3:40791416-40791438 ATGAGGCTTGTGCAGAATGCTGG - Intergenic
954192624 3:48974832-48974854 ATCTGCATTGAGAAGAATGGAGG + Exonic
954713769 3:52517199-52517221 ATGGGACTTGTGGGGACTGGGGG + Intronic
959002692 3:100982766-100982788 ATGGGCCTGGAGAGGAATGGAGG + Intronic
959055552 3:101564074-101564096 CTGGGCTTAGTGTAGAATGGAGG + Intronic
959346194 3:105197625-105197647 AGGGGTCTTGTAAAGAATGATGG + Intergenic
962008358 3:131370198-131370220 AAGGGCCTTTTGAGGAAGGGAGG + Intergenic
962630153 3:137267575-137267597 TTTAGCCTTGTGAAGTATGGAGG - Intergenic
964700963 3:159565854-159565876 ATGAGGCATGTGAAGAATGCTGG - Intronic
966459543 3:180160893-180160915 ATTGGCCTTGGGAAGAATTTTGG - Intergenic
966656523 3:182364607-182364629 ATGGACCTTGAGAAGAACTGGGG - Intergenic
968396640 4:244375-244397 AGGGGACTAGGGAAGAATGGAGG + Intergenic
968650417 4:1758163-1758185 ATGGGCCTTCTGATGAAAGCGGG + Intergenic
971507965 4:27386969-27386991 AAGAGCCTTGTGAGGAATGCAGG + Intergenic
975405902 4:73989196-73989218 ATGGTCATTAAGAAGAATGGGGG - Intergenic
979157569 4:117416638-117416660 ATGGCCTTTGTGTAGAATGCTGG + Intergenic
980181747 4:129409733-129409755 ATGGGACTTCTGAGGCATGGTGG + Intergenic
980238954 4:130147839-130147861 ATGGGCTTTGTGAAAAAAGCTGG - Intergenic
980923972 4:139115568-139115590 ATGAGGCCTGTGAAAAATGGAGG - Intronic
981313267 4:143317196-143317218 ATGACCCTTTTGTAGAATGGAGG - Intergenic
981578870 4:146232414-146232436 ATGGGTCTGCTGAAGAATGTGGG + Intergenic
981630355 4:146811207-146811229 ATGGCTCTTATGAAGCATGGGGG + Intronic
985349114 4:189038792-189038814 GTGGGCCTTTTGAGGAATGAAGG - Intergenic
985830968 5:2229559-2229581 GTGGGCCTTGGGAAGAGAGGAGG - Intergenic
987056720 5:14200228-14200250 AAGGGCCCTGAGAAGGATGGAGG - Intronic
987492557 5:18599067-18599089 AAGGGCTTTGAGGAGAATGGAGG + Intergenic
989652536 5:43709252-43709274 ATGGACTTTGAGAAGAATTGAGG + Intergenic
993150889 5:84160995-84161017 TAGGGGCTTGTGAAGAAGGGTGG - Intronic
994195613 5:96919888-96919910 ATGGGCCTTGTGAAGAATGGGGG - Intronic
994980452 5:106868430-106868452 AAGGGCCTAGTGAATAGTGGAGG + Intergenic
996230433 5:121057416-121057438 CTGAGCCTTGTGAGAAATGGTGG - Intergenic
996975110 5:129423496-129423518 ATGGGACCTGTGGAGAATGATGG + Intergenic
997652594 5:135533637-135533659 ATGGGGGTTGAGAAGAATGCAGG + Intergenic
998211920 5:140206086-140206108 ATGTGCCTGGTGAGGAAGGGAGG - Intronic
998871838 5:146560446-146560468 ATGGGCCTAGAGATGAATGGGGG - Intergenic
1001755298 5:174163965-174163987 ATGGTCATTGTGGAGGATGGAGG + Intronic
1004186842 6:13428350-13428372 CTGGGCCGTGTGAAAACTGGGGG + Intronic
1005746491 6:28842954-28842976 AAGGGCATTCTCAAGAATGGTGG + Intergenic
1008493308 6:52108126-52108148 AAGGGCCTTCTGGAGAGTGGTGG - Intergenic
1009719845 6:67454376-67454398 ATGATCCTTGAGAAGAATTGTGG + Intergenic
1010254639 6:73743958-73743980 CGGGGCCTTTGGAAGAATGGAGG - Intronic
1010634512 6:78240902-78240924 ATGGGCATCTTGAAAAATGGTGG + Intergenic
1014630932 6:123789327-123789349 AGGAGCCTGGTGGAGAATGGAGG - Intergenic
1015563774 6:134544343-134544365 ATGGGGTTTGGGAAGAATGGAGG - Intergenic
1017112013 6:150941154-150941176 GCCGGCCTTGTGAAGAATGAGGG + Intronic
1018076328 6:160217345-160217367 ATGGGCTTTGTGATGAGTGCAGG + Exonic
1020192840 7:6013641-6013663 ATAGGCTAGGTGAAGAATGGTGG + Intronic
1021042280 7:15876950-15876972 ATGGGCTTTGGAAAGGATGGAGG + Intergenic
1024988091 7:55213281-55213303 CTGGGCCTTGAGCAGAATGCTGG - Intronic
1025264433 7:57443254-57443276 AGGGGCCTTGTGGGGAAGGGAGG + Intergenic
1025634772 7:63312851-63312873 AGGGGCCTTGTGGGGAAGGGAGG - Intergenic
1025647923 7:63435319-63435341 AGGGGCCTTGTGGGGAAGGGAGG + Intergenic
1027137733 7:75637161-75637183 AAGGGCCTTGAGAAGCAGGGAGG + Intronic
1028689725 7:93637979-93638001 ATAGTCCTTGTGGAAAATGGGGG + Intronic
1029363712 7:100104191-100104213 ATGGGACTTGGGAAACATGGTGG + Intronic
1029402562 7:100355064-100355086 ATGGGCCCTGTGATGGGTGGAGG + Intronic
1034213024 7:149381660-149381682 ATTGGCCCTGTAATGAATGGAGG + Intergenic
1037458127 8:19083680-19083702 ATGGGCATTGGGAACAATGGGGG - Intronic
1037943553 8:22972829-22972851 AAGGGCCTTGTGAGGAAGTGTGG - Intronic
1044450378 8:92329351-92329373 AGGGGCCTGTTGGAGAATGGTGG - Intergenic
1047307488 8:123664706-123664728 ATGGCCCCAGTGAAGAATGGAGG - Intergenic
1048509644 8:135050601-135050623 TTGGGCCTTGGGAAGGTTGGTGG + Intergenic
1048749379 8:137654133-137654155 ATGAGCGGAGTGAAGAATGGTGG - Intergenic
1050336505 9:4594906-4594928 GTGGGTGTTGAGAAGAATGGAGG - Intronic
1056495839 9:87154501-87154523 ATGGGACATGTGAAGGTTGGAGG - Intronic
1056686885 9:88773902-88773924 AAGGGTCATGTGAAGAATTGAGG - Intergenic
1057485530 9:95480059-95480081 ATGGCCCTTGTTTTGAATGGTGG - Exonic
1058744324 9:107975107-107975129 ACAGGCCTGGGGAAGAATGGTGG - Intergenic
1058747204 9:108003298-108003320 ATGGGTCTGGTGAAGGATGAAGG - Intergenic
1061494158 9:130962209-130962231 CTTGGCCTGGTGAAGGATGGCGG - Intergenic
1062433249 9:136535246-136535268 AGGGGCCTTGTGAACCCTGGGGG - Intronic
1190509677 X:51162640-51162662 AGGGGCCTTGATAAGAATGTGGG - Intergenic
1195570507 X:106394207-106394229 AGGGGCCTTATGATCAATGGAGG + Intergenic
1195885076 X:109629212-109629234 ATGGGGCTCGTGGAAAATGGGGG - Intronic
1195967964 X:110446183-110446205 ATGGGACTTGCGGGGAATGGGGG + Intronic
1200142363 X:153908477-153908499 ATGGGCCCTGTGAACACTGTCGG - Intronic