ID: 994199891

View in Genome Browser
Species Human (GRCh38)
Location 5:96961245-96961267
Sequence AACCGCTTTCCCATACTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994199891_994199893 6 Left 994199891 5:96961245-96961267 CCTGTAAGTATGGGAAAGCGGTT 0: 1
1: 0
2: 0
3: 1
4: 52
Right 994199893 5:96961274-96961296 AAAATCACCAGACAGAATTTGGG 0: 1
1: 0
2: 0
3: 31
4: 300
994199891_994199892 5 Left 994199891 5:96961245-96961267 CCTGTAAGTATGGGAAAGCGGTT 0: 1
1: 0
2: 0
3: 1
4: 52
Right 994199892 5:96961273-96961295 CAAAATCACCAGACAGAATTTGG 0: 1
1: 0
2: 2
3: 19
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994199891 Original CRISPR AACCGCTTTCCCATACTTAC AGG (reversed) Intronic
905877337 1:41440962-41440984 ATCAGCTTTCCCATGCTTAGTGG + Intergenic
906101189 1:43263815-43263837 CACCTCTCTCCCTTACTTACTGG + Intronic
906725972 1:48044500-48044522 AGCTGCTTTCCCATGCTAACAGG - Intergenic
915265619 1:154714856-154714878 AACCGCTCTGGCATACTCACTGG + Exonic
924021637 1:239789823-239789845 AACCGCTTTCCCAGCCACACTGG + Intronic
1072265267 10:93721138-93721160 AACCTCTTTCCCATCTTCACTGG - Intergenic
1075482026 10:122789979-122790001 AACCACTTTCCCCTTCCTACAGG - Intergenic
1099465128 12:82975279-82975301 AACAATTTTCCCTTACTTACTGG - Intronic
1108975367 13:56436925-56436947 AACACCTTTCACATACCTACTGG + Intergenic
1112471656 13:99694943-99694965 AACCATTTTCCCATCCCTACAGG - Intronic
1115472805 14:33785679-33785701 AACAGTTTTCCCATACATGCAGG + Intronic
1119811479 14:77524250-77524272 AGCCGCCTTCCCATACTTTCTGG - Intronic
1124602034 15:31141521-31141543 CACCACTTTCTCCTACTTACTGG - Intronic
1124692328 15:31834761-31834783 AACCACTTTTACATACTTCCTGG - Intronic
1136672585 16:31872262-31872284 AACCCCTTTCCCACACTGAAGGG - Intergenic
1143236432 17:5405220-5405242 AACAGCTTTCCAATATTTCCAGG + Exonic
1143292809 17:5844436-5844458 AACTGCTTTCAGATACTTGCTGG - Intronic
1150177161 17:63070473-63070495 AGCCGCCTTCTCATCCTTACTGG + Intronic
1153999428 18:10471471-10471493 AATCTCTTTCCCATACCTTCAGG + Intronic
1159206094 18:65254845-65254867 AAAAGCTTTCTCACACTTACTGG - Intergenic
1165002868 19:32779344-32779366 AACCGCTTACTGGTACTTACAGG - Intronic
1165329784 19:35135163-35135185 AACCCCTTTCCCAAACCTTCGGG - Exonic
937477450 2:122227983-122228005 AACTTCTTTCCCAAAGTTACAGG - Intergenic
938881875 2:135598573-135598595 ATCCTGTTTTCCATACTTACTGG + Intronic
941285042 2:163600950-163600972 AACTGCTTTCAAATATTTACAGG - Intronic
941516401 2:166485707-166485729 GACCACTTTCCCAGAGTTACTGG - Intronic
942063623 2:172250190-172250212 AAGCACTTTCTCATATTTACTGG + Intergenic
946324018 2:218973839-218973861 AACCTCTTTCACATCCTTAGTGG + Intergenic
947143819 2:227045112-227045134 AGACATTTTCCCATACTTACTGG - Intronic
948820776 2:240544117-240544139 CATCTCTTTCCCCTACTTACTGG - Intronic
1181423057 22:22815121-22815143 AACAGCTTTTCCATACTCTCAGG + Intronic
1181832753 22:25575392-25575414 ACCCTCTTTCCCTTACTTTCAGG + Intronic
950543844 3:13627413-13627435 AGCCGCTGTCCCACACTTGCAGG - Intronic
958169521 3:89921046-89921068 CATCTCTTTCCCCTACTTACTGG + Intergenic
958852158 3:99341186-99341208 AACCCCTTACCCATACATAGGGG - Intergenic
964695603 3:159504503-159504525 AACTGCCTTCCCAGACTTATTGG - Intronic
967930736 3:194688245-194688267 GACCGCTTTCCCCTACCTCCCGG + Exonic
968730158 4:2265734-2265756 AGCCTCTTTCCCACACTTCCAGG + Intergenic
994199891 5:96961245-96961267 AACCGCTTTCCCATACTTACAGG - Intronic
996623259 5:125536933-125536955 CACAGCTTACCAATACTTACAGG + Intergenic
996746341 5:126849438-126849460 AACTGCTTTCACCTACTTGCTGG - Intergenic
1000035179 5:157441609-157441631 AACCACTTTCACATACTCAAAGG + Intronic
1003794349 6:9583300-9583322 AACCGTTTTCAAATACTTTCTGG - Intergenic
1004755969 6:18610549-18610571 AACCTGGTTCTCATACTTACTGG + Intergenic
1011388965 6:86829976-86829998 AATAGCTTTCCCATGCTTAAAGG + Intergenic
1012711650 6:102614749-102614771 CACATCTCTCCCATACTTACTGG - Intergenic
1016408567 6:143757555-143757577 AAGCTGTTTCCCATACTTCCAGG - Intronic
1027872455 7:83725992-83726014 CACCGCTTTCCCATAACTAAAGG - Intergenic
1030895548 7:115055171-115055193 AATAGCTTTGCCATATTTACTGG + Intergenic
1034477469 7:151294216-151294238 TACCTCTTTCCCAGACTTCCTGG + Intergenic
1034962910 7:155373553-155373575 AACCGCTTTCGCTTCCTTGCGGG + Intergenic
1058286142 9:103181366-103181388 AACAGTTTTCACACACTTACAGG + Intergenic
1186842866 X:13502342-13502364 CATCTCTTTCCCCTACTTACTGG - Intergenic
1200325821 X:155237684-155237706 AATGACTTTCCCATATTTACAGG + Intronic