ID: 994200079

View in Genome Browser
Species Human (GRCh38)
Location 5:96963598-96963620
Sequence GTCCAATCCTAGGCTTTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 1, 2: 2, 3: 20, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994200079_994200083 29 Left 994200079 5:96963598-96963620 CCTCTTAAAGCCTAGGATTGGAC 0: 1
1: 1
2: 2
3: 20
4: 110
Right 994200083 5:96963650-96963672 ATTGATTAAAGCAAGTTACAAGG 0: 1
1: 2
2: 30
3: 188
4: 811

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994200079 Original CRISPR GTCCAATCCTAGGCTTTAAG AGG (reversed) Intronic
901574153 1:10186434-10186456 TTCCAAGCCTAGGCTGTAAAAGG - Intergenic
904429458 1:30452631-30452653 GTCCAATCCTCAACATTAAGAGG - Intergenic
908071793 1:60468559-60468581 GTCCAAGCCCAGGACTTAAGAGG - Intergenic
911171116 1:94772019-94772041 ATTCAATCCTTGGCCTTAAGTGG - Intergenic
912389333 1:109291255-109291277 GTCCAGGCCTGGGCCTTAAGAGG - Intergenic
913154088 1:116077371-116077393 GTCCAAGCCTTGGCTTCATGAGG - Intergenic
916057835 1:161080220-161080242 ATACAATCCTAGGCTGCAAGAGG - Intronic
917297650 1:173538487-173538509 GTATAGTCCAAGGCTTTAAGGGG + Intronic
917754403 1:178084725-178084747 GGCAAATCCTAGCCTTGAAGTGG - Intergenic
1068492703 10:57743830-57743852 TTCCAAGCCTAGGCCTCAAGAGG + Intergenic
1076559231 10:131350276-131350298 GCCCCATCCCAGGCTTTGAGGGG + Intergenic
1079915407 11:26363672-26363694 GTCCACGCCTATGCTTTATGAGG + Intronic
1080423957 11:32139091-32139113 TTCCAACTCTAGGCTTCAAGAGG + Intergenic
1080899814 11:36479023-36479045 GTCCAATTCTAGGCTGAAATGGG + Intergenic
1081097646 11:38958824-38958846 GAGCAATCCTAGGCTTGCAGTGG - Intergenic
1081133170 11:39405238-39405260 TTCTAATTCTAGGATTTAAGTGG - Intergenic
1081837451 11:46167825-46167847 GTTCAATGGTAGGCTTGAAGAGG - Intergenic
1083183957 11:61007000-61007022 GTACAATCCTGGGCTAAAAGGGG + Intronic
1084760671 11:71268722-71268744 GTCCAAGCCCAGGCTTTGGGAGG + Intergenic
1084941774 11:72616945-72616967 GTCCAATCCCAAGCTTGATGGGG + Intronic
1086095185 11:83043157-83043179 TTCCAAGCCTAGGCCTTAAAAGG + Intronic
1088564749 11:111157824-111157846 GTCCAAACCCAGTCTGTAAGTGG + Intergenic
1088586939 11:111367663-111367685 GTCCAAGCCCAGACTTTAACTGG - Intronic
1088729293 11:112666690-112666712 TTCCAGTCCTAGGCCTTAAGGGG - Intergenic
1089837740 11:121386220-121386242 GTCCAAGCCTAGGCATTAAAGGG + Intergenic
1090901089 11:131032123-131032145 GTCCAAACCTCAGATTTAAGTGG - Intergenic
1092365404 12:7872918-7872940 GTCGAATCCTAGGCTTTTCGAGG - Intronic
1092383614 12:8018799-8018821 GTCGAATCCTAGGCTTTTCGAGG - Intergenic
1094773866 12:33698373-33698395 GTCTATTTCTAGGCTTTAAATGG + Intergenic
1099471206 12:83051041-83051063 CTCAAAGCCTAGGCTTTGAGAGG + Intronic
1101502540 12:105317453-105317475 GTCCATCCCTGGGCTTAAAGAGG + Intronic
1103521914 12:121541712-121541734 GGCCAAACCTATGCTTTATGTGG + Intronic
1105307634 13:19180316-19180338 TTACACTCCTAGGCTTCAAGGGG - Intronic
1107933518 13:45326000-45326022 TTCCAGGCCTAGGCTTCAAGGGG - Intergenic
1107979557 13:45721425-45721447 TTCCAAGCCTAGGATTCAAGAGG - Intergenic
1108242580 13:48481983-48482005 ATCCATTCCTAGCCTTTAAGGGG + Exonic
1108441666 13:50459573-50459595 TTCTAAGCCTAGGCCTTAAGGGG + Intronic
1110238608 13:73242500-73242522 TTCCAATTCTAGGTGTTAAGAGG + Intergenic
1113184579 13:107673326-107673348 CTCCAATCCCTGGCTATAAGAGG - Intronic
1115584272 14:34794466-34794488 TTCCAGGCCTAGGCTTTAAGAGG + Intronic
1120113145 14:80581971-80581993 GTCCAGACTGAGGCTTTAAGAGG + Intronic
1122163989 14:99807530-99807552 GTCCCACCCTAGGCCTGAAGGGG + Intronic
1122345028 14:101053397-101053419 GTCCACTGCTAGGTTTTATGGGG + Intergenic
1130885013 15:88085381-88085403 TTCCAAGCCAAGGTTTTAAGAGG + Intronic
1133838775 16:9389615-9389637 TTCCAACTCTAGGCCTTAAGGGG + Intergenic
1139828390 16:69776111-69776133 GTCAAATCCTAGTCTTTTAGTGG + Intronic
1140401075 16:74672100-74672122 TTCCAAGCCTAGGTTTCAAGAGG - Exonic
1141808204 16:86356139-86356161 TTCCAAGCCCAGGCCTTAAGGGG - Intergenic
1146036635 17:29412627-29412649 GTCCTATGCTAGGCATTAAATGG - Intronic
1146743597 17:35307715-35307737 GTCTAGTCCTGGGCTTTTAGTGG - Intergenic
1148579675 17:48734854-48734876 CTCCAAACCTGGGCTTTAATGGG + Intergenic
1150966231 17:69972354-69972376 TTCCAGGCCTAGGCCTTAAGTGG - Intergenic
1153796589 18:8629234-8629256 CTCTAATCCTAGGCATTTAGGGG - Intronic
1155967443 18:32049273-32049295 GTTAAATCCTAGGCTTTAAAGGG + Intronic
1158578819 18:58663438-58663460 GGCCACTCTTAGGTTTTAAGAGG - Intergenic
1159069603 18:63608605-63608627 ATCAAATCCTAGGCTTTAATGGG - Intergenic
1159373418 18:67559548-67559570 TTCCATTGCTAGGTTTTAAGAGG + Intergenic
1160052826 18:75452390-75452412 TTCTAATCCTAGACTTTAAGAGG - Intergenic
1163238096 19:16041429-16041451 GTCCAAGCCTGGGCTGTATGTGG - Intergenic
1164551308 19:29214725-29214747 GTCAAAGCCTAGGCCCTAAGGGG - Intergenic
932913110 2:75825838-75825860 ATCCAGTCCTAGGCTTTTGGGGG - Intergenic
933498729 2:83085364-83085386 TTCCAATCGTAAGCTTTGAGTGG - Intergenic
936076971 2:109407827-109407849 TACCAATCCTGGCCTTTAAGTGG + Intronic
936501184 2:113067630-113067652 GCTCCATCCTAGGCTTGAAGAGG - Intergenic
938452100 2:131430446-131430468 TTCCAATTCCAGGCTTTGAGAGG + Intergenic
939356609 2:141110886-141110908 TACCAACTCTAGGCTTTAAGTGG + Intronic
945622113 2:212152901-212152923 TTCTAAGCCTAGGCATTAAGAGG + Intronic
1169502199 20:6171487-6171509 CTCCAAGCCTAGGCCTCAAGAGG - Intergenic
1169576312 20:6965786-6965808 TTCCAAGCCTAGGCTTCAAAGGG + Intergenic
1170805345 20:19625107-19625129 TTCCAAGCCTAGGTTTTAAAAGG - Intronic
1177034795 21:16028258-16028280 TTCCAAACCTAGGTCTTAAGAGG + Intergenic
1182104115 22:27676913-27676935 TACCAAGCCTAGGTTTTAAGAGG - Intergenic
1182147373 22:28004950-28004972 GTTCAACCCTAAGCCTTAAGAGG - Intronic
1182583934 22:31332236-31332258 TTTAAATTCTAGGCTTTAAGTGG - Intronic
1184874261 22:47263170-47263192 TTCCAAGCCTAGGCCTGAAGAGG + Intergenic
950052086 3:9999866-9999888 CTTCAATCCTAGCCTTTAAGAGG + Intronic
950925950 3:16742172-16742194 TTCCAGGCCTAGGCCTTAAGAGG - Intergenic
951015707 3:17730365-17730387 TTCCTAGCCTAGCCTTTAAGGGG + Intronic
951793107 3:26508301-26508323 GTTCCAGCCTAGGCTTTAAGAGG - Intergenic
951948671 3:28173068-28173090 TTCCAATCCTAGGCCTGAAGGGG + Intergenic
952190617 3:31019135-31019157 TTCCAAGCCTAGTCTTTAAGAGG - Intergenic
952711975 3:36440555-36440577 TTCCAAGCCCAGGCCTTAAGAGG - Intronic
953186017 3:40639052-40639074 TTCCAAGCCTAGGCCTTAAGAGG + Intergenic
955593448 3:60562511-60562533 CCCCACTCCTAGGTTTTAAGAGG + Intronic
961484194 3:127206194-127206216 GTCCAACCCTCAGCTCTAAGAGG + Intergenic
961916200 3:130377613-130377635 GTCCCATCCTAGACTTTTAGAGG + Intronic
967620251 3:191624708-191624730 TTCCAAGCTTAGCCTTTAAGAGG - Intergenic
967833923 3:193945017-193945039 GTCCAAACCAAGCCTCTAAGTGG + Intergenic
969959839 4:10933301-10933323 GTCTGAGCCTAGGCCTTAAGAGG - Intergenic
972246736 4:37252815-37252837 TTCCAAGCCCAGGCCTTAAGAGG - Intronic
973183899 4:47300337-47300359 TATCAGTCCTAGGCTTTAAGAGG + Intronic
982189109 4:152835281-152835303 ATCCAATCTTAGGCTGTTAGAGG + Intronic
983225090 4:165078497-165078519 GTATAATCCAAGGCTTTAAAAGG + Exonic
985678566 5:1244536-1244558 GTCCGATCCTCGGCTTGGAGTGG + Intronic
986902908 5:12459055-12459077 TTCTAAGGCTAGGCTTTAAGTGG - Intergenic
987178549 5:15342228-15342250 TTCCAATCCAAGGCTTCATGAGG + Intergenic
989118252 5:37977681-37977703 CTCAAATCCCAGACTTTAAGTGG + Intergenic
992555456 5:77898697-77898719 CTCCAAGCCTAGGTCTTAAGAGG - Intergenic
994200079 5:96963598-96963620 GTCCAATCCTAGGCTTTAAGAGG - Intronic
995316865 5:110784487-110784509 GTCCATTTCTTTGCTTTAAGAGG + Intergenic
1003214396 6:4095824-4095846 TTCCCACCCTTGGCTTTAAGGGG - Intronic
1005169785 6:22969561-22969583 ATCCAAGCCTAGACTTTGAGGGG - Intergenic
1005618984 6:27602535-27602557 CCCCAATCCTAGGATTAAAGGGG + Intergenic
1006481858 6:34301450-34301472 GTCCAAGCCTAGGCCTCAAGAGG + Intronic
1007403487 6:41618222-41618244 GTTCCAGCCTGGGCTTTAAGAGG - Intergenic
1010426699 6:75735675-75735697 TTCTGATGCTAGGCTTTAAGAGG + Intergenic
1012341878 6:98136596-98136618 GTGAAATGCTAGGCTCTAAGAGG + Intergenic
1012588512 6:100950833-100950855 GTCCCATCCCAGGTGTTAAGGGG - Intergenic
1012916978 6:105180511-105180533 CTGCAATCCTAAGCTTTAGGAGG - Intergenic
1015531276 6:134223431-134223453 ATCCACTCCTAGGCTGTATGGGG + Intronic
1016814678 6:148292732-148292754 GTTCAATGCCAGGCTTTAAAAGG + Intronic
1026123989 7:67563359-67563381 GTCCAAGCCTAGGCTTTAAGAGG - Intergenic
1031512962 7:122671491-122671513 GGCCAAGCCTAGGAGTTAAGAGG + Intronic
1035682146 8:1495925-1495947 GGCCAATCCTTGGCTGTCAGAGG - Intergenic
1037808967 8:22074887-22074909 GACCCCTCTTAGGCTTTAAGAGG - Intronic
1039172852 8:34768085-34768107 ATACAATTCTGGGCTTTAAGTGG + Intergenic
1041982045 8:63873454-63873476 GCCCAATCCTAGGCCTGAAGGGG + Intergenic
1042823806 8:72960155-72960177 GTCCAATCTGAGGTTTTAAATGG - Intergenic
1046718442 8:117592464-117592486 GTCCAAGCCTAGGCCTCAACAGG + Intergenic
1049146308 8:141003261-141003283 TTCCAAGCCTAGGCCTCAAGAGG + Intergenic
1050515808 9:6442870-6442892 GTTAAATCCTTGGTTTTAAGAGG - Intronic
1051024835 9:12595898-12595920 GTCCAAGCCTAGGTCTCAAGAGG - Intergenic
1051134421 9:13902237-13902259 GTCCAGTGCTAGGCTTTAGGAGG + Intergenic
1059071200 9:111138151-111138173 ATCCAATCCTACACTTTAAAAGG + Intergenic
1059414164 9:114153180-114153202 TCCAAATCTTAGGCTTTAAGGGG - Intergenic
1188481461 X:30640596-30640618 GGCCAAGCCTAGGCCTTAATAGG + Intergenic
1192197362 X:69037559-69037581 ATCCAAGCCTGGGCTTTAAGAGG + Intergenic
1192631850 X:72783277-72783299 GTCCAATCATAGGCTTTTAGTGG - Intronic
1192649859 X:72937524-72937546 GTCCAATCATAGGCTTTTAGTGG + Intronic
1194276845 X:91895514-91895536 GACCAATCCTAGGCATTACCAGG - Intronic
1195493840 X:105506532-105506554 TTCCAGGCCTAGTCTTTAAGAGG - Intronic
1198475436 X:136992497-136992519 TTCAAATCCTAGGCTGAAAGGGG - Intergenic
1199888584 X:152049926-152049948 GTCCAAGACTAGGATTCAAGGGG + Intergenic
1200594196 Y:5117625-5117647 GACCAATCCTAGGCATTACCAGG - Intronic