ID: 994201311

View in Genome Browser
Species Human (GRCh38)
Location 5:96979363-96979385
Sequence TGAATAGAAGCTCAGGCCTT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994201311 Original CRISPR TGAATAGAAGCTCAGGCCTT CGG Exonic
900767383 1:4514307-4514329 TGAAAGGCAGCTCAGGCCTCTGG + Intergenic
901444620 1:9300484-9300506 TGAATCGCAGTACAGGCCTTGGG + Intronic
905143664 1:35869607-35869629 TTAATAGAAGTTGGGGCCTTGGG + Intergenic
906617067 1:47240845-47240867 TGTACATAAGCTCAGTCCTTTGG + Intergenic
908024562 1:59936967-59936989 TGAATATTAGCTCAGGCATAGGG + Intergenic
908148837 1:61278487-61278509 TGATTAAAAGCTCAGGCTGTGGG + Intronic
911237729 1:95429605-95429627 GGATTAGAAGGTGAGGCCTTTGG + Intergenic
911965103 1:104358674-104358696 TGAATAAAAGTTCAGGCATTTGG - Intergenic
913998663 1:143673684-143673706 TGAATAGAAACTGAGCTCTTTGG - Intergenic
915202101 1:154238496-154238518 TGAATAGAAATTCAGGCATGGGG + Intronic
915943635 1:160134759-160134781 TGGATACAAGCTCAGGGCTGAGG - Intronic
917777967 1:178358750-178358772 GGAATAGAATCTCTGGGCTTAGG - Intronic
922161496 1:223081789-223081811 CTAATGGAAGCTCAGGCTTTTGG - Intergenic
922851020 1:228734392-228734414 TGGTTAGAAGCTCAGGCTCTGGG + Intergenic
923244162 1:232115306-232115328 TAAATTGATGCTCAAGCCTTTGG - Intergenic
1062814453 10:489506-489528 TTGATTGAAGGTCAGGCCTTGGG - Intronic
1063252862 10:4293299-4293321 TGAATACAAGCTCATGCAGTGGG - Intergenic
1064216788 10:13407078-13407100 AAAATAGAAGCTCAGGGATTAGG + Intergenic
1065468817 10:26055079-26055101 TGGATAGAAGCTGCTGCCTTAGG - Intronic
1066062708 10:31738099-31738121 AGAAGAGAACCTCTGGCCTTGGG - Intergenic
1069507570 10:69014614-69014636 TGAAAAGAAGAAAAGGCCTTGGG + Intronic
1070599457 10:77855704-77855726 TGAATACAAGCTCAGGGATCAGG + Intronic
1071181246 10:82986024-82986046 TGAATAGAAATTTAGGGCTTGGG - Intronic
1072792769 10:98330463-98330485 TGGATAAAAGCTGAGGTCTTCGG + Intergenic
1073224617 10:101907338-101907360 TGAATAGAAGCTCAGGAACTGGG + Intronic
1074954902 10:118379259-118379281 GGAAAAGAAACTCAGGCCCTTGG - Intergenic
1075555830 10:123431166-123431188 TGGTTAGGAGCTCAGGCTTTGGG + Intergenic
1076046271 10:127296649-127296671 TGTTTAGAAGCTCAGCCCTGAGG - Intronic
1078248974 11:9601689-9601711 TGAATAAGAGCTCAAACCTTAGG + Intergenic
1078917648 11:15795121-15795143 TGAAAAGAAGGTCAGGACTGGGG + Intergenic
1080554158 11:33400958-33400980 TGGACAGGAGCACAGGCCTTGGG - Intergenic
1083259231 11:61514242-61514264 TGAACAGAAGCTCTGGCCAAGGG + Intergenic
1084767551 11:71322574-71322596 TGAATAGGCGCCCAGGCCTCAGG - Intergenic
1087912035 11:103765061-103765083 TGGCTAGGAGCACAGGCCTTTGG + Intergenic
1088001723 11:104889853-104889875 TGAATAAAAAATCAGTCCTTTGG - Intergenic
1088753924 11:112869573-112869595 AGAAAAGAAGCTAAGACCTTTGG - Intergenic
1093390813 12:18618346-18618368 TCAATAGCAGCTCAGGGATTAGG - Intronic
1093785170 12:23184406-23184428 TGCCTAGAAGCCCAGCCCTTTGG + Intergenic
1094009850 12:25796036-25796058 TGAATAGATGCTGAAGTCTTAGG - Intergenic
1094198030 12:27769492-27769514 AGCAGAGAAGCTCTGGCCTTTGG - Intronic
1094556822 12:31509133-31509155 TGAATTGAAACTCAGGGCTGGGG - Intronic
1095200616 12:39379736-39379758 TTAATAGGAGCTGTGGCCTTTGG - Intronic
1095730879 12:45505626-45505648 TGAATATAAGCTGAGGCCTGTGG + Intergenic
1098115158 12:67167613-67167635 TAAACACAAGCTCAGGCATTAGG - Intergenic
1098564562 12:71918444-71918466 TGCATAGAATCTCAGGACTCTGG + Exonic
1099725446 12:86421370-86421392 TGAACTGAAGCTCATACCTTTGG + Intronic
1100116240 12:91308090-91308112 TGATTAGAAATTGAGGCCTTTGG - Intergenic
1102919971 12:116784592-116784614 TGAGAAGAAGCCCAGGCTTTGGG - Intronic
1106130227 13:26933600-26933622 TGATTGGAAGGTGAGGCCTTTGG + Intergenic
1110243782 13:73298373-73298395 AGAATAGAAGCTCACTTCTTGGG + Intergenic
1110441944 13:75536132-75536154 TGACTGTAAGCTCAGGGCTTTGG - Intronic
1115952519 14:38737230-38737252 GTACTAGAAGCTGAGGCCTTTGG + Intergenic
1119203554 14:72777090-72777112 TGAAGAGAAGCCCTGGCCTGTGG + Intronic
1119895054 14:78213139-78213161 TGGCTAGAAGCCTAGGCCTTGGG + Intergenic
1120002581 14:79319433-79319455 TGAAGAAAAGCTCAGGCTCTTGG + Intronic
1125280024 15:38033268-38033290 TAAATAGAAGCTCAGTGCTCTGG - Intergenic
1126043805 15:44619109-44619131 TGAATAGAAAATCAGGGCTAAGG + Intronic
1131277164 15:90991855-90991877 TGAGTAGAAGATTAGGACTTGGG - Intronic
1132301829 15:100780775-100780797 AGAAGAGAGGCTCATGCCTTCGG + Intergenic
1133896436 16:9933634-9933656 TCAATAGAAGCCCAGGACTCTGG - Intronic
1134307817 16:13049116-13049138 AGAATGGCAGCTCAAGCCTTTGG - Intronic
1134844809 16:17430820-17430842 TTAAAAGAAGCTCAGGCTTCAGG - Intronic
1135660062 16:24288540-24288562 TGTACAGAAGGCCAGGCCTTTGG + Intronic
1138633761 16:58320209-58320231 TGGATAAAAGCCCAGGACTTGGG - Intronic
1143916637 17:10298588-10298610 TGGACAGAAGCACAGGCTTTAGG - Intronic
1144811450 17:18002502-18002524 TAAATAGATGCTGAGCCCTTTGG - Intronic
1147995466 17:44357989-44358011 CGGATAGAAGCCCAGGCCATCGG + Intronic
1151158306 17:72142868-72142890 AGAGCAGATGCTCAGGCCTTTGG + Intergenic
1151633348 17:75326345-75326367 TGGGGAAAAGCTCAGGCCTTTGG + Intronic
1153431367 18:5021151-5021173 TGAATAGAAGCTCAACATTTAGG - Intergenic
1153449207 18:5207997-5208019 TGAAGACAAGGTCAGGCCTCAGG + Intergenic
1153806243 18:8710420-8710442 TTATGAGAAGCCCAGGCCTTTGG - Intronic
1155320392 18:24613112-24613134 TGGATGGAAGCTGAGGCCTAGGG - Intergenic
1155995480 18:32326754-32326776 TGAATAAAAGCGGAGGCATTTGG - Intronic
1158883547 18:61804429-61804451 TGATTAGAAGGTGAGGCCTTTGG - Intergenic
1159291683 18:66431365-66431387 TGAAAACAAGCACAGGACTTTGG + Intergenic
1163256327 19:16158031-16158053 TGAATAGAAGGTCTGGCACTGGG - Exonic
1164691922 19:30217657-30217679 GGGATACAAGCTCAGCCCTTGGG + Intergenic
1166036888 19:40174986-40175008 AAAAAAGAAGCTGAGGCCTTTGG - Intergenic
1166070900 19:40387113-40387135 TGCCTAGAATCTCAGGACTTTGG - Intronic
1167026812 19:46925686-46925708 TGATTAGGAGCTCAGGCTCTGGG + Intronic
928404785 2:31006427-31006449 TTAATAGAAGCACCTGCCTTGGG - Intronic
929265613 2:39915969-39915991 TGAAAAGCAGCTCAGCACTTTGG - Intergenic
933970245 2:87464185-87464207 AGAAAAGAGGCTCAGGCCTGGGG - Intergenic
936323536 2:111486311-111486333 AGAAAAGAGGCTCAGGCCTGGGG + Intergenic
936635672 2:114254250-114254272 TGAATAAAAACTCATGCATTTGG + Intergenic
937093577 2:119222528-119222550 AGAAGAGAGGCTCTGGCCTTGGG + Intergenic
937262389 2:120594966-120594988 TGAATAGAAGCTGCTCCCTTTGG + Intergenic
938662560 2:133502777-133502799 TTAATAGAAGCACAGTACTTCGG + Intronic
939391004 2:141570101-141570123 TGACTAGAAGCAGAGGCATTTGG + Intronic
948695162 2:239729589-239729611 TGAACAGCAGCTCAGCCCTTTGG + Intergenic
1170391972 20:15885002-15885024 TGATTAGAAGGTGAGGCCTTTGG - Intronic
1172119847 20:32591863-32591885 TGCAGAGAGGCTCAGGCCCTGGG - Intronic
1172749832 20:37243254-37243276 TGAATAGCAGCTCGTCCCTTTGG + Intergenic
1179239184 21:39573927-39573949 TGAATAGGAGCCCATGCGTTTGG + Intronic
1179371230 21:40807792-40807814 TGGATAGAAATTCAGGCTTTTGG - Intronic
1181690306 22:24555397-24555419 TGAATAGAGGCTCGTCCCTTCGG + Intronic
1183229852 22:36574999-36575021 TGAAGAGAGGCTTAGGCCTGAGG + Intronic
1183642081 22:39098855-39098877 AGAAAAGGAGCTCAGGCCCTCGG + Intronic
1183959733 22:41404186-41404208 AGCCTAGAAGCACAGGCCTTGGG - Intergenic
1184629309 22:45763382-45763404 TGAGTTCAAGCTGAGGCCTTTGG + Intronic
1184829351 22:46974449-46974471 TGAAGAGAGCCTGAGGCCTTAGG + Intronic
950120393 3:10478597-10478619 TGGAGAGAAGATGAGGCCTTTGG - Intronic
950448397 3:13051677-13051699 GCAACAGAAGCTCAGGCCTCAGG + Intronic
950805260 3:15597241-15597263 TAAAAAGAATCTCAGACCTTTGG - Intronic
951301212 3:20999459-20999481 TGAACAAAATCTCAGGACTTGGG - Intergenic
951560004 3:23956638-23956660 TGAATATAAGTTGAGCCCTTGGG + Intronic
952552889 3:34498965-34498987 TGTCTCAAAGCTCAGGCCTTGGG - Intergenic
952736503 3:36696745-36696767 TGAAAAGAAGATAAGGTCTTGGG - Intergenic
953310521 3:41873315-41873337 AGAATAGAAGATGAGGCCTGAGG - Intronic
954511499 3:51129730-51129752 TGAATCGTAGCGGAGGCCTTTGG - Intronic
954694455 3:52413857-52413879 TGAAAAGAAGCTGATGTCTTAGG + Intronic
954831512 3:53425196-53425218 TGAGTAGATGGCCAGGCCTTTGG + Intergenic
955939260 3:64132429-64132451 TAGATAGAAACTGAGGCCTTAGG - Intronic
956660967 3:71596757-71596779 TGAAGAGAGGCTTGGGCCTTTGG + Intergenic
958730843 3:97958714-97958736 AAAATGGAAGCTCTGGCCTTGGG - Intronic
959520962 3:107322401-107322423 TGATGAGAATGTCAGGCCTTGGG + Intergenic
960621275 3:119638886-119638908 TGAATAGGATTTCAGGCCTGAGG + Intronic
961266707 3:125648787-125648809 GGAATAAAAGATAAGGCCTTGGG + Intergenic
962722646 3:138190227-138190249 TGAATATAAACTTGGGCCTTTGG - Intronic
962812391 3:138970909-138970931 TGAGGAGGAGCTCAGCCCTTGGG + Intergenic
964203449 3:154144215-154144237 TGATTAAGAGCTCAGGCTTTGGG + Intronic
970988268 4:22183533-22183555 TTATTAGAAGGTGAGGCCTTTGG - Intergenic
974697227 4:65391544-65391566 TGAATAGATGTTCTAGCCTTTGG + Intronic
974786418 4:66624178-66624200 TGATAGGAAGCTCAGGTCTTAGG - Intergenic
978507113 4:109470595-109470617 TGTATAGAAGCTCTGCCCTAGGG + Intronic
980134769 4:128848478-128848500 GGAAAAGAAAATCAGGCCTTGGG - Intronic
981401524 4:144319563-144319585 TGATTAGAAGTTCAGGTCATAGG + Intergenic
983114255 4:163793358-163793380 TGAAGAGAATTACAGGCCTTGGG - Intronic
983693394 4:170499752-170499774 TGAATAGGAGCTCAGACATGAGG + Intergenic
984306884 4:178004521-178004543 TGAATATAAGCTATGGACTTTGG - Intergenic
986068109 5:4255901-4255923 TGCAAATATGCTCAGGCCTTTGG - Intergenic
986259920 5:6135046-6135068 TGCATAGAAGCACAGCCCTCTGG + Intergenic
987143470 5:14968234-14968256 TGAATATAAACTCAGGACTCCGG - Intergenic
993166569 5:84362599-84362621 TGAATATAAGCCCAGGCAATTGG - Intronic
993496146 5:88611272-88611294 TGACTGAAAGCTCAGGACTTTGG - Intergenic
994201311 5:96979363-96979385 TGAATAGAAGCTCAGGCCTTCGG + Exonic
997585843 5:135042798-135042820 GGAAGAGTGGCTCAGGCCTTTGG + Intronic
998959078 5:147465724-147465746 TGACTAGAAGGCCAGGCCTCTGG - Intronic
999454467 5:151703262-151703284 GGAACAGGAGCTCAGCCCTTGGG - Intergenic
1000183853 5:158839905-158839927 TGAAGAGCAGCTGAGGCCCTTGG - Intronic
1001124643 5:169008400-169008422 TGAAGAGAAGCACAGGGGTTTGG + Intronic
1004795817 6:19083110-19083132 TGAGTAGAATCTGTGGCCTTTGG - Intergenic
1007271137 6:40637989-40638011 AGAATTGGAACTCAGGCCTTTGG + Intergenic
1007761135 6:44134430-44134452 TGGATGGAAGCTCTGGCCTCTGG - Intronic
1015431491 6:133135755-133135777 TGAATGGAAGCTCAGGTAGTGGG + Intergenic
1016428632 6:143959797-143959819 TTAATAGAAGCTAATGCCTTTGG - Intronic
1018882636 6:167900423-167900445 AGAATAGTAGCTCATGCCCTGGG - Intronic
1021958102 7:25846623-25846645 TGCAAAAAAGCTCAGGCCTCAGG + Intergenic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1023549288 7:41352026-41352048 TTAAGAGAAAGTCAGGCCTTCGG - Intergenic
1026298826 7:69079440-69079462 TGAAAAGAAGCCCTGGCATTTGG - Intergenic
1026375623 7:69747484-69747506 TGAATATAAGCTCTGGACTGTGG + Intronic
1026793495 7:73350557-73350579 TGAAGAGAAGCTGAAGCCTTTGG + Intronic
1029030638 7:97462963-97462985 TGATTAGAGGCTGAGGCCTCAGG - Intergenic
1031511299 7:122653413-122653435 GAAATAGAAGAGCAGGCCTTGGG - Intronic
1032308029 7:130755109-130755131 TGAAAAGAAGCACAGTCCTGTGG - Intergenic
1033443518 7:141400959-141400981 GGAGGAGATGCTCAGGCCTTTGG - Intronic
1036719870 8:11164168-11164190 TGAATTGAAGCTGAAGCCTGTGG - Intronic
1036756994 8:11477340-11477362 TGAGGAGAAGGGCAGGCCTTAGG + Intergenic
1038199972 8:25402794-25402816 TGAAAAGAAACTCAGAGCTTTGG - Intronic
1038523887 8:28256993-28257015 TGAATATAAGGTCAGACCATGGG + Intergenic
1040777996 8:51070770-51070792 GGAATGGAACCTCAGGCCTTTGG - Intergenic
1041358858 8:57029350-57029372 TGAAGAGAAACACAGGCCTCTGG + Intergenic
1041920400 8:63176618-63176640 TGATTAGAAACTCAGTTCTTTGG + Intronic
1042814661 8:72865267-72865289 GGAATAGAATCCCAAGCCTTTGG - Intronic
1042911493 8:73832008-73832030 TGAATACAATCTCAGCGCTTTGG + Intronic
1043201088 8:77370545-77370567 TGAAGAGAAGCTCAGACCACAGG + Intergenic
1047287363 8:123499062-123499084 GGCATAGAAGGTCAGGCCTCAGG + Exonic
1048086731 8:131189145-131189167 TGAATATAAGCTCTGCACTTTGG - Intergenic
1048383274 8:133887536-133887558 TGACTTGAAGATCAGACCTTGGG + Intergenic
1048725586 8:137379946-137379968 TGTGCAGCAGCTCAGGCCTTTGG - Intergenic
1050096582 9:2073687-2073709 TGAATGTAAGCCCGGGCCTTGGG + Intronic
1050620529 9:7447565-7447587 TCAATAGAAGCTCAAAACTTAGG - Intergenic
1052374778 9:27706688-27706710 TGATTAAGAGCTCAGACCTTGGG + Intergenic
1052747200 9:32452313-32452335 GTAATAGAAGCTGGGGCCTTTGG + Exonic
1056266870 9:84905969-84905991 TGAGTGGAAGCTCAGGCTTGGGG + Intronic
1056308428 9:85315257-85315279 TGAATATCAGCTCTAGCCTTGGG - Intergenic
1056848128 9:90058045-90058067 TGAACAGAAGCCCAGGCCTTAGG + Intergenic
1059066205 9:111087416-111087438 TGAATAGCAGCTCTAGTCTTTGG - Intergenic
1062609726 9:137368560-137368582 TTAATAGCAGCTCAGGCCCGTGG - Intronic
1188176392 X:26995936-26995958 TGAATGTAAGCTCAGCACTTTGG + Intergenic
1188686532 X:33076657-33076679 TTACTAGAAGCTAAGGCTTTTGG + Intronic
1195134126 X:101886577-101886599 TGACTAGAAGCTCTGGTCTTTGG + Intronic
1198530513 X:137546886-137546908 TGAAAAGAGGCCCTGGCCTTTGG + Intergenic
1199983264 X:152932769-152932791 AGACCAGAAGCACAGGCCTTTGG - Intronic