ID: 994204539

View in Genome Browser
Species Human (GRCh38)
Location 5:97019669-97019691
Sequence CTAAAACACAAAGGCAGCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 374}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994204539 Original CRISPR CTAAAACACAAAGGCAGCAA TGG (reversed) Intronic
901361155 1:8702170-8702192 TTAAAACACAGAGGCACAAAGGG + Intronic
901655040 1:10764499-10764521 TTACAACACAAAGGCAGAAATGG + Intronic
902207138 1:14877204-14877226 CCAATACACAAAGGGAGTAACGG - Intronic
902242421 1:15097915-15097937 TTTTAACACAAAGGCAGCATGGG - Intronic
905518562 1:38580011-38580033 GGAAAACACAAGGGCAGAAAAGG + Intergenic
905937109 1:41833509-41833531 CCAAAGCACAAAGGCACGAATGG + Intronic
906114053 1:43344175-43344197 CTAAAGTACAAAGGTAGCTATGG + Intronic
907350972 1:53830460-53830482 CAAAAACAGAAAGCAAGCAAGGG + Intronic
910812617 1:91253614-91253636 CTAGAGCCCAAAGGCAACAATGG - Intergenic
911069586 1:93822071-93822093 CTCAAAGAACAAGGCAGCAAGGG + Intronic
911684068 1:100753763-100753785 CTACAGCACAAAGGCTGAAAGGG - Intergenic
912280148 1:108304497-108304519 CTAAATCCCAAAGGCAGCAATGG + Intergenic
912288078 1:108389860-108389882 CTAAATCCCAAAGGCAGCAATGG - Intronic
913301378 1:117373470-117373492 AAAAAAAACAAATGCAGCAAAGG - Intronic
913406669 1:118501580-118501602 CAAAAACACAAAGGAATCATTGG + Intergenic
913537934 1:119791973-119791995 TGAAAACATAAAGCCAGCAAGGG - Intergenic
915743811 1:158140912-158140934 ATAATACAGACAGGCAGCAAGGG + Intergenic
915955497 1:160217127-160217149 TTAAAAAACAAAGGAAGAAAAGG + Exonic
917127780 1:171705461-171705483 CTGAAATAAAAAGGCAGAAATGG + Intronic
917263063 1:173190445-173190467 CTAAAACCAACAGGCAGCATAGG + Intronic
917463346 1:175251922-175251944 CTAAAATGCAAAGACAGAAAAGG + Intergenic
917911552 1:179652402-179652424 CAACTGCACAAAGGCAGCAATGG - Intronic
918433209 1:184483885-184483907 CACACACACAAAGGCAGCAAAGG - Intronic
920703484 1:208235119-208235141 CAAAAACCCAAGGGCGGCAAAGG + Intronic
920794733 1:209128179-209128201 CTAAATAGCAAAGGCACCAAAGG + Intergenic
921629294 1:217414390-217414412 CTAAAACACAAACAGTGCAACGG - Intergenic
923439932 1:234007616-234007638 CTAAAGAGCAAAGGAAGCAAAGG - Intronic
923848214 1:237761679-237761701 CTAAAATGAAAGGGCAGCAAAGG - Intronic
923999093 1:239530874-239530896 CCAAAAGAAAAAGGCAGAAAAGG + Intronic
924246738 1:242092768-242092790 CCAAAATACAAAAGCTGCAAAGG - Intronic
924319291 1:242831236-242831258 ATAAACCAGAAAGGCAACAAGGG - Intergenic
924837858 1:247672482-247672504 CTACAGGACAAAGCCAGCAATGG + Exonic
1063223068 10:3989222-3989244 CTAAGAAGCAAAGGCAGCAGAGG - Intergenic
1063344566 10:5299086-5299108 ATAGAACAAAAAGGCAGCAGAGG + Intergenic
1063415386 10:5868945-5868967 CAAAAAGACAAAGAAAGCAAAGG + Intronic
1063474111 10:6313593-6313615 CTAATGCACAAAGGCAAGAAGGG - Intergenic
1064493863 10:15887313-15887335 CTAAAAGATAAAGCCAACAAAGG - Intergenic
1064827751 10:19424945-19424967 ATAAAAAATAAAGGCAACAAAGG + Intronic
1066069561 10:31793256-31793278 CTGAAACTCAAAGGCAAAAAAGG - Intergenic
1066446659 10:35490423-35490445 CAGAAGCACAAAGGCAGCCATGG - Intronic
1069325791 10:67230203-67230225 CAAAAACACAAAGTGAGGAAAGG + Intronic
1069811652 10:71164808-71164830 ATAAAACACAAATACAGCAATGG + Intergenic
1070443416 10:76469090-76469112 CTAAAACTCAAAAGGAACAATGG + Intronic
1070667357 10:78354614-78354636 CTAAAGCATAAACTCAGCAAAGG + Intergenic
1071166527 10:82814433-82814455 CTAAAACCCAGAGGCCGCATGGG + Intronic
1071459035 10:85874502-85874524 CAAAAGCACAAATGCAGGAAAGG - Intronic
1072275501 10:93818447-93818469 CTAAAACACACAAACAGCAGAGG - Intergenic
1073432466 10:103494973-103494995 CAAAAACCCAACGGCTGCAAAGG - Intronic
1073600931 10:104845548-104845570 CTTAAAAACAAAGTCAACAATGG - Intronic
1075176705 10:120170709-120170731 CCAAAACAAAAAAGCAGGAAAGG - Intergenic
1076241750 10:128913933-128913955 CAAAAGCACAAAGACAGAAAAGG + Intergenic
1076414331 10:130274555-130274577 CTAAAACACAAAGGAGGCATGGG - Intergenic
1078816052 11:14823434-14823456 CCAAATCCCAAAGGCAACAATGG - Intronic
1078991558 11:16652494-16652516 CAAAAACATAAAGTGAGCAAAGG + Intronic
1079117881 11:17652114-17652136 CAAAGACACAGAGGCAGGAATGG - Intergenic
1079679814 11:23281154-23281176 CCAAACCACAAAGTCAACAAAGG - Intergenic
1079714738 11:23731026-23731048 CTAACACACTACAGCAGCAAAGG + Intergenic
1080402866 11:31953752-31953774 CTTAAACATAAAGGAAACAAGGG + Intronic
1080722079 11:34859610-34859632 ATTAAACAAAAAGGCAGCATTGG - Intronic
1087393191 11:97565478-97565500 CAACAACAAAAAGGCAGCCAAGG + Intergenic
1087959775 11:104333808-104333830 GTATAACACAAAGGCAGTCAAGG - Intergenic
1088576958 11:111281564-111281586 CTAAAATACAAAATCAGCGAAGG + Intronic
1089678197 11:120104652-120104674 CTAACACCCAAAGGCACCACAGG + Intergenic
1089730067 11:120513737-120513759 CTGAAACCCAGAGGCAGCACTGG + Intronic
1090575045 11:128093216-128093238 CTAAAACAAAACGGCACAAATGG + Intergenic
1092505047 12:9090126-9090148 TTAAAACACAGAAGCAGGAACGG + Intronic
1092962774 12:13611771-13611793 CTCAAAGACAAAGACAGCCACGG + Exonic
1093251108 12:16805611-16805633 ACAAAACAAAAAGACAGCAAAGG + Intergenic
1094002004 12:25705654-25705676 CAAAAACTCAAAGGCAGGCAGGG - Intergenic
1094155150 12:27331443-27331465 CTAAAATACGAAAGCAGGAAGGG - Intergenic
1095235817 12:39794221-39794243 GAAAAACACAAAAGCAACAAAGG - Intronic
1095511731 12:42958411-42958433 CATACACACAGAGGCAGCAAGGG - Intergenic
1096812886 12:54182947-54182969 CTGAGACAGAAAGGCAGCCAGGG + Intronic
1097391204 12:59016111-59016133 TTAAAACAGAGAGGCAGTAAGGG - Intergenic
1098034232 12:66286143-66286165 CAAAAACACAAAGATAGCGAGGG + Intergenic
1098145133 12:67489987-67490009 CCAAAGCCCAAAGGCAACAATGG - Intergenic
1098419418 12:70277515-70277537 CTGAAAGACAAAAGCATCAAAGG + Intronic
1099267731 12:80468616-80468638 ATAAAACACAAAGGCAAAGAAGG - Intronic
1099618446 12:84970568-84970590 CTAAAAACCAAAGAGAGCAAGGG - Intergenic
1099770414 12:87045662-87045684 CTTAAAAACAAAAGCAGGAATGG + Intergenic
1100057190 12:90526101-90526123 CTAAACAATAAAGGCAGCACTGG + Intergenic
1100129792 12:91477589-91477611 CCAAAATACAGAGGCAGGAAGGG - Intergenic
1100411376 12:94322767-94322789 CTAGAGCCCAAAGGCAACAATGG + Intronic
1101134961 12:101733452-101733474 TTAAAACACATGGCCAGCAATGG + Intronic
1101273862 12:103177746-103177768 TTAATACACAAAAGCAGCATCGG - Intergenic
1102041215 12:109801989-109802011 CTAAGAGGCAAAGGCAGCAGGGG - Intronic
1102848082 12:116209431-116209453 TTAAAAAACAAAGGCATGAAGGG - Intronic
1104351565 12:128048516-128048538 GAAAAACACAAAGGTAGCTATGG - Intergenic
1105221015 13:18327167-18327189 CCAAGACACAAAGTGAGCAAAGG + Intergenic
1105816892 13:24044187-24044209 CAAACAAACAAAGGCAGCAGAGG - Intronic
1105898124 13:24735002-24735024 CAAAAATCCAAATGCAGCAATGG - Intergenic
1105901725 13:24760788-24760810 CTCAAACAGAAAGTGAGCAAAGG + Intergenic
1106697377 13:32191373-32191395 CTATAACACACAGTCAGCAGAGG + Intronic
1107279864 13:38721371-38721393 GTAAAACAAAGAGGCAGCCATGG + Intronic
1108497812 13:51042560-51042582 CTGTAACACAAAAGCAGCCATGG + Intergenic
1108967426 13:56327182-56327204 GTAAAACACAAAGGAAGAAATGG + Intergenic
1109039148 13:57309204-57309226 CTAAACAACAAAGACAGCTAAGG - Intergenic
1109212832 13:59554451-59554473 CTCAAAAACACAGGCAACAAAGG + Intergenic
1111392592 13:87617013-87617035 CATAAACCCAAAGGCAGCCATGG + Intergenic
1111751736 13:92340941-92340963 ATAAACCACTAAAGCAGCAAAGG + Intronic
1112995375 13:105568248-105568270 ATAAAACAAAAAGGCCGCACGGG - Intergenic
1113391938 13:109906370-109906392 CAAAAACACAAAGCCAGGAAAGG + Intergenic
1113504153 13:110801669-110801691 CTGAGAAACAAATGCAGCAAGGG - Intergenic
1113803493 13:113098762-113098784 CAGAAACGCAAAGGCAGCAGAGG + Intronic
1116605511 14:46988423-46988445 CTGAAACACCAGGGAAGCAAAGG + Intronic
1119397107 14:74334720-74334742 GTAAAACACAAATGTAGAAATGG + Intronic
1119742100 14:77020531-77020553 CAAAAAAACAAAGGATGCAAAGG - Intergenic
1120192653 14:81453140-81453162 CCACAACACAGAGGCAGAAATGG + Intergenic
1120887708 14:89464674-89464696 CAAAAACAGAAAAGCAGCATGGG - Intronic
1121180902 14:91927969-91927991 CTACTACACAAAGGCACCAAGGG + Intronic
1121603411 14:95222947-95222969 CTAAAACAGAGGTGCAGCAACGG - Intronic
1124659045 15:31530301-31530323 ATAAAGCATAAAGGCAGGAATGG - Intronic
1126838782 15:52695477-52695499 CTTAATCACAAAGGAAGAAAAGG - Intronic
1126855375 15:52834016-52834038 GTAAAAAGCAAAGGCAGAAAAGG - Intergenic
1127211110 15:56775806-56775828 CCAGAACACAAAAGCAGGAAAGG + Intronic
1128265819 15:66265829-66265851 CAAAAACAAAAAACCAGCAAAGG - Intergenic
1130054913 15:80514207-80514229 CAAAACCACAAAGGCAGACAAGG + Intronic
1130620199 15:85453971-85453993 CCAAAGCACAAAGGCTGGAATGG + Intronic
1131147314 15:90022415-90022437 CAAACATGCAAAGGCAGCAAGGG + Intronic
1131363456 15:91816627-91816649 ATTAAACACAAAGGGAGCAGTGG - Intergenic
1133459513 16:5975111-5975133 CTAAACAACATAGGCATCAAAGG - Intergenic
1133679539 16:8108116-8108138 CAAAAAAACAAAGTCAGCCATGG + Intergenic
1135385340 16:22034693-22034715 CTAAACCCCAAAGACATCAAGGG - Intronic
1135837435 16:25839405-25839427 CTAAAACAAAAATGGAGGAAGGG - Intronic
1135912209 16:26571770-26571792 CTAAAATACAAGGGCAGGATAGG + Intergenic
1136484067 16:30559899-30559921 TAAAAACTCAAAGGCAGAAATGG - Intergenic
1137513817 16:49125167-49125189 TTAAAATACAAAGCCAGAAAAGG - Intergenic
1137848713 16:51716656-51716678 CAAAACCACAAAGACAGGAATGG + Intergenic
1138209131 16:55148249-55148271 CTGAAACACAAAGTCAGAACTGG + Intergenic
1138332860 16:56229184-56229206 CAAAAAAACAAAAACAGCAATGG - Intronic
1140399977 16:74663769-74663791 ATAAAACTCAAAGCCTGCAAAGG + Intronic
1140823677 16:78686002-78686024 ATAAAACAAAAGGGCAGGAAAGG + Intronic
1141022437 16:80510038-80510060 CTCAAACTCCAAAGCAGCAATGG + Intergenic
1143669250 17:8385100-8385122 CTGAATCACAGAGACAGCAAGGG - Intergenic
1143929158 17:10402991-10403013 CAAAAACACAAAAGCAGAAAGGG - Intronic
1147791072 17:43014630-43014652 CAAACACACAAAGGCAGCTGTGG + Exonic
1148896587 17:50842579-50842601 CAAGAACACAAAGGCAGGAAGGG + Intergenic
1149084193 17:52694565-52694587 CTAAGACACTAATGAAGCAAGGG + Intergenic
1150887161 17:69100288-69100310 CTAATACACACAGGCTGCATTGG - Intronic
1151194997 17:72425009-72425031 AAAAAACACAGAGGCAGGAAAGG - Intergenic
1153526996 18:6006241-6006263 CTAAAACACAAAGAAGACAAAGG + Intronic
1153577975 18:6541659-6541681 CAAAAGAACAAAGGCAACAAAGG - Intronic
1153739522 18:8108911-8108933 TTAATAAACAAAGGCAGCATGGG + Intronic
1155210762 18:23598899-23598921 CAAAAAGAAAAAAGCAGCAAAGG + Intergenic
1155619998 18:27767745-27767767 CTCAATCATAAAGGCAGCTAGGG + Intergenic
1155967135 18:32046777-32046799 CTAAAACGCCAAGGCTGAAAAGG - Intronic
1156277676 18:35599247-35599269 CTCAAAAACACAGGCAACAAAGG - Intronic
1157578883 18:48761824-48761846 AGAAAACACAAAGGCAGTTAAGG + Intronic
1158292540 18:55957583-55957605 CAAAAACTAAAAGGCAGAAATGG + Intergenic
1159052676 18:63436168-63436190 CTAAAATAAAAAGGAAGCATTGG - Intergenic
1159510617 18:69394355-69394377 CAAATAAACAAAGACAGCAACGG + Intergenic
1159591237 18:70337484-70337506 TTAGAATAAAAAGGCAGCAAAGG + Intronic
1159682023 18:71366881-71366903 CTAATACACCAAGGAAGCCACGG - Intergenic
1160132258 18:76236464-76236486 AAAAAATACAAAGGAAGCAAAGG + Intergenic
1160877007 19:1301197-1301219 ATAAAACACAGAGTCAGGAAAGG - Intergenic
1163093619 19:15039036-15039058 CCAAAACACAAAACCAGCAATGG - Intergenic
1163212092 19:15848592-15848614 ATAAAATAAAAAGGCAACAATGG - Intergenic
1164953064 19:32355173-32355195 CTAAAACACAGAGGCTGTCAAGG - Intronic
1165807722 19:38591668-38591690 CTAAAATAAAAATGCAGCCAGGG + Intronic
1166500754 19:43339462-43339484 CTAAACCCCAAAGCCAGAAAAGG + Intergenic
1166806043 19:45487950-45487972 AAAAAAAAAAAAGGCAGCAAAGG + Intronic
1167572997 19:50301809-50301831 CTTAGACTCAAGGGCAGCAATGG - Exonic
1167794257 19:51699003-51699025 CTAAAAAACAAAGACAGAGAAGG - Intergenic
1167841045 19:52120371-52120393 AATAAACACAAAGGCAGTAACGG + Intronic
1167880072 19:52450203-52450225 CTCAAAAACACAGGCAACAAGGG - Intronic
925446805 2:3933383-3933405 CAAAAACATAAAGTCAGGAAAGG - Intergenic
926682793 2:15676529-15676551 CTAAAACAAAAAAGCAGGATTGG + Intergenic
928057935 2:28077070-28077092 CTAAAACCTAAAGGCTGAAAAGG - Intronic
930229355 2:48827557-48827579 CCAAAACCCAAAGGCTGGAAAGG - Intergenic
930305138 2:49667087-49667109 CTAGAGCCCAAAGGCAACAATGG + Intergenic
930367893 2:50464992-50465014 TTAAAAGTAAAAGGCAGCAATGG + Intronic
931179787 2:59887851-59887873 CAAAAACACAGAGGCAGCACAGG - Intergenic
931675067 2:64686460-64686482 CTAACAAACAGAGGCAGTAAAGG + Intronic
931712400 2:64999884-64999906 CTAATGAACAAATGCAGCAAAGG - Intronic
935138719 2:100332525-100332547 CTGAAATACAAAGGAAGGAAAGG - Intergenic
935353108 2:102172021-102172043 AAAAAAAAAAAAGGCAGCAAAGG - Intronic
935815916 2:106845540-106845562 CCAAAACACAAAGGCATGTAGGG + Intronic
936096364 2:109533134-109533156 CTAAAACAGAAAGGGAGGAAGGG + Intergenic
936634043 2:114235124-114235146 GTACAACAAAAAGTCAGCAATGG - Intergenic
937370505 2:121294227-121294249 CCAAAACACAAATGCAGTCATGG + Intergenic
937713451 2:125004951-125004973 AAAAAACACAATGGCAGAAATGG + Intergenic
940357377 2:152758880-152758902 CCAAAAGACAAAAGCAGTAAGGG - Intronic
940599143 2:155835430-155835452 CTAAAATACAATGGCAGAACAGG - Intergenic
940604975 2:155910325-155910347 CTAAAATACAAGCACAGCAAGGG + Intergenic
942013656 2:171789608-171789630 CGAAAAGACAAAGGAAGGAAGGG + Intronic
942641356 2:178064130-178064152 CTAAAAAACTAAGGCAGAACTGG + Intronic
942828145 2:180205506-180205528 CTAACACTCAATGTCAGCAAAGG + Intergenic
942957544 2:181791063-181791085 CTAAAAGACAAATGCAGTCAGGG + Intergenic
942981071 2:182082756-182082778 CTATAACATACAGGCAGAAAGGG + Intronic
943103729 2:183517202-183517224 TTAAAAAACAATGGCATCAAGGG + Intergenic
943377322 2:187094340-187094362 CTAAAACAGAAAAACTGCAATGG - Intergenic
943645708 2:190406850-190406872 CTAAAACTCAAGTGGAGCAAAGG + Intergenic
944941987 2:204638872-204638894 CTAAGAAACAAAGGCAGAATAGG - Intronic
946177672 2:217931343-217931365 CTAGAACAGTAAGGCAGGAAGGG + Intronic
946891130 2:224278198-224278220 CTAGACCACAAATCCAGCAAAGG - Intergenic
948148525 2:235726785-235726807 CTAAAATAGAAAGGCAGGGAGGG + Intronic
1169462160 20:5805155-5805177 CTCAAAAACAACAGCAGCAAAGG - Intronic
1169918265 20:10705638-10705660 CTAAAACACACAGGCCACACTGG - Intergenic
1170379715 20:15743681-15743703 CTCAAACACAAGTGCAGCGAGGG - Intronic
1171106078 20:22434038-22434060 CTAAAACAGGAAGGCAGAATGGG - Intergenic
1171993456 20:31714378-31714400 CTACAACAGAAATGCTGCAAGGG + Intronic
1173018961 20:39251242-39251264 CTAATAGACAAAAGCAGCACAGG - Intergenic
1173052084 20:39573178-39573200 CAAAAACCTAAAGGCAGCAGGGG + Intergenic
1173262713 20:41451106-41451128 CTGAAACAGAAAGACAGCATAGG + Intronic
1176914192 21:14605086-14605108 TTCAAATACAGAGGCAGCAAGGG + Intronic
1177029293 21:15962484-15962506 CTATAACACAAAGAGGGCAAAGG - Intergenic
1177273543 21:18877760-18877782 CTAGAGCCCAAAGGCAACAATGG + Intergenic
1178254026 21:31034240-31034262 TTAAAACAGAAATGGAGCAAGGG + Intergenic
1178641529 21:34348461-34348483 AAAAAAAAAAAAGGCAGCAAAGG + Intergenic
1182670483 22:31991379-31991401 TGAAAAGACAAAGGCAGCCAGGG + Intergenic
1182730964 22:32492876-32492898 CTAAAACATAAAGGGAATAAGGG + Intronic
1183339714 22:37273425-37273447 CAAGAACACAATGGCAGAAATGG + Intergenic
1185371953 22:50465040-50465062 CTCTGACACAAAGCCAGCAAAGG + Exonic
949485192 3:4531403-4531425 CTCAGACACAAAGGAGGCAAAGG - Intronic
950720080 3:14876284-14876306 CTGTCACACAAAGACAGCAAAGG - Intronic
951541322 3:23784643-23784665 CTAAACCACAAACGCTGCTAGGG - Intergenic
952469464 3:33630910-33630932 GTAAAACACAAAAGGAGGAAGGG + Intronic
953811284 3:46114987-46115009 CTAAAACTCAAAGGCCAAAAAGG - Intergenic
954429943 3:50465180-50465202 TTTGAACACAAAGGCAGCGATGG + Intronic
955543732 3:60005169-60005191 TTCAAACTCAAAGGCAGCTAAGG - Intronic
955583720 3:60453546-60453568 GTAAAACATAAAGGCAGCTATGG + Intronic
955622816 3:60883824-60883846 CTCAAATATAAAGGCAACAAAGG + Intronic
955804701 3:62722120-62722142 CAAAATCACAGAAGCAGCAAGGG + Intronic
957360325 3:79148182-79148204 CTAAAAGACAAAGAAAGAAATGG + Intronic
957598590 3:82301762-82301784 CTAAAACACAATCTAAGCAATGG + Intergenic
958177864 3:90019622-90019644 CTAACACCAAAATGCAGCAAGGG - Intergenic
959105278 3:102058449-102058471 CAAAGACCCAAAGGAAGCAAGGG + Intergenic
959364148 3:105435702-105435724 CTAATACACAAGTGAAGCAATGG - Intronic
959957164 3:112252171-112252193 CTAGAGCTCAAAGGCAACAATGG - Intronic
960358379 3:116680207-116680229 CTAAAATACAAGGGCAGGACAGG - Intronic
960436509 3:117633454-117633476 CTAACACTCAGAGGCAGCCATGG + Intergenic
961386701 3:126526855-126526877 CAAAAACACAGAGGGAGCCAAGG - Intronic
962192269 3:133323907-133323929 CAAAAACATAAAGTCAGGAAGGG + Intronic
963639789 3:147844523-147844545 CTGAAACAGAAAGGCAGAAAAGG + Intergenic
964086906 3:152830072-152830094 GTCAAAGACAAAGACAGCAAAGG + Intergenic
964991929 3:162824956-162824978 CAAAAACACAAAGACAGAAAGGG - Intergenic
965260085 3:166471179-166471201 CAAAAATACAAATGCAGCCAGGG - Intergenic
965581930 3:170277786-170277808 ATAACACCCAAAGGCAGGAATGG - Intronic
966151859 3:176874762-176874784 CCAAAGCCCAAAGGCAACAATGG + Intergenic
966564782 3:181364629-181364651 CTAAGAAACAAAGCCAGCAAAGG + Intergenic
966703072 3:182877641-182877663 CAGAAAAATAAAGGCAGCAAAGG + Intronic
967382352 3:188873261-188873283 CCAGAACACAATAGCAGCAATGG - Intronic
967677042 3:192313014-192313036 CTAAAACATAAAGGATGAAAAGG - Intronic
967723126 3:192836333-192836355 CTAACACACAAAAGCAGCCTGGG + Intronic
969916921 4:10500278-10500300 CAAAGACACACAGGCAGTAACGG - Intronic
970705285 4:18794188-18794210 CTAAAACACAAAGCCCCCACAGG - Intergenic
970928441 4:21481365-21481387 CCAAAACAGAAAGGAAGGAAAGG + Intronic
971058249 4:22937701-22937723 CAAAAATAGAAAGGTAGCAAGGG - Intergenic
971455163 4:26837162-26837184 CTAAACCACAGAGGCATAAAAGG + Intergenic
971546874 4:27897175-27897197 CTAAAACACAATGGCAGAATAGG - Intergenic
972813176 4:42613211-42613233 CCAATACTCAAAGGCAGCAAAGG + Intronic
973666197 4:53162155-53162177 CTAAAAAAAAAAGCAAGCAAGGG - Intronic
974340884 4:60614022-60614044 CTTAGATACAAAGGCAGCACAGG - Intergenic
974359961 4:60864791-60864813 CTGAAACAGAAAAGCAGAAAAGG + Intergenic
975586261 4:75953293-75953315 CTAAAAAACAAAGGAAGTAGGGG + Intronic
976023440 4:80659383-80659405 GTAATACACATAAGCAGCAAAGG + Intronic
976755060 4:88489471-88489493 CCAAAACTCAAAGGCAACTAGGG - Intronic
977394189 4:96451016-96451038 CTAAAGCCCAAAGGCTGAAATGG + Intergenic
978630715 4:110740420-110740442 ATAAAACTCAAAGGAATCAATGG - Intergenic
979899310 4:126198049-126198071 GTAAAACTCAAAGACAGTAAAGG - Intergenic
981245966 4:142538428-142538450 CTAAAACACAGATGTAGTAACGG + Intronic
981787215 4:148495646-148495668 CTAAGACACCAAGGCCCCAAAGG - Intergenic
983993781 4:174156388-174156410 GTAATGGACAAAGGCAGCAAAGG + Intergenic
984226394 4:177040410-177040432 TTAAAACAAAAAATCAGCAAAGG + Intergenic
985137084 4:186797126-186797148 CAAGAACATAACGGCAGCAATGG - Intergenic
985362088 4:189186280-189186302 TTAAAACAAAAAGGCAGGCAAGG - Intergenic
985696400 5:1343226-1343248 GAAAAACACAAAGGCATCTATGG + Intronic
985846146 5:2350252-2350274 ATACAACAAAAAGGCAGAAATGG + Intergenic
985870718 5:2553815-2553837 ATAAAACACAACAGCAGAAAGGG - Intergenic
986596777 5:9430775-9430797 ATAAAATAAAAAGGCAGAAATGG + Intronic
986860180 5:11918392-11918414 TTAAAATACAAAGCCAGGAAAGG - Intergenic
987179134 5:15348087-15348109 GTAAAATAGAAAGGCAGTAATGG + Intergenic
987606413 5:20141665-20141687 TTAGAACACAATTGCAGCAAAGG + Intronic
987766335 5:22236440-22236462 CTAAAACACAAGGCCAGGCACGG + Intronic
987895168 5:23936001-23936023 CTAATAAACAAATTCAGCAAGGG - Intergenic
988239775 5:28594673-28594695 CTAAAAAGCAAAGGTAGCAGGGG - Intergenic
988371391 5:30372580-30372602 TTAGAACAAAAATGCAGCAAAGG - Intergenic
988598588 5:32618083-32618105 CTAAAACAAAATGGCAGCCGGGG - Intergenic
989499923 5:42153661-42153683 CTACAACAGAAAGCCAACAAAGG - Intergenic
991236793 5:64407790-64407812 CTCAAACAGACAGGCAGCAAAGG + Intergenic
993658486 5:90601237-90601259 CAAAAAAAAAAAAGCAGCAAGGG + Intronic
994204539 5:97019669-97019691 CTAAAACACAAAGGCAGCAATGG - Intronic
994539889 5:101080943-101080965 CTTAAAAACAAATGCAGGAAAGG + Intergenic
995541280 5:113188548-113188570 TCAAAACACAAAAGCAGAAAGGG + Intronic
995637841 5:114215473-114215495 CTAACACTCTAAGGCAGGAAGGG + Intergenic
996108952 5:119542319-119542341 CAAAAAAACAAAGGTATCAAAGG - Intronic
996704660 5:126484926-126484948 CTATAATACAAAGGGAGGAAAGG - Intronic
996998820 5:129733285-129733307 CAAAAACAAAAAGGCACAAATGG + Intronic
998629960 5:143887148-143887170 CTCAAGCACAGAGGCAGCAGAGG - Intergenic
998738316 5:145168796-145168818 ATAAAACACAAAGGCAAAGATGG - Intergenic
1000681684 5:164193077-164193099 CTCAAAAACAATGGCAGGAAGGG + Intergenic
1000954731 5:167529792-167529814 ATAGAAAACACAGGCAGCAAAGG + Intronic
1000975937 5:167764546-167764568 CTGAAACACAAAGGCAAGAGTGG - Intronic
1001543787 5:172557628-172557650 CTAAATCACAAACCCTGCAAAGG + Intergenic
1003973919 6:11324846-11324868 TTCAAACACAAAGGCAGCAGTGG + Intronic
1004859036 6:19782123-19782145 ATAGAACAAAAAGGCAGAAAAGG - Intergenic
1004966356 6:20856172-20856194 CTAAAATACAGATGAAGCAATGG - Intronic
1005605312 6:27471834-27471856 CTAAAAAAGAAAGCCAACAAGGG + Intronic
1005622598 6:27634017-27634039 CTAAAACACTCAGTCATCAAAGG - Intergenic
1006245431 6:32730624-32730646 CTATAACGGAAAGGCAGCTAAGG - Intergenic
1007382643 6:41500677-41500699 ATCAAACACAAAGGCTGCAGAGG + Intergenic
1008173097 6:48233909-48233931 CCAAAACCCAAAGGCTGGAAGGG - Intergenic
1008395714 6:51004283-51004305 AAAAAAAAAAAAGGCAGCAACGG + Intergenic
1008806269 6:55432644-55432666 GTAAGACACACAGGAAGCAATGG + Intergenic
1009779530 6:68252131-68252153 CTAAAACATAAAGTCAGGAAAGG - Intergenic
1010376935 6:75181792-75181814 CCAAAAAAAAAAGGCAGGAAGGG + Intronic
1010609056 6:77930227-77930249 ATAGAACAAAAAGGCACCAACGG - Intergenic
1010941699 6:81926590-81926612 TTAAAACTCCAAGGCAGGAATGG - Intergenic
1011302528 6:85891786-85891808 ATCAAAGACAAAGGCTGCAAAGG - Intergenic
1011320758 6:86090210-86090232 CAAAAACACAAAGTCAGGAAAGG - Intergenic
1011714353 6:90088978-90089000 CTAAGACTCGAAGGCAGCACAGG - Exonic
1012381032 6:98619739-98619761 CTAGGACATAAAGGCAGGAAGGG - Intergenic
1013019334 6:106196975-106196997 ATAAAACACAAATGTATCAAGGG + Intronic
1013471593 6:110471426-110471448 CTAAAAGACAAATGCAAGAAAGG + Intronic
1013953708 6:115816552-115816574 ATAGAACAAAAAGGCAGAAAAGG - Intergenic
1015351232 6:132222367-132222389 TTAAAAAAAAATGGCAGCAAGGG + Intergenic
1015682158 6:135820363-135820385 ATAAAAAGCAATGGCAGCAAAGG + Intergenic
1016400163 6:143671425-143671447 CAAAAACACAAAGGAGGTAATGG - Intronic
1017536075 6:155349291-155349313 CTAAAGCCCAAAGGCTGGAATGG + Intergenic
1018252786 6:161888869-161888891 CTAAAAAAGAAATCCAGCAATGG - Intronic
1018651733 6:165998144-165998166 CTAACAAACAAAGGCTGAAAAGG + Intergenic
1021397195 7:20165072-20165094 CTCAGAAACAAAGGCACCAAAGG + Intronic
1021611090 7:22458753-22458775 ATAAAACAGAAAGACAGCCAAGG + Intronic
1022864495 7:34403761-34403783 CTATAACACAAACTCTGCAAGGG + Intergenic
1023199989 7:37686545-37686567 CTAAAATATAAAGGTAGCAAAGG - Intronic
1023453316 7:40311603-40311625 CGAAAGCTCAAAGGCAGGAAAGG - Intronic
1024916516 7:54506111-54506133 CTAAAACAAGAAGGCAGAATGGG + Intergenic
1025098901 7:56119028-56119050 ATAAAAAACAAAGGCAAAAAAGG + Intergenic
1025223373 7:57135385-57135407 AACAAACACAAAGACAGCAATGG - Intronic
1025634177 7:63307037-63307059 AACAAACACAAAGACAGCAATGG - Intergenic
1025648521 7:63441129-63441151 AACAAACACAAAGACAGCAATGG + Intergenic
1025781751 7:64608263-64608285 GGAAAGCACAAAGGCAGCAGAGG - Intergenic
1025870809 7:65432361-65432383 CTACATCACGAATGCAGCAAGGG - Intergenic
1025989801 7:66488475-66488497 ATAAAAAACAAAGGCAAAAAAGG + Intergenic
1026038942 7:66850198-66850220 ATAAAAAACAAAGGCAAAAAAGG - Intergenic
1029944306 7:104515727-104515749 CTTAATCTCAAAGGCTGCAAAGG - Intronic
1029960154 7:104681742-104681764 CTAAATCACATAGGTAGCAAAGG + Intronic
1031381127 7:121087185-121087207 GGCAAACAAAAAGGCAGCAAAGG + Intronic
1031610955 7:123826798-123826820 CTGAAACAGAATGGTAGCAAGGG + Intergenic
1031647110 7:124240065-124240087 TTAAAAAACACAGGCAACAAGGG - Intergenic
1033250429 7:139753791-139753813 CCAGTACACATAGGCAGCAAAGG + Intronic
1034346676 7:150389505-150389527 CCAAAACACACATGCAGCTAGGG - Intronic
1034384429 7:150727455-150727477 ATAGAACAAAAAGGCAGCAAAGG + Intronic
1034588478 7:152117862-152117884 TTAAGACACAAAGACAGCTAAGG - Intronic
1034917377 7:155051999-155052021 CTGGGACACCAAGGCAGCAAAGG + Intergenic
1035870039 8:3127840-3127862 CTAAAGAACAAAGGAAGGAAAGG + Intronic
1036604000 8:10290460-10290482 CTAAACCACAAAGGAGGAAATGG - Intronic
1037297417 8:17415450-17415472 CTCAAAAGCATAGGCAGCAAAGG + Intergenic
1037897737 8:22669267-22669289 CTTAGACACACAGGCTGCAACGG + Intergenic
1038462811 8:27730783-27730805 TTAAAAATCAAAGGCAGCCAGGG - Intergenic
1040981882 8:53252489-53252511 GCAAGACACAAAGGGAGCAAGGG + Intergenic
1041201364 8:55453889-55453911 CTCCAACACAAAGAGAGCAAAGG + Intronic
1042037953 8:64557646-64557668 CTCAAACACAAGGCCAGAAAAGG + Intergenic
1042218684 8:66452306-66452328 CTAAAAGGCAAAGGCAGCCAGGG + Intronic
1042663739 8:71183403-71183425 CAAAGTCACAAAGGCAGTAAAGG - Intergenic
1043479416 8:80638089-80638111 AGAAAACACACAGGTAGCAAGGG - Exonic
1043868883 8:85407183-85407205 ATAAAAGAACAAGGCAGCAAGGG + Intronic
1044346997 8:91116917-91116939 CTATAATCCAAAGGCATCAATGG + Intronic
1046321129 8:112577248-112577270 TGAAAACATAAAGGCAACAAAGG + Intronic
1046441277 8:114258120-114258142 CTAAAACACAATGGGATAAATGG + Intergenic
1046541634 8:115591171-115591193 CTAAATAACAAAGACAGTAAGGG + Intronic
1046694488 8:117323897-117323919 TAACAACACAAAGGCAGAAAGGG + Intergenic
1046699436 8:117383470-117383492 TTATTACACACAGGCAGCAAGGG + Intergenic
1048190793 8:132286481-132286503 CTAAAATACAATGGCAGAACAGG - Intronic
1049048994 8:140177163-140177185 CTAAAACACAAAGGACAAAATGG - Intronic
1049942033 9:555570-555592 CAAGAAGACAAACGCAGCAAAGG - Intronic
1050141716 9:2522879-2522901 ATAAAACACAAAGTCAGAAAAGG + Intergenic
1050444736 9:5707957-5707979 CAACAACAAAAAGGCAGCAGTGG - Intronic
1050797796 9:9566954-9566976 GTCAAATACTAAGGCAGCAAGGG + Intronic
1051556450 9:18388599-18388621 CAAAAAAAAAAAGGCAGCAAAGG - Intergenic
1053086459 9:35227318-35227340 CTAAAACACAAAACCTGGAAAGG - Intronic
1053522618 9:38796350-38796372 CTAATAAACAAATTCAGCAAAGG - Intergenic
1054194846 9:62020773-62020795 CTAATAAACAAATTCAGCAAAGG - Intergenic
1054268027 9:62939104-62939126 CTAGAAAACAAAAGCAGCAGGGG - Intergenic
1054643562 9:67567917-67567939 CTAATAAACAAATTCAGCAAAGG + Intergenic
1054721060 9:68604372-68604394 CAAAAACACAAAGGCAAAAAAGG + Intergenic
1055281604 9:74680784-74680806 CTAAAGCAGGAAGCCAGCAATGG - Intronic
1055634057 9:78256978-78257000 ATAGAACAGAAAGGCAGGAATGG + Intronic
1056421531 9:86432320-86432342 CTAACACAAAAAGGCAATAATGG - Intergenic
1056429084 9:86508940-86508962 CTAAAAACCAAGGGCAGCAGAGG - Intergenic
1056723011 9:89087593-89087615 CTAAAACAAAATGTCAACAAGGG - Intronic
1059127190 9:111701033-111701055 CTATAATGCAAAGTCAGCAAAGG - Intronic
1059246569 9:112854668-112854690 CCCAGACCCAAAGGCAGCAAAGG - Intronic
1060358804 9:122935071-122935093 CTAACACAAAAAAGCAGTAATGG - Intergenic
1061216366 9:129224240-129224262 CTAAAACACAAATGAAGAAGTGG - Intergenic
1186374173 X:8980778-8980800 CAAAAAGAAAAAGGCAGCAGTGG - Intergenic
1187252669 X:17612936-17612958 CTATCACACACAGGCAGCCAAGG - Intronic
1188045486 X:25421617-25421639 CAAAAACATAAAGTCAGGAAAGG - Intergenic
1188714847 X:33448694-33448716 CCAAAACCCAAAGGCTGGAATGG - Intergenic
1188913091 X:35874715-35874737 CTAAAACACAGAAGCAGCCAAGG + Intergenic
1189024250 X:37375026-37375048 GTAAAAAACAAAGACAGCAGAGG - Intronic
1189089804 X:38069629-38069651 CTTAAACACAAAGGAAGAAGAGG - Intronic
1189729219 X:44001121-44001143 CTGAGAGACAAAGGCAGAAAGGG + Intergenic
1190084892 X:47386802-47386824 CTAAAATACACAGGAAACAAAGG - Intronic
1192327571 X:70146082-70146104 CTGAAAAAGAAAGGCAGCCAGGG + Intronic
1192532961 X:71905065-71905087 CCAAGACACACAGCCAGCAATGG + Intergenic
1194064483 X:89244629-89244651 CTAAAACAAATATGGAGCAATGG - Intergenic
1194781554 X:98029839-98029861 CCAAAGCCCAAAGGCAGTAACGG + Intergenic
1195698788 X:107686294-107686316 CCAAAACACACAGCTAGCAAAGG + Intergenic
1196495656 X:116322021-116322043 CAAAAACACAAAGAAAGGAACGG + Intergenic
1196739035 X:119007950-119007972 CTAAAACAAAAAGCCAGAAAAGG - Intronic
1197954089 X:131928311-131928333 CTAAAACATAAAGTAAGGAAAGG + Intergenic
1198719527 X:139601048-139601070 TAAAAACACAATGGCAGAAATGG + Intronic
1199019821 X:142865489-142865511 ATAAAACAAAAAGACAGAAAAGG + Intergenic
1199272893 X:145905888-145905910 CAACAACAAAAAGGCAGCCATGG + Intergenic
1199755744 X:150863417-150863439 CTAAAGCACAAAGCAATCAAAGG + Intronic
1200250615 X:154551965-154551987 CTGAAAGAGAAAGGCAGCAGGGG - Intronic
1200718654 Y:6578711-6578733 CTAAAACAAATATGGAGCAATGG - Intergenic