ID: 994204687

View in Genome Browser
Species Human (GRCh38)
Location 5:97021613-97021635
Sequence GTATCACTTATAACCACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 55}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994204687_994204690 24 Left 994204687 5:97021613-97021635 CCAGCAGTGGTTATAAGTGATAC 0: 1
1: 0
2: 1
3: 9
4: 55
Right 994204690 5:97021660-97021682 GCTGAGTATATGCAGCATAAAGG 0: 1
1: 0
2: 0
3: 11
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994204687 Original CRISPR GTATCACTTATAACCACTGC TGG (reversed) Intronic
914703287 1:150151894-150151916 GAATGACTTCTAACCACTGTAGG - Intronic
916938439 1:169655896-169655918 CCATCACTTATTACCCCTGCTGG - Intergenic
919852580 1:201683204-201683226 ATATCAGTTAAAACCACTGCAGG - Intronic
920188675 1:204178589-204178611 GTCTCACTTGTATGCACTGCTGG - Intergenic
921422935 1:214969641-214969663 GTATCCCTTATTACCAGTCCTGG - Intergenic
1076528054 10:131124958-131124980 GAATCCCTTATAGCCACTGATGG + Intronic
1089921106 11:122210443-122210465 GAATCACTTGTGACCAGTGCAGG - Intergenic
1092114912 12:5993351-5993373 TTCTCAGTTATAAACACTGCAGG - Intronic
1094152069 12:27295873-27295895 GAAGCAGTTATATCCACTGCAGG - Intronic
1101169637 12:102077012-102077034 ACATGACTTAGAACCACTGCAGG + Intronic
1114336370 14:21694887-21694909 GTAACACTGATAACAAATGCTGG - Intergenic
1124185052 15:27517587-27517609 ATTTCATTTATCACCACTGCAGG - Intronic
1126037554 15:44560772-44560794 CAATAACTTATAACCCCTGCTGG + Intronic
1126704372 15:51394046-51394068 GCATCTGTTATAACCACTGTAGG + Intronic
1130049587 15:80472617-80472639 GTGGCACATATTACCACTGCTGG - Intronic
1134796132 16:17038747-17038769 CTCTCACTCATATCCACTGCTGG + Intergenic
1140599366 16:76456976-76456998 GTATTACTTATAACAAATACTGG - Intronic
1146804023 17:35850872-35850894 GCTTGACTTATAACCACTGTGGG + Intronic
1149625523 17:58077770-58077792 TTACTTCTTATAACCACTGCTGG + Intergenic
1153340994 18:3974616-3974638 GTTTCACTTTTAACCAAAGCAGG - Intronic
1153757454 18:8298771-8298793 GCAGCTTTTATAACCACTGCTGG + Intronic
1154091864 18:11371770-11371792 GTATCACTTATAAATATTGATGG - Intergenic
1154256679 18:12787554-12787576 CTATCATTTATAACAACTGAAGG + Intronic
1156413582 18:36862074-36862096 GTATTATTTCTAACAACTGCAGG - Intronic
1158686323 18:59617836-59617858 GTTTGATTTATTACCACTGCAGG + Intronic
1160098589 18:75899654-75899676 GCATCACTTACAACCCATGCCGG + Intergenic
1167872114 19:52379257-52379279 GTAACACTTATATACACTCCAGG + Intronic
927551551 2:24005364-24005386 CTTTCACATATAACCACTACTGG + Intergenic
927888988 2:26736581-26736603 GTATCACTCATAGAAACTGCAGG - Intergenic
930696822 2:54420174-54420196 TTTACACTTATAATCACTGCAGG + Intergenic
941055055 2:160777618-160777640 GTATCATTAAAAACCATTGCTGG - Intergenic
946632071 2:221680781-221680803 GTATCACTTTAAACCACTGTGGG - Intergenic
1172591336 20:36120158-36120180 GAATCACTTATAACCACGCCTGG - Intronic
949313045 3:2721685-2721707 CTATCACTGATAAGCACTACAGG - Intronic
953560875 3:43991873-43991895 ATTTCCCTTATAACGACTGCAGG - Intergenic
957369072 3:79267610-79267632 ATCTCATTTATAAGCACTGCAGG + Intronic
963999462 3:151752259-151752281 GTATCAATAATCACCACTGAGGG + Intronic
970276654 4:14408157-14408179 GTATGAGGAATAACCACTGCAGG + Intergenic
977672495 4:99712259-99712281 TAATCACTAATAACCTCTGCAGG - Intergenic
981542523 4:145860575-145860597 GTATCACTTATCTCCACAGCTGG - Intronic
982659884 4:158193920-158193942 GTACCTGATATAACCACTGCAGG - Intergenic
984877950 4:184386100-184386122 GTATCACTTAGAAACAATACAGG + Intergenic
988108742 5:26786335-26786357 GTATCACATACAACTTCTGCTGG - Intergenic
993112406 5:83674499-83674521 GTATCACTTAGAATCACTTTTGG - Intronic
994204687 5:97021613-97021635 GTATCACTTATAACCACTGCTGG - Intronic
996599200 5:125241991-125242013 GAAACACTTATATACACTGCTGG - Intergenic
996890023 5:128407645-128407667 GTATCTCTTATGTTCACTGCTGG + Intronic
1002163333 5:177330146-177330168 GTACCTGTTAAAACCACTGCAGG + Intergenic
1005294157 6:24407933-24407955 GTATCCCTTGTAACCATCGCAGG + Intronic
1007554994 6:42758281-42758303 GTGTCACTTAAAACCTCTGCTGG + Intronic
1010073821 6:71776737-71776759 ATATCAATTAAAACCAATGCAGG - Intergenic
1016139232 6:140586978-140587000 GTATGATTAAGAACCACTGCTGG - Intergenic
1023068959 7:36409288-36409310 CTATCACTTATTACTACTTCAGG - Intronic
1026253142 7:68688402-68688424 GTAGCACTTAAAACCACAGCTGG + Intergenic
1032297961 7:130659611-130659633 GTATTAATTATAAACACTGCAGG + Intronic
1036385584 8:8276894-8276916 GTCTCACTTATCACCGATGCTGG - Intergenic
1038647277 8:29372492-29372514 GTATCACTTAGAACAGCTGCTGG - Intergenic
1044473482 8:92599478-92599500 GGAACACTTATACACACTGCTGG + Intergenic
1056170064 9:83976634-83976656 GTATTACTGAAAACCATTGCAGG - Intronic
1059153128 9:111966955-111966977 GCATCACTTATCACCACTGATGG + Intergenic
1186221863 X:7357382-7357404 GAATCACTTATAATCAATCCTGG - Intergenic
1186743870 X:12545961-12545983 GTTTCACTTAAAACCACTGCTGG + Intronic
1187319216 X:18225658-18225680 GGAACGCTTATAAACACTGCTGG - Intergenic
1189091532 X:38088320-38088342 TCATCACTATTAACCACTGCTGG + Intronic
1196991259 X:121330996-121331018 GTATCACTTTTAGCAATTGCAGG + Intergenic
1200212505 X:154353012-154353034 GTATCAATGATAAACTCTGCAGG + Exonic