ID: 994206639

View in Genome Browser
Species Human (GRCh38)
Location 5:97043278-97043300
Sequence CATTCACTTGGAACACCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994206639_994206644 9 Left 994206639 5:97043278-97043300 CCTGCGGGTGTTCCAAGTGAATG No data
Right 994206644 5:97043310-97043332 GGGAAATTAATTGCCTGTTTCGG No data
994206639_994206645 21 Left 994206639 5:97043278-97043300 CCTGCGGGTGTTCCAAGTGAATG No data
Right 994206645 5:97043322-97043344 GCCTGTTTCGGTTTCACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994206639 Original CRISPR CATTCACTTGGAACACCCGC AGG (reversed) Intergenic
No off target data available for this crispr