ID: 994207979

View in Genome Browser
Species Human (GRCh38)
Location 5:97057286-97057308
Sequence ACCACCTCCTGCTCTGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994207979_994207986 13 Left 994207979 5:97057286-97057308 CCAGTCCCAGAGCAGGAGGTGGT No data
Right 994207986 5:97057322-97057344 TTTGAGGCAGGAGTGGAGACTGG No data
994207979_994207989 22 Left 994207979 5:97057286-97057308 CCAGTCCCAGAGCAGGAGGTGGT No data
Right 994207989 5:97057331-97057353 GGAGTGGAGACTGGCGTTTGGGG 0: 1
1: 3
2: 4
3: 16
4: 197
994207979_994207983 -3 Left 994207979 5:97057286-97057308 CCAGTCCCAGAGCAGGAGGTGGT No data
Right 994207983 5:97057306-97057328 GGTCTTGGTTTCTTCTTTTGAGG No data
994207979_994207985 6 Left 994207979 5:97057286-97057308 CCAGTCCCAGAGCAGGAGGTGGT No data
Right 994207985 5:97057315-97057337 TTCTTCTTTTGAGGCAGGAGTGG No data
994207979_994207990 23 Left 994207979 5:97057286-97057308 CCAGTCCCAGAGCAGGAGGTGGT No data
Right 994207990 5:97057332-97057354 GAGTGGAGACTGGCGTTTGGGGG 0: 1
1: 4
2: 2
3: 12
4: 171
994207979_994207987 20 Left 994207979 5:97057286-97057308 CCAGTCCCAGAGCAGGAGGTGGT No data
Right 994207987 5:97057329-97057351 CAGGAGTGGAGACTGGCGTTTGG 0: 1
1: 1
2: 2
3: 26
4: 216
994207979_994207988 21 Left 994207979 5:97057286-97057308 CCAGTCCCAGAGCAGGAGGTGGT No data
Right 994207988 5:97057330-97057352 AGGAGTGGAGACTGGCGTTTGGG 0: 1
1: 4
2: 1
3: 23
4: 176
994207979_994207984 1 Left 994207979 5:97057286-97057308 CCAGTCCCAGAGCAGGAGGTGGT No data
Right 994207984 5:97057310-97057332 TTGGTTTCTTCTTTTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994207979 Original CRISPR ACCACCTCCTGCTCTGGGAC TGG (reversed) Intergenic
No off target data available for this crispr