ID: 994215850

View in Genome Browser
Species Human (GRCh38)
Location 5:97136256-97136278
Sequence AGACAGCATCAAGAAAGTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994215850_994215853 -9 Left 994215850 5:97136256-97136278 CCCCGACTTTCTTGATGCTGTCT 0: 1
1: 0
2: 0
3: 14
4: 155
Right 994215853 5:97136270-97136292 ATGCTGTCTTCTGTATCATCTGG 0: 1
1: 0
2: 1
3: 18
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994215850 Original CRISPR AGACAGCATCAAGAAAGTCG GGG (reversed) Intronic
900182706 1:1319322-1319344 AGACTGCATGAAGAAGGTGGTGG - Exonic
901327569 1:8377548-8377570 AGAAAACATCAAGAAAGGTGAGG - Intronic
904649692 1:31995559-31995581 AGACAGCAACCTGAAAGTTGAGG - Intergenic
907349373 1:53813661-53813683 AGACAGCAACACGATAGTGGGGG + Intronic
907401993 1:54229977-54229999 AGAGAGCATCAACAAAATTGAGG + Intronic
908959150 1:69673272-69673294 AGACACCATCAAGAATGTCATGG + Intronic
911268462 1:95772250-95772272 AGACAGCCTCATGAAAGCCATGG - Intergenic
913557764 1:119985851-119985873 AGACACCATGAAGAAATTCTAGG + Intronic
915087324 1:153397520-153397542 GAACAGCATGAAGAAAGTCAGGG + Intergenic
915408225 1:155678903-155678925 TTACAGCATCCAGAAAGTAGAGG - Intronic
915421191 1:155783480-155783502 TTACAGCATCCAGAAAGTAGAGG - Intronic
915730940 1:158053903-158053925 AGAAGGAATCAAGAAAGTGGTGG + Intronic
917121580 1:171649198-171649220 ATACATGATCAAGAAAGTGGTGG + Intronic
917417087 1:174821647-174821669 AAACAGCATGAAGAAATTAGAGG - Intronic
921594093 1:217036430-217036452 AGACTGCATAAAGAAAATTGTGG + Intronic
923543285 1:234904848-234904870 AGAAAACATCAAGAAAGTAATGG - Intergenic
923700400 1:236294633-236294655 AGGTGGAATCAAGAAAGTCGAGG - Intergenic
924003987 1:239586845-239586867 AGACAGAATCTAGAAAGAAGAGG - Intronic
1063602316 10:7493576-7493598 ACAGAGCATCAAGAAAATGGAGG - Intergenic
1063918652 10:10909839-10909861 AGACAGCCTCATGAAAGAGGGGG + Intergenic
1066491064 10:35895512-35895534 AGACAGTATCCAGAAACTTGTGG + Intergenic
1070727937 10:78804733-78804755 AGGCAGCATCAAGGCAGTCCGGG + Intergenic
1072606133 10:96984309-96984331 AGACAGCATAGAGGAAGTCAAGG + Exonic
1073173021 10:101528630-101528652 AAGCAGCAACAAGAAAGTCGAGG - Intronic
1078026441 11:7700222-7700244 AGACAGCATCAGCAGAGTCCTGG - Intronic
1079743380 11:24093417-24093439 AGACAGCATCAAAGAAGTGCAGG + Intergenic
1079894761 11:26104297-26104319 AGACAGTATCAAGACAATTGGGG + Intergenic
1081949705 11:47033735-47033757 ATAGAACATCAAGAAAGTCTGGG - Intronic
1086788154 11:90998547-90998569 AGACAACATCCAGAAAATGGTGG - Intergenic
1088345756 11:108822989-108823011 AGACAGTATCAGCAAAGTCAGGG - Intronic
1091586739 12:1821180-1821202 AGACAGCCCCAAGAAACTCGGGG + Intronic
1096742008 12:53700478-53700500 AGACAAAATCAAGAAAAACGTGG + Intergenic
1101690633 12:107076879-107076901 AGGCAGAAGCAAGAGAGTCGGGG - Intronic
1102314919 12:111879862-111879884 AGACAGTATCAAGTAGGTCGGGG + Intronic
1111277964 13:85976625-85976647 AGACAGTAAAATGAAAGTCGTGG + Intergenic
1113802816 13:113095367-113095389 AGACAGCATGAAGGAAGGCCTGG + Intronic
1119388421 14:74273660-74273682 AGAAATCATCAAGAACGTCAAGG - Intergenic
1119837837 14:77766924-77766946 GGACATCATCAAGAAAGTGAAGG + Intronic
1121645126 14:95513151-95513173 AGAGAGGATCAGGAGAGTCGGGG - Intergenic
1126461315 15:48917933-48917955 AGACAGCAACATGAAATTCCTGG - Intronic
1129029235 15:72606481-72606503 AGAGAGAAGCAAGAAAGTCAGGG - Intergenic
1129037169 15:72657525-72657547 AGAGAGAAGCAAGAAAGTCAGGG - Intronic
1129212718 15:74079701-74079723 AGAGAGAAGCAAGAAAGTCAGGG + Intronic
1129397681 15:75261385-75261407 AGAGAGAAGCAAGAAAGTCAGGG - Intronic
1129401292 15:75285662-75285684 AGAGAGAAGCAAGAAAGTCAGGG - Intronic
1129474888 15:75778356-75778378 AGAGAGAAGCAAGAAAGTCAGGG - Intergenic
1129729859 15:77924022-77924044 AGAGAGAAGCAAGAAAGTCAGGG + Intergenic
1129838657 15:78729960-78729982 AGAGAGAAGCAAGAAAGTCAGGG - Intergenic
1130458371 15:84138046-84138068 AGACAGCATCAACAATGTCAAGG - Intergenic
1130538165 15:84801830-84801852 AGACAGCATGAGCAAAGTCCAGG - Intronic
1135618673 16:23934111-23934133 AGACAGAACCAAGCAAGTCCAGG - Intronic
1136334040 16:29600266-29600288 AGACAGCATAGAGGAAGTGGCGG + Intergenic
1136506338 16:30706061-30706083 AGGAAACATCAAGAAAGACGTGG - Intronic
1149523895 17:57339423-57339445 AGAAAGCATCACGCAAGTGGAGG - Intronic
1150960187 17:69904138-69904160 AGAAAGCATGAAGAATGTCATGG - Intergenic
1151091478 17:71444831-71444853 AGACATCATGAAGAAAGGAGGGG + Intergenic
1153008961 18:520575-520597 ATACAGAATCCAGAAAGTAGTGG - Intergenic
1157398835 18:47368887-47368909 AGAGAACATCATGAAAGTCTGGG - Intergenic
1167669493 19:50841650-50841672 AGACAGGATCAAGTCAGGCGTGG + Intergenic
1168415314 19:56164122-56164144 AGACGGAAGCAAGAAAGTCAAGG - Intergenic
925237569 2:2293039-2293061 AGACAGGATCAAGAAGATAGAGG + Intronic
925338994 2:3121181-3121203 AGACACTATCAAGAAATTGGTGG + Intergenic
925468306 2:4131842-4131864 AAAGAGCATCAAGAAAGTTAGGG - Intergenic
926431988 2:12796778-12796800 AGACAGCGCCAAGAAGGTCCTGG + Intergenic
928063795 2:28142366-28142388 AGACAGCTTCAACAAAATAGAGG + Intronic
929168962 2:38912016-38912038 AGACAGACTCAAGAAAGCCTGGG + Intronic
929645806 2:43626261-43626283 GGACACCATCAAGAAAGTAAAGG + Intergenic
930599771 2:53429659-53429681 AGAAAGCATCAAGGAACTAGAGG + Intergenic
931175917 2:59855216-59855238 AGACAGAAACAAGAAATTCCAGG + Intergenic
931976816 2:67652508-67652530 AGAAGGCATCATGAAAGTAGTGG + Intergenic
933321202 2:80777613-80777635 AGACATCATCAAGCAGGTCAAGG - Intergenic
933641803 2:84770212-84770234 AGACAGCAACAAGAAACCCTGGG + Intronic
937761526 2:125609751-125609773 AGACATGTTCAAGAAAGTTGGGG + Intergenic
940269977 2:151880085-151880107 ATATACCATCAAGAAAGTAGAGG + Intronic
941714939 2:168754056-168754078 AGACAGCATGAGGGAAGTCAGGG + Intronic
944321321 2:198346886-198346908 AGAGAGCATCAAGAAAGAGATGG + Intronic
948805172 2:240450827-240450849 AGGCAGGAGCAAGAAAGTGGAGG + Exonic
1171427053 20:25055835-25055857 TGGGAGCATCTAGAAAGTCGTGG - Intronic
1175530881 20:59673668-59673690 AGACAGCACCAAGCAAGCCCGGG - Intronic
1175983242 20:62751868-62751890 AGACAGCATCCAGATCATCGGGG - Intronic
1177096174 21:16836451-16836473 AAACATTATGAAGAAAGTCGGGG - Intergenic
1177666240 21:24163091-24163113 GGACAGCATTAAGAAAGGCATGG - Intergenic
1178842152 21:36146392-36146414 AGACAGCATCAGGACTGTGGAGG + Exonic
1181311916 22:21949537-21949559 AGACAGCATCAGGAATGGCATGG + Intronic
1184692482 22:46123599-46123621 AGACATCCTCAAGAGAGTCTCGG + Intergenic
1184905117 22:47477537-47477559 GGACACCATCAAGAAAATTGAGG - Intronic
949236002 3:1808808-1808830 AGATAGAATCAAGAAATTTGAGG + Intergenic
949263841 3:2134542-2134564 AGACACCATCAAGAAAACTGAGG - Intronic
950803886 3:15580001-15580023 AGAGAGTATCAAGAAATTGGTGG - Exonic
951231456 3:20184564-20184586 ACACAGTCTCAAGAAAGTCAAGG + Intronic
951610489 3:24487011-24487033 AAACAGCAGAAAGAAAGTCAAGG + Intronic
952239081 3:31511397-31511419 AGGCAGAAGCAAGAGAGTCGGGG - Intergenic
953689847 3:45108414-45108436 AAACAGCATCAAGAAGGACATGG - Intronic
956460692 3:69468779-69468801 CGACTGAATCAAGCAAGTCGAGG + Intronic
957714825 3:83913731-83913753 AGACAGCATGAGGTAAGTCTTGG - Intergenic
958048350 3:88314236-88314258 AGACATGATCAAGAAAATCCAGG - Intergenic
963055214 3:141180998-141181020 AGACAGGTTCAAGAAAGGCTAGG - Intergenic
964530256 3:157660168-157660190 AGACAGCATCATAAAAGGAGGGG + Intronic
976718051 4:88144404-88144426 AGGAAGCAACAAGAAAGGCGAGG - Intronic
981170475 4:141616924-141616946 AGAGAACATCACGAAAGTTGGGG - Intergenic
982764631 4:159331082-159331104 AGACAGAAACTAGAAAGTCAAGG - Intronic
986699960 5:10396758-10396780 AGACAGGACAAAGAAAGTCAGGG + Intronic
986943389 5:12984865-12984887 AGAGAACATCATGAAAGTCTGGG + Intergenic
987091963 5:14516226-14516248 AGACAGGATAAAGAAAATCTGGG + Intronic
987141309 5:14949257-14949279 AGACACCATTAAGAAAGTGAAGG - Intergenic
988970005 5:36457526-36457548 AGAAAGAAGCAAGAAAGTCTGGG + Intergenic
989622319 5:43396932-43396954 CGACAGCAACAAGAAAGGGGTGG + Intronic
990106761 5:52273461-52273483 ATACAGCATAGAGAAAGTAGTGG + Intergenic
994215850 5:97136256-97136278 AGACAGCATCAAGAAAGTCGGGG - Intronic
995871607 5:116749395-116749417 TGGCAGCCTCAAGAAAGTAGGGG + Intergenic
995879128 5:116824026-116824048 AGACAGCATAACGCAAGACGCGG + Intergenic
997078654 5:130711876-130711898 AGACAGCACAAAGAAGGTAGAGG + Intergenic
998796594 5:145826357-145826379 AGCCAGGATCAAGAAAGACAAGG - Intronic
1000255049 5:159529631-159529653 AGTCATAATCAAGAATGTCGAGG + Intergenic
1000447603 5:161343315-161343337 GGACACCATCAAGTAAGTCATGG + Intronic
1001488121 5:172134606-172134628 GGACAGTATCAAGAAAGTAAAGG + Intronic
1001867951 5:175121791-175121813 AAACAGCATCAAGAAACTCAAGG + Intergenic
1001950097 5:175810330-175810352 AGACAGCAGCCAGAAGGTCTGGG - Intronic
1003930200 6:10917254-10917276 AGACAGCAACACGATAATCGTGG - Intronic
1004773528 6:18815328-18815350 AGACAGCATCAAGAATTTCTGGG - Intergenic
1004996093 6:21194680-21194702 AGACAGCATCTAGAAAGTGTAGG + Intronic
1005432879 6:25776875-25776897 AGACAGCACCAAGAAGGTCATGG - Exonic
1006129861 6:31862660-31862682 AGACAGCAGCAGGAAGATCGCGG + Exonic
1006194760 6:32232424-32232446 AGGCACCATCAAGAAAGTGAAGG + Intergenic
1006287381 6:33106982-33107004 AGACACCATCAGGGAAGTAGGGG + Intergenic
1010366880 6:75061135-75061157 AGACAGTTTCAAGAAAGAGGAGG + Intergenic
1010828518 6:80502341-80502363 AGACACCATTAAGAAAATCATGG + Intergenic
1015640957 6:135331826-135331848 AGAAAGCATAAAGAAGGTGGTGG - Intronic
1015644348 6:135369439-135369461 AGACAGCATCAACACAGTTATGG + Intronic
1016656990 6:146530380-146530402 AGAAAGCATCAAGAAAATTAAGG + Intergenic
1016919747 6:149280162-149280184 AGAAAGAAACAAGAAAGTTGTGG - Intronic
1020225824 7:6279203-6279225 AGACAGCAACGAGAAGGTGGCGG - Intergenic
1022132130 7:27414475-27414497 AGTCAGCAGCAAGAAACTCTGGG - Intergenic
1022434432 7:30367571-30367593 AAACAGAAGCAAGAAAGTAGGGG - Exonic
1023846609 7:44124225-44124247 AGACAGCACTCAGAAAGACGTGG - Intronic
1026180291 7:68033592-68033614 AGACAGGATCAAGACAGACAGGG - Intergenic
1027739363 7:81980634-81980656 AGACAGCATTAAGAAATACAGGG + Intronic
1031975437 7:128090593-128090615 AGACAGGGGCAAGAAAGGCGGGG + Intronic
1033508247 7:142027684-142027706 AGACAACATGAGGGAAGTCGTGG + Exonic
1034709820 7:153181446-153181468 TGACAGCATCAAGAAAATTCAGG - Intergenic
1037696826 8:21230819-21230841 TCACAGCATCAAGGAAGTCTGGG + Intergenic
1038732575 8:30140440-30140462 GGACAGAATGAAGAAAGTCAGGG - Intronic
1039585545 8:38704147-38704169 AGACAGCAACAGGAAAGCCACGG + Intergenic
1040485061 8:47862867-47862889 AGACAGCACCAAGTAAGAGGAGG + Intronic
1040609785 8:48972775-48972797 AGACAGCATCAAGAGAGTATTGG - Intergenic
1041611374 8:59853908-59853930 AGAGAACATCATGAAAGTCTGGG - Intergenic
1043040998 8:75261717-75261739 AGACAGCATCAAAATAATAGTGG + Intergenic
1043780715 8:84331497-84331519 AGACAGCTTCAAGAAAGATGTGG - Intronic
1045760616 8:105602103-105602125 TGACAGAATCAAGAAAGTCAAGG - Intronic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1048250593 8:132863781-132863803 AGAAAGCTTCAAGAGAATCGAGG - Intergenic
1048635275 8:136288717-136288739 AGACAGCATCATCAAAATCTTGG + Intergenic
1053015507 9:34659833-34659855 TGCCAGCATCTAGAAAGTCCCGG - Exonic
1056032305 9:82565627-82565649 AGCCTGCATCAAGAAAGACTGGG + Intergenic
1056714002 9:89013702-89013724 AGACAGCATCTCTAAAGTGGTGG - Intronic
1057602563 9:96471434-96471456 AGAAATCATCAAGAAAGGCCAGG - Intronic
1059701749 9:116781704-116781726 AGACTGCATCAAGAAACCCATGG - Intronic
1060734090 9:126055313-126055335 AGACACCATCACTAAAGTGGGGG + Intergenic
1186029010 X:5346672-5346694 AGACAGAAGCAAGAGATTCGGGG - Intergenic
1186308635 X:8292343-8292365 AGATGGCAACAAGATAGTCGTGG + Intergenic
1187492814 X:19768178-19768200 AGACAGCAACAAGATAGCTGAGG - Intronic
1189274589 X:39776293-39776315 AGCCAGCATGAATAAAGTCTAGG + Intergenic
1192141284 X:68649018-68649040 ACACAGCGTCAAGAAAGGCATGG - Intronic
1192911726 X:75611891-75611913 TGACAGCATGAAGAAAGGTGTGG + Intergenic
1194961922 X:100246009-100246031 TTACAGCACAAAGAAAGTCGGGG + Intergenic
1196049169 X:111287262-111287284 AGAAAGCAACAAGAAAGTTGTGG - Intergenic
1196885163 X:120237454-120237476 AGACAGCATAAAGAAAGCCAAGG - Intergenic
1197630377 X:128851594-128851616 AGACAGAATGAAGAAAATAGTGG + Intergenic
1199299039 X:146191427-146191449 AGACAGAATCAGGAAAATGGAGG + Intergenic
1201674114 Y:16559836-16559858 AGGCAGCATCTAGAAACTTGGGG - Intergenic