ID: 994216830

View in Genome Browser
Species Human (GRCh38)
Location 5:97146982-97147004
Sequence GTCTTTATGGGCATTTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994216830 Original CRISPR GTCTTTATGGGCATTTAAGA AGG (reversed) Intronic
900955200 1:5882538-5882560 GTCTTTATGGGGATGTAGCAGGG - Intronic
902366533 1:15978208-15978230 GCATTGATGGGCATTTGAGATGG + Intergenic
906669017 1:47641462-47641484 TTCCTTATGGGCATTTGAGCAGG + Intergenic
909279224 1:73727423-73727445 GTTTTTATGGGGAATAAAGAGGG + Intergenic
909627936 1:77739947-77739969 CTCTTTCTGTGCATCTAAGATGG - Intronic
910076576 1:83287297-83287319 GTCTTTATGAGCATTTTTTATGG - Intergenic
910514500 1:88044992-88045014 GGCTTTAGTGGCATTGAAGAAGG - Intergenic
911210931 1:95137333-95137355 GTCTTTAAGGGCAGCAAAGAAGG - Intronic
918443218 1:184589566-184589588 GTTTTCATGAACATTTAAGAAGG - Intronic
920417974 1:205811438-205811460 TTCTTAATGGGCATTCAAGAAGG - Intronic
1063992981 10:11586325-11586347 GTTTTTTTGGTCATTTAAGATGG - Intronic
1063992983 10:11586352-11586374 TTTTTTTTGGTCATTTAAGATGG - Intronic
1063992985 10:11586381-11586403 TTTTTTTTGGTCATTTAAGATGG - Intronic
1064612795 10:17120973-17120995 CTGTTTATGGGCATTTATCAAGG - Intronic
1064811530 10:19205070-19205092 GTCAGTCTGGGCATTTATGATGG + Exonic
1066550405 10:36549895-36549917 GTCTTTATACTCATTTTAGAAGG - Intergenic
1067728897 10:48794738-48794760 TTCTTTATCAGCATTTAACATGG - Intronic
1072119011 10:92389716-92389738 GTATTCATGGGCATTGAAGTGGG + Intergenic
1072184908 10:93027989-93028011 GTCTTTAATGGCATTTAGAATGG - Intronic
1075171248 10:120117219-120117241 GTCTTTATGGAGATTTCAAAGGG - Intergenic
1075385859 10:122054912-122054934 GTCTTTTTGGTGTTTTAAGAAGG + Intronic
1075944743 10:126422899-126422921 CTCTTTGTGGGCATTTTTGAAGG + Intergenic
1078661227 11:13287973-13287995 ATCTTTATGAGCATTGTAGAAGG + Intronic
1079292362 11:19199764-19199786 GTCTTAAAGGGCATTGAGGATGG - Intronic
1079552870 11:21722506-21722528 CATTTGATGGGCATTTAAGAAGG - Intergenic
1084024854 11:66441497-66441519 GTATTTATGGACCTTAAAGAGGG - Intronic
1085976123 11:81657974-81657996 GTGTCTATGTGCATTTCAGATGG + Intergenic
1087123107 11:94595288-94595310 GTCTTCATTTGCATTTAATAGGG + Exonic
1087243864 11:95811179-95811201 GTCTTGATGGACATTTAGGCTGG - Intronic
1087430418 11:98046492-98046514 GTGTTTACTGGCATTTAAGATGG + Intergenic
1087462678 11:98464539-98464561 GTCACTATGTGCATTTAAGGAGG + Intergenic
1089839150 11:121399261-121399283 GGGTTTATGGGCTTTAAAGATGG + Intergenic
1090044510 11:123319193-123319215 GACTTTATGGGCAGCCAAGAGGG - Intergenic
1094220065 12:27983254-27983276 GACTTTATTCACATTTAAGATGG + Intergenic
1096050435 12:48602706-48602728 GTCTTTATAAGAATTTAAGAAGG - Intergenic
1101971980 12:109321081-109321103 GTTTTTGAGGGCTTTTAAGATGG - Intergenic
1102307593 12:111817483-111817505 GTCTTTTTTGGCAACTAAGAAGG - Intergenic
1102908054 12:116692522-116692544 ATCTTTTTGGGCATTGAAAATGG + Intergenic
1106060563 13:26287234-26287256 TTGTTGATGGGCATTTAAGTGGG - Intronic
1109067401 13:57715965-57715987 GTCTTAATGTGCATTTAAACTGG - Intronic
1110260427 13:73478284-73478306 TTCATTAGGGGCATTTGAGATGG + Intergenic
1111500215 13:89109092-89109114 CACTTTATGGGCAGTTATGAGGG - Intergenic
1112052528 13:95657088-95657110 GTCTTTTTGGTGCTTTAAGAAGG - Intergenic
1115964148 14:38867953-38867975 GTCTTTATGTGTATTTTATATGG + Intergenic
1116970848 14:51063905-51063927 GTATTTATGCCCATTTCAGATGG - Intronic
1119858456 14:77918977-77918999 GTGTTTATGGGCGTTTAAACAGG - Intronic
1120431139 14:84417775-84417797 AACATTATGGGAATTTAAGAAGG - Intergenic
1122297980 14:100716176-100716198 GTGTTTATGGGCATTGAGGAAGG + Intergenic
1123022983 14:105410958-105410980 CTCTTTATGATCATTTCAGAGGG + Intronic
1123771717 15:23535996-23536018 GTCTTTCTGTGAATTTAAGGGGG - Intergenic
1125149539 15:36516250-36516272 GAATTGATGGGAATTTAAGAGGG + Intergenic
1126393730 15:48189364-48189386 AGCTTTATGGGCATTTACCATGG + Intergenic
1126514281 15:49518286-49518308 GTTTTTATAGGATTTTAAGATGG + Intronic
1126624546 15:50673675-50673697 GACTTGATGGGCATTTGAGTTGG + Intronic
1127011047 15:54629030-54629052 CTGTTGATGGGCATTTAGGATGG - Exonic
1127968102 15:63938877-63938899 GAGTTTATGGGAATTCAAGAGGG + Intronic
1129512713 15:76136848-76136870 GTCATTATTGACATTTAAGTAGG - Intronic
1129646980 15:77445152-77445174 GTCTTCATTGGCTTTTGAGAGGG + Intronic
1130897872 15:88184689-88184711 GTCTTTATGGGCAATAACTAAGG - Intronic
1132076579 15:98826077-98826099 TGCTTCATGGGCATTTAACATGG - Intronic
1132381504 15:101369636-101369658 GTGTTTATGGGAACTTAAGAGGG - Intronic
1135018211 16:18941835-18941857 ATGTTTAAGGGCCTTTAAGAGGG - Intergenic
1139255121 16:65533717-65533739 GTATATATGGGCATCAAAGAAGG - Intergenic
1140930545 16:79623666-79623688 GTCCTTATGGCGATTCAAGAAGG - Intergenic
1143219561 17:5249933-5249955 CTCTTGGTGGGCATGTAAGATGG + Intergenic
1143934592 17:10469764-10469786 TTCTTTATAGGCATTTGATAGGG + Intergenic
1144917816 17:18738656-18738678 GTCTTCATGGCCATTCATGAGGG - Intergenic
1145987533 17:29057137-29057159 GATTTTATGGGCATTTGTGATGG - Exonic
1148398869 17:47336042-47336064 GTCTTAAAGAGAATTTAAGAAGG + Intronic
1149440461 17:56669469-56669491 GTATTTAGAGGCATTTAAAATGG - Intergenic
1157516322 18:48314365-48314387 ATCTTGAGGGGCTTTTAAGAGGG - Intronic
1162163691 19:8738677-8738699 GTCTCTTTGGACAATTAAGAGGG - Intergenic
1162241718 19:9360531-9360553 GTATATATGAGCATTTAACAAGG + Intronic
1167878023 19:52430362-52430384 GTCTTTAAGGGGAATTAATAGGG + Intronic
1168192313 19:54748147-54748169 GTCTTTGTGGGCTTTGAGGAAGG - Intronic
1168196638 19:54779424-54779446 GTCTTTGTGGGCTTTGAGGAAGG - Intronic
1168202417 19:54825839-54825861 GTCTTTGTGGGCTTTGAGGAAGG - Intronic
1168207220 19:54859891-54859913 GTCTTTGTGGGCTTTGAGGAAGG - Intronic
1168607686 19:57772767-57772789 GTCTTTATGGGGTTTTATGGAGG + Intronic
927003261 2:18821731-18821753 GTCTCTTTAGGCATTTAACAAGG + Intergenic
928600083 2:32896008-32896030 CTCTTTATGGGGGTTGAAGATGG + Intergenic
930435551 2:51336957-51336979 CTCTTTATGGGTAATAAAGATGG - Intergenic
931241388 2:60455781-60455803 GGTTTTATGGACATTTAATAGGG + Intronic
932316228 2:70785382-70785404 ATCTGTATGGGTATTTAAGAAGG + Intronic
933384828 2:81596919-81596941 GCCTTAATGGGCCTTTAAAAGGG + Intergenic
933509087 2:83216838-83216860 ATCTTTATGTGCATTTATCATGG - Intergenic
937148403 2:119668049-119668071 TCATTTATGGGCATTTAAGTTGG - Intergenic
939535325 2:143420852-143420874 GCATTAATGGGAATTTAAGAAGG + Intronic
940060128 2:149556562-149556584 GTTTTTATTGGCATTTGAAATGG - Intergenic
942697841 2:178665847-178665869 TTCTGTATGTGCAGTTAAGATGG - Intronic
942786031 2:179703863-179703885 GTATTAATGGGCACTTAAGCAGG + Intronic
944116942 2:196197570-196197592 TTCTTTATGGACTTTTCAGAAGG + Exonic
944159144 2:196640354-196640376 GTGTTGGGGGGCATTTAAGACGG - Intronic
944471776 2:200061409-200061431 CTCTTGATGGGCATTTAAGTTGG - Intergenic
947915248 2:233828431-233828453 GTCTGTGTGGGGATTTAATAAGG - Intronic
948345169 2:237290181-237290203 GTCATTATGGGGATTAAATAAGG + Intergenic
1170398472 20:15954199-15954221 GGTATTATGGGCATTCAAGAAGG - Intronic
1173696870 20:45024556-45024578 TTCTCTATAGGCATTTAAGTAGG - Intronic
1174210652 20:48875496-48875518 GGCTTCCTGGGCATCTAAGAGGG + Intergenic
1175124609 20:56741953-56741975 GTCTTTATGGGGATTGAGGGTGG + Intergenic
1175244383 20:57572824-57572846 GTCTTTAGGGGCATGTGTGAGGG + Intergenic
1178125556 21:29512112-29512134 TTCTTTAAGAGGATTTAAGAAGG + Intronic
1179625912 21:42649676-42649698 ATCTTTTTGGGAATTAAAGAGGG + Intergenic
1181170136 22:21003516-21003538 GGGATTATGGGCATGTAAGATGG + Intergenic
1181686646 22:24533771-24533793 GTCTTCAGGGGCAATTATGAAGG + Intergenic
1182745542 22:32603129-32603151 GTATTTATTGTCATGTAAGAAGG + Intronic
953564529 3:44020154-44020176 CTCTTTATCTGCATATAAGAAGG + Intergenic
955945248 3:64187621-64187643 GTTTTTATGGGGGTTTTAGAAGG + Intronic
957522347 3:81335606-81335628 ATCTTTAGGGGAATTTAAGGTGG - Intergenic
959954860 3:112224914-112224936 ATCATTATGGGAATTTAAGAAGG + Intronic
960046849 3:113206934-113206956 GTCATTATGGGGATTCAAGATGG + Intergenic
960775312 3:121244422-121244444 CACATTATGGGAATTTAAGAAGG + Intronic
960927751 3:122812923-122812945 GTCATGATAAGCATTTAAGAGGG + Intronic
960998723 3:123357957-123357979 GTCTTTATGGGGGTGTAAGAAGG - Intronic
966811044 3:183845149-183845171 GTCCTTATTGGCATCGAAGAAGG - Intronic
967487839 3:190054912-190054934 CTGTTTGGGGGCATTTAAGAGGG - Intronic
971535483 4:27743283-27743305 TTTCTTATGGACATTTAAGAAGG + Intergenic
974112347 4:57539944-57539966 TTCTTCATGAGCATTTAAGGTGG + Intergenic
974179383 4:58364096-58364118 GTCCTTTTGGGCTTTTATGAAGG - Intergenic
977658167 4:99548326-99548348 GTCTTTACCTGCATTTAAAATGG - Exonic
978030167 4:103931776-103931798 AACTTTCTTGGCATTTAAGATGG - Intergenic
981078244 4:140612505-140612527 GTTTACATGAGCATTTAAGAAGG + Intergenic
983665573 4:170177833-170177855 GTCTTTATAGAAATTTAAAATGG - Intergenic
986221183 5:5770430-5770452 GTCTTCATGGGGATGGAAGACGG + Intergenic
986485990 5:8237708-8237730 CTATTTATGGGCTTTTAGGATGG + Intergenic
986862591 5:11944902-11944924 GCCTTTGTTGACATTTAAGAAGG + Intergenic
988179495 5:27771785-27771807 GTCTTTATAGGCATGGAATATGG - Intergenic
990061540 5:51655774-51655796 ATCTTTATAAGCTTTTAAGAAGG + Intergenic
990103337 5:52221084-52221106 GTATTTATGGACCTTGAAGAGGG - Intergenic
992916571 5:81459669-81459691 CTTTTTATGGGCATTTAAATAGG + Intronic
994216830 5:97146982-97147004 GTCTTTATGGGCATTTAAGAAGG - Intronic
994977639 5:106830360-106830382 TTCTTTCCGGGCATTTAACATGG + Intergenic
997241879 5:132313808-132313830 CTCTTTCTGGGCCTTTCAGAGGG - Intronic
998558137 5:143145958-143145980 GTCTCTTTAGGCAATTAAGAGGG - Intronic
1001155073 5:169265656-169265678 GTGATTATGGCCATTTAAGATGG - Intronic
1011746507 6:90412446-90412468 GTCATCAAGGGCATTTAAGTAGG + Intergenic
1012181417 6:96157633-96157655 GTCTTCATTGGCATTTCTGAGGG - Intronic
1014039068 6:116803211-116803233 GTATATATGGATATTTAAGAGGG - Intronic
1014218623 6:118777559-118777581 GTATTTAGGGGCATTTCTGACGG + Intergenic
1016361674 6:143274050-143274072 GTCTTTATGCCCATGTCAGAGGG - Intronic
1017432431 6:154384247-154384269 GTCATTTTGGGCATTCCAGAAGG - Intronic
1020216580 7:6196128-6196150 GACTTTATGGGCTTCTCAGAAGG - Intronic
1021929632 7:25567071-25567093 GTCATTTTGGGCCTTTAAGTGGG - Intergenic
1022137690 7:27465096-27465118 GTCTTCATGGGGATTACAGATGG - Intergenic
1023198349 7:37666292-37666314 GTATTTATGGGCCTTAAAGCGGG - Intergenic
1024867089 7:53915545-53915567 GTCTTCAAAGGCATTTATGAAGG - Intergenic
1027294352 7:76752588-76752610 GTCTTTATGAGCATTTTTTATGG - Intergenic
1032309347 7:130768757-130768779 GACATTATGGGAATTTAAGGAGG + Intergenic
1034175132 7:149093764-149093786 CTATTTAAGGGCATTTTAGAGGG - Intergenic
1036220593 8:6918941-6918963 ATATTTATAGGCATTTAATATGG + Intergenic
1038362757 8:26898842-26898864 GTCTTTATAGCCATTTAAGCAGG + Intergenic
1039807079 8:41009396-41009418 GTCTTTGTGGGCATTTAGAGAGG - Intergenic
1041324954 8:56653827-56653849 GTCTTTGTGGTGTTTTAAGAAGG - Intergenic
1041706621 8:60853093-60853115 GTTTTTATGTGCATCCAAGAAGG - Exonic
1042943226 8:74128159-74128181 TTATTTATGGGAATTTGAGATGG + Intergenic
1042960741 8:74301276-74301298 GTCTTCAAAGGCATTTGAGAAGG - Intronic
1044417577 8:91953660-91953682 GCCTTCATGGGATTTTAAGAAGG + Intergenic
1044472665 8:92588119-92588141 GTCTTTATTGGCAATTTCGAAGG + Intergenic
1044506138 8:93022192-93022214 TTCTTTTTGTGCATTTAATATGG + Intergenic
1044620755 8:94188596-94188618 GTCTTTAATAGCACTTAAGATGG + Intronic
1044702113 8:94974440-94974462 CTCTTCCTGGGCATTTAAGAAGG + Intronic
1045360917 8:101432531-101432553 GTCTTTATGGGCACTAAGCAGGG + Intergenic
1046255238 8:111688207-111688229 TTGTTGATGGGCATTTAAGTTGG + Intergenic
1047758639 8:127937783-127937805 ATCTTTATGGGCATCGAACAAGG + Intergenic
1049951570 9:649693-649715 ACCTTGATGGGCCTTTAAGAAGG - Intronic
1052015177 9:23455177-23455199 TTCTTTATTTGCATTTAAAAAGG - Intergenic
1053188011 9:36035784-36035806 GTCTTCATGAGAATTTAAAACGG + Intergenic
1057545886 9:96020513-96020535 GTCTTTGAGGGCATTTTAGGAGG - Intergenic
1186067334 X:5780056-5780078 ATCTTTATTTGCATTTAAAATGG - Intergenic
1191699477 X:64024231-64024253 CTCATTATGGACATTTAATATGG + Intergenic
1192478351 X:71463559-71463581 GCATTTATGGTCATGTAAGATGG + Intronic
1194783255 X:98050286-98050308 GTATATATGGCCATTTAACATGG - Intergenic
1194931966 X:99900013-99900035 GTATTTATGGACCTTTAAGCAGG - Intergenic
1195325655 X:103756232-103756254 GTCTTTCTGGGTTTTTATGAAGG + Intergenic
1196050542 X:111299228-111299250 TTCTTTATGGCCATTTTGGAGGG - Exonic
1198707829 X:139468347-139468369 GTCTTCATGGTCATTTCAGATGG - Intergenic