ID: 994219229

View in Genome Browser
Species Human (GRCh38)
Location 5:97175515-97175537
Sequence CATTTTCCCAAAAGGGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994219229 Original CRISPR CATTTTCCCAAAAGGGTAGT AGG (reversed) Intronic
900343451 1:2199436-2199458 CAATTTCCCAGCAGGGCAGTGGG - Intronic
901408351 1:9065533-9065555 CAGTTTCACAAACAGGTAGTGGG + Intronic
901804185 1:11727294-11727316 TATTTACACAAAAGGGTAGCGGG + Intergenic
901905639 1:12407162-12407184 CATTGTCCCAAGAGGGAAATAGG + Intronic
902027338 1:13393899-13393921 CATTTTTCTAAAAGGGAAATTGG - Intergenic
902274984 1:15332981-15333003 CATTATTCCAAGAGGTTAGTTGG - Intronic
904976825 1:34462895-34462917 CATCTAACCAAAAGGGCAGTGGG + Intergenic
909882387 1:80896310-80896332 AATTTGCCCAAAAGTGTACTTGG + Intergenic
911278341 1:95892493-95892515 CAATTTAACAAAAGAGTAGTGGG - Intergenic
911757911 1:101581953-101581975 CTTTTTGTCAAAAGGGGAGTTGG - Intergenic
916123881 1:161551965-161551987 AATTTTTACAAAAGGGTAGATGG + Intergenic
916133765 1:161633327-161633349 AATTTTTACAAAAGGGTAGATGG + Intronic
918992553 1:191716741-191716763 CATTTTCCCAAGATGGGAATAGG - Intergenic
920019193 1:202941255-202941277 AATTTTCCCAAAATGGTTGGAGG + Exonic
920130935 1:203731333-203731355 CATTTTCCCAGGAGGGAAGATGG - Intronic
920343919 1:205293756-205293778 CAGTTTCACACAAGGGTATTCGG - Intergenic
924052103 1:240089511-240089533 CATTTTCCCACAAAGGAAATTGG - Intronic
924386083 1:243498805-243498827 CATCTTCCAAAAAGAGAAGTGGG - Intronic
1064541905 10:16414030-16414052 CCTGTTCCTAAAAGGGTAGGAGG - Intergenic
1065074126 10:22060015-22060037 TATATTCCCAAAAGTGCAGTTGG + Intergenic
1068039967 10:51811449-51811471 CATATTTCTAAAAGTGTAGTCGG + Intronic
1070374517 10:75816521-75816543 CAATTTCCCAAAAGGGTAAAAGG + Intronic
1071824410 10:89310492-89310514 CCTTTTCCAAAAAGGGCAATAGG - Intronic
1071923829 10:90382335-90382357 CATTTTCCCTAAAGGTTTGAAGG - Intergenic
1072095314 10:92172504-92172526 GATTTTCCCAAAAGGTCACTTGG - Intronic
1074268999 10:111934239-111934261 CGTTTTCCAAAATGAGTAGTGGG - Intergenic
1074585006 10:114759588-114759610 TATTTTCCCAAATGGCAAGTTGG - Intergenic
1074892205 10:117745018-117745040 CATTTTGCCAATAAGGTAGAGGG - Intergenic
1075798424 10:125136849-125136871 CATTCTCCCAAAATGGTAACAGG + Intronic
1075943252 10:126409320-126409342 CATTTTCCCAAAAGGCTCCCAGG - Intergenic
1077972650 11:7211237-7211259 CATTTTACCCAAAGGGCAGAGGG - Intergenic
1080414430 11:32056072-32056094 GTTTTTCCCAAAAGGGTTGCAGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085947365 11:81287518-81287540 CATTTTCCAAATGAGGTAGTTGG - Intergenic
1086055223 11:82638814-82638836 CATTTTCCCTAAAGGGTTGATGG - Intergenic
1089699787 11:120237721-120237743 CATTTTTCCAGAATGGTGGTAGG + Intronic
1094032778 12:26032272-26032294 CATTTTCCCCGAAAGGAAGTGGG + Intronic
1096483337 12:51958329-51958351 AATTTTCCCACAGGGGAAGTAGG + Intronic
1097032946 12:56102670-56102692 CATTTTACACAAAGGGAAGTCGG + Exonic
1099178741 12:79453832-79453854 CATTTTCCCAAAAGGTTTGAAGG + Intergenic
1100623663 12:96306989-96307011 AATTTTCTGAAAAGGGAAGTAGG + Intronic
1101457563 12:104852087-104852109 CATTTTCACAAAAAGTTACTGGG + Intronic
1101849960 12:108393976-108393998 CATTTTACAGAAAGGGAAGTGGG - Intergenic
1104523695 12:129498662-129498684 CATTTGCCCCAAAGTGTATTTGG - Intronic
1108118041 13:47151714-47151736 AATTTTCCCAAAAGGAAAGCAGG - Intergenic
1108948614 13:56058091-56058113 CATTTTCAAAAAAAGGTAGGGGG - Intergenic
1110434063 13:75459623-75459645 CTTTTTCCCAAAACAGTGGTAGG + Intronic
1111115007 13:83764357-83764379 CATTTCCACAAAAGGGAAGCTGG + Intergenic
1112039185 13:95528795-95528817 CATTTTATTAAATGGGTAGTTGG + Intronic
1114853294 14:26406743-26406765 CAATTTCCTAGAAGGATAGTAGG + Intergenic
1121028290 14:90633683-90633705 CATTGGCCCAAAAAGGTAGAAGG - Intronic
1121950789 14:98169516-98169538 CATTTTCCCAGAATGGGAGTTGG - Intergenic
1122301832 14:100735784-100735806 TTTTTTCCCAAAAGGGAAGTGGG - Exonic
1122607381 14:102956239-102956261 CTTCTTCCCAAAAGGCTAGCAGG + Intronic
1126140277 15:45431848-45431870 CAGTTCCCCTAAAGGGTAGGAGG - Intronic
1127498163 15:59531782-59531804 CATTTGCCCAAGAGGGAACTAGG - Intergenic
1127684759 15:61332463-61332485 TATTTTCCCAAAACAGTAGCAGG - Intergenic
1127870262 15:63066900-63066922 TTTTTTCCCAAAAAGATAGTTGG + Intronic
1128432882 15:67615919-67615941 CATTTTCCCAAAAGATTATAAGG - Intronic
1130961735 15:88663933-88663955 GATTTTCCCATCAGGGCAGTGGG - Intergenic
1131339895 15:91589048-91589070 CATTTTTCCTAATGGGCAGTAGG - Intergenic
1131760425 15:95616736-95616758 CATTCTCCCCACAGGGTAATAGG - Intergenic
1133536315 16:6705546-6705568 CATTCTCCAAAAAGGGAAGAAGG + Intronic
1137846160 16:51690272-51690294 CAAGTTCTCAAAAGTGTAGTAGG - Intergenic
1138192300 16:55023895-55023917 CATTTTTTAAAAAGGGTATTTGG + Intergenic
1138794376 16:59950243-59950265 CCTTTTCCAAAGGGGGTAGTTGG + Intergenic
1140983578 16:80136171-80136193 AATTTTCCCCAAAGGTTTGTAGG + Intergenic
1141765353 16:86054657-86054679 ACTTTTCCTAAAAGGGTTGTGGG + Intergenic
1143131082 17:4677416-4677438 CATTTTACAAATAGGCTAGTGGG - Intronic
1148038561 17:44688092-44688114 CATTTTTTTAAAAGGGTAGAAGG - Intronic
1149043230 17:52215467-52215489 CTTGTTCCCAACAGGCTAGTTGG + Intergenic
1150601450 17:66654386-66654408 CATTTTTCCCAAAAGGTGGTTGG - Intronic
1151378594 17:73708977-73708999 CATTTTCTCCAGAGGGAAGTTGG - Intergenic
1155129199 18:22913562-22913584 GATATTCCCCACAGGGTAGTGGG - Intronic
1156613004 18:38749844-38749866 GATTTTTCAAAAGGGGTAGTTGG + Intergenic
1159502045 18:69285661-69285683 AATTTTTCAAAAAGCGTAGTAGG + Intergenic
1159697907 18:71583956-71583978 CATTTTCCCCAACAGGCAGTTGG - Intergenic
1160389036 18:78516517-78516539 CAGATTCCCAAAAGAGAAGTGGG + Intergenic
1164726597 19:30469596-30469618 CACATTCCCCAAAGGGTATTTGG + Intronic
925838263 2:7966411-7966433 AATTGTCCCAAAAGGGAAGGAGG + Intergenic
927039094 2:19210115-19210137 CTTATTCCCAAAGGGGAAGTAGG + Intergenic
927040062 2:19220274-19220296 CATTTTTCCAGATGGATAGTGGG + Intergenic
927371767 2:22363827-22363849 CATTTTCCATAAACGGTGGTGGG - Intergenic
931218537 2:60268059-60268081 CATTTCCCCACAAAGGTAGGTGG - Intergenic
933274500 2:80268909-80268931 CATTTTCAGAAAAGGGTTGCAGG - Intronic
933609755 2:84421872-84421894 CATTTTCCCTATAGGGTCCTTGG + Intergenic
934932855 2:98442453-98442475 CTTTTTCCCAAGAGGGTTTTGGG + Intergenic
935972281 2:108541678-108541700 CATTTTCAGAAAAAGGCAGTGGG - Intronic
937060574 2:118977775-118977797 CCTGTCCCCAAAAGGATAGTGGG + Intronic
937502024 2:122489547-122489569 CTTTTTCCCAAGAGTGTAGTTGG + Intergenic
939418153 2:141928075-141928097 CATTCTCCCCAAAGTGTAGTGGG + Intronic
941576461 2:167238511-167238533 CTTTTTCCCTCAAGGGTATTTGG - Intronic
943065194 2:183078647-183078669 CATTTTCCCGAAAGGCTCGAGGG - Intronic
943473688 2:188328301-188328323 CATTTTCCTGAAAGGGAAGATGG - Intronic
945582941 2:211619267-211619289 TTTTTTCCCCAAAGGGTATTTGG - Exonic
947406356 2:229781560-229781582 CACATTCCCAAAAGGATACTGGG + Intronic
1169035248 20:2445453-2445475 CAGCTTCCCAAAAGGCTGGTGGG - Intergenic
1169745925 20:8942834-8942856 GATTTTACAAAAAGGTTAGTTGG - Intronic
1169896622 20:10511077-10511099 CATTTTGCCAAAAAGGTAAATGG - Intronic
1170586195 20:17735833-17735855 CATTTTCCCCAGAGGGTGGTGGG - Exonic
1171218868 20:23375468-23375490 CATTTTCACAAAAGTGCATTTGG + Exonic
1172929157 20:38570708-38570730 CATTTTCCCAAACAGATAATAGG - Intronic
1183116391 22:35695581-35695603 CATTTTTCCTAAAGGGCAGAGGG - Intergenic
1183997421 22:41645586-41645608 CATTCTCCCAAAACTGTAGTCGG + Intronic
949278334 3:2315373-2315395 CAGTTTCCCAAACGAGAAGTGGG + Intronic
950211236 3:11125109-11125131 CAGTTTCCCAAAAGGCCAGGTGG - Intergenic
951874736 3:27409851-27409873 CATTTTCATAAATGGGTTGTTGG - Intronic
953465221 3:43113994-43114016 CCTTTTCCCAAGAGGGAGGTGGG + Intergenic
953550127 3:43895623-43895645 AATTTTGCCAAAAGAGGAGTGGG - Intergenic
953829646 3:46284871-46284893 CATTTCCCAAAATGTGTAGTTGG - Intergenic
954025558 3:47780808-47780830 TATTTACACAAAAGGGAAGTTGG + Intronic
954369915 3:50164834-50164856 CATTTTCCAGAAAAGGCAGTGGG - Intronic
955607955 3:60726486-60726508 TGTTTTCCCAGATGGGTAGTGGG + Intronic
956138901 3:66126155-66126177 CAGTTGCCCACAGGGGTAGTTGG - Intergenic
956640662 3:71412553-71412575 CATTTTCTTCAAAGGGTAGTTGG - Intronic
956833653 3:73077636-73077658 CATTTTCCAAATTGGGTTGTTGG + Intergenic
957172660 3:76758644-76758666 CATTTTCCCAACAGAGAGGTGGG - Intronic
957824643 3:85425109-85425131 TATTTACTCAAAAGAGTAGTTGG + Intronic
958406078 3:93760638-93760660 CACTTCCCCAAAAGGGCAGCCGG + Intergenic
961630306 3:128293813-128293835 AATTTTTCTAAAAGGGTAATGGG + Intronic
962083127 3:132161621-132161643 CATTTTCCCCATATGGTATTGGG - Intronic
965507498 3:169532575-169532597 CATGTTCCCAGAAGTGGAGTTGG - Intronic
965718680 3:171636300-171636322 AATTTTTTCAAAAAGGTAGTTGG + Intronic
966485012 3:180458774-180458796 CATTTTCCAAAAAGATTATTTGG - Intergenic
970520640 4:16880414-16880436 CATTTTCACAAAAGGGCCATAGG + Intronic
970631666 4:17953426-17953448 CATTTACCCCAAAGGATATTAGG + Intronic
971274705 4:25184914-25184936 CATTTTCTTAAAAGTGTTGTTGG - Intronic
971641770 4:29143135-29143157 GATTTTCCCAAATGAGTAATGGG + Intergenic
973885720 4:55318966-55318988 AATTTTCCCATAAAGGAAGTTGG - Intergenic
974129466 4:57735435-57735457 AATTTGTCCAAAATGGTAGTTGG + Intergenic
974160488 4:58132118-58132140 CATCTTCACAAAATGGTGGTGGG - Intergenic
975174554 4:71272627-71272649 AATTTTCCTAAAAAGGCAGTTGG + Intronic
977226222 4:94394970-94394992 CATTTTTCCAAAATAGTATTTGG + Intergenic
977781841 4:100989791-100989813 CATTTTCCCATAATGCTAATGGG + Intergenic
978579277 4:110216405-110216427 CATTTCCCCAAAGGAGCAGTGGG - Intergenic
979011642 4:115377949-115377971 TATTTTCAAAGAAGGGTAGTAGG - Intergenic
979620792 4:122796829-122796851 CATTCTCCCAAAATAGTAGCTGG + Intergenic
981753894 4:148120092-148120114 CATCTTCCCCATAGGGCAGTAGG - Intronic
982469352 4:155768668-155768690 CCTTTTCACAAAGAGGTAGTTGG - Intronic
982559819 4:156916046-156916068 AATATTCCCAAAAGAGGAGTAGG - Intronic
984484847 4:180354993-180355015 CAATTTCCAAATAGGGTGGTAGG + Intergenic
993088157 5:83390320-83390342 CATTTTCACAAATGAGAAGTAGG + Intergenic
994219229 5:97175515-97175537 CATTTTCCCAAAAGGGTAGTAGG - Intronic
995661790 5:114492433-114492455 CTTTTTCCCAAAAGAGAAGTAGG - Intronic
1000942421 5:167378183-167378205 CATATTACCAAAAAGGAAGTTGG - Intronic
1003614778 6:7645152-7645174 CATTTTTCCAAAGGCCTAGTTGG + Intergenic
1003811054 6:9781266-9781288 CATTTTCCTACAAGAGTATTTGG - Intronic
1005599935 6:27416325-27416347 CAATTACCCAAAAGGATAGAGGG + Intergenic
1008072114 6:47108183-47108205 CATTTTCACAAAGGGGTGGTTGG - Intergenic
1010361674 6:75002431-75002453 TATTTTCACAAAATGGTAGCTGG - Intergenic
1011410585 6:87061986-87062008 CATTTCTCAAAAAGGTTAGTGGG + Intergenic
1011969332 6:93202307-93202329 CATATTCCCATATTGGTAGTGGG + Intergenic
1012968727 6:105704122-105704144 CATTCTCCCAGAAGGGTAAGAGG + Intergenic
1016872201 6:148829377-148829399 CATTTTCCAGATAGGGAAGTTGG - Intronic
1019561698 7:1662491-1662513 CCTCTTCCCCAAAGGGTAGCTGG + Intergenic
1022064761 7:26840839-26840861 CTTTTTCCTAAAAAGGTATTTGG + Intronic
1024143432 7:46485345-46485367 CATTTTCTCCAAAGTGCAGTTGG + Intergenic
1024749643 7:52450380-52450402 CATTTTCTCAAAATTGCAGTTGG + Intergenic
1025824010 7:64996299-64996321 CACTTTCCCAAGAGGATATTTGG - Intronic
1030850626 7:114481468-114481490 AATTTTCCCCAAAGCGTAATAGG + Intronic
1032975458 7:137217547-137217569 AATTTTCCTAAAAGGATATTAGG - Intergenic
1038108838 8:24470431-24470453 AAATATCCCAAAAGGGTAGAGGG + Intronic
1039475208 8:37835904-37835926 CCTTTTCCCAACAGGGCAGAGGG + Intronic
1041372743 8:57180370-57180392 CATTTTCACATAAGGGCTGTTGG + Intergenic
1041647022 8:60263563-60263585 CATGTTCCCAAAAGGGTACCTGG + Intronic
1044375382 8:91464163-91464185 CATTTTCCCACAAGGGTGCCAGG + Intergenic
1044669230 8:94662084-94662106 CTTTTACCCAAAAGGGCAGTTGG + Intronic
1045216133 8:100150361-100150383 CACTTTTCCAGAAGGGTAGAGGG - Intergenic
1045380721 8:101622035-101622057 AATTTTCCCAAGTGGGTGGTGGG - Intronic
1046583115 8:116117907-116117929 CATTTTTACAAAAGAGTAGATGG + Intergenic
1048863341 8:138740188-138740210 CATTTTCCCTCAAGGTCAGTGGG + Intronic
1052254571 9:26439452-26439474 CATTTACCTAAAATGTTAGTTGG + Intergenic
1052413902 9:28153150-28153172 CAATTTCCCAAAAGGCAATTTGG + Intronic
1053283927 9:36838577-36838599 CAGTTTCCCACAAGGGAAGTTGG + Exonic
1055665464 9:78548621-78548643 CATTTTCCCAACAGGTCACTCGG + Intergenic
1058724493 9:107789050-107789072 AACTTTCCAAAAAGGGTAGGGGG + Intergenic
1059659774 9:116389473-116389495 CATTTTCCCAAGAGCTTTGTAGG - Intronic
1062589361 9:137266557-137266579 CATTTTCCCAAAAGGAAGGTGGG - Intronic
1186097994 X:6122915-6122937 CATTTTCCCAAAATGGATCTGGG + Intronic
1186382724 X:9077956-9077978 CATTTTCCCCTAAGGGCATTTGG + Intronic
1186932702 X:14412397-14412419 CATTTTCTCAAATGAGTAATAGG + Intergenic
1187034042 X:15518956-15518978 CTTTTTCCCAAGAGTGGAGTTGG + Intronic
1188223727 X:27571763-27571785 TGTTTTCCCAACAGGATAGTTGG - Intergenic
1188948245 X:36335292-36335314 CATTTTCTAAAAAGGTTGGTAGG - Intronic
1191296686 X:58874962-58874984 CATTCTACCAAAAGTGTATTTGG - Intergenic
1191487039 X:61421482-61421504 CATTCTACCAAAAGTGTATTTGG - Intergenic
1192618534 X:72653030-72653052 CATTTTCCCAAAATGCCAGTCGG - Intronic
1193651778 X:84144381-84144403 CATTTTACCAAGAGGATAGATGG + Intronic
1196121566 X:112056693-112056715 CATTTTCCTAAGAGGGTTGAAGG + Intronic
1199654797 X:149983623-149983645 CGTTTTCCCAAAAAGCTATTAGG + Intergenic