ID: 994222147

View in Genome Browser
Species Human (GRCh38)
Location 5:97208514-97208536
Sequence CTACCACAGCTGAGGCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994222147_994222155 7 Left 994222147 5:97208514-97208536 CCAGAGAGCCTCAGCTGTGGTAG No data
Right 994222155 5:97208544-97208566 AGGAACAGAGGCTGTGAGTAGGG No data
994222147_994222153 -5 Left 994222147 5:97208514-97208536 CCAGAGAGCCTCAGCTGTGGTAG No data
Right 994222153 5:97208532-97208554 GGTAGTATGGGGAGGAACAGAGG No data
994222147_994222154 6 Left 994222147 5:97208514-97208536 CCAGAGAGCCTCAGCTGTGGTAG No data
Right 994222154 5:97208543-97208565 GAGGAACAGAGGCTGTGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994222147 Original CRISPR CTACCACAGCTGAGGCTCTC TGG (reversed) Intergenic
No off target data available for this crispr