ID: 994223321

View in Genome Browser
Species Human (GRCh38)
Location 5:97222072-97222094
Sequence CATGCTGGTGCTACATATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994223321_994223325 1 Left 994223321 5:97222072-97222094 CCCTCATATGTAGCACCAGCATG No data
Right 994223325 5:97222096-97222118 TTAGTAGTAAAATAGGAGATTGG No data
994223321_994223324 -6 Left 994223321 5:97222072-97222094 CCCTCATATGTAGCACCAGCATG No data
Right 994223324 5:97222089-97222111 AGCATGTTTAGTAGTAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994223321 Original CRISPR CATGCTGGTGCTACATATGA GGG (reversed) Intergenic
No off target data available for this crispr