ID: 994224033

View in Genome Browser
Species Human (GRCh38)
Location 5:97231219-97231241
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994224033_994224035 2 Left 994224033 5:97231219-97231241 CCTTGTTCCTCTAGGGGGCAGTG No data
Right 994224035 5:97231244-97231266 TTACTTTTACATCACCAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994224033 Original CRISPR CACTGCCCCCTAGAGGAACA AGG (reversed) Intergenic
No off target data available for this crispr