ID: 994224294

View in Genome Browser
Species Human (GRCh38)
Location 5:97234521-97234543
Sequence CATTCTAAGCAACTATTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994224294_994224297 11 Left 994224294 5:97234521-97234543 CCTTGCAATAGTTGCTTAGAATG No data
Right 994224297 5:97234555-97234577 CTTCATCCATGTTGCTACAAAGG 0: 42
1: 422
2: 10325
3: 22878
4: 11426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994224294 Original CRISPR CATTCTAAGCAACTATTGCA AGG (reversed) Intergenic
No off target data available for this crispr