ID: 994229300

View in Genome Browser
Species Human (GRCh38)
Location 5:97295542-97295564
Sequence AGTGTGATGATACCAAAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
994229297_994229300 3 Left 994229297 5:97295516-97295538 CCTTGTAGTATAGTTTGAAGTCA 0: 12625
1: 6625
2: 4327
3: 3177
4: 2039
Right 994229300 5:97295542-97295564 AGTGTGATGATACCAAAGTCGGG No data
994229296_994229300 26 Left 994229296 5:97295493-97295515 CCATGCTGTTTTGGTTACTGTAG 0: 13252
1: 8037
2: 5226
3: 4639
4: 4233
Right 994229300 5:97295542-97295564 AGTGTGATGATACCAAAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
994229300 Original CRISPR AGTGTGATGATACCAAAGTC GGG Intergenic
No off target data available for this crispr